KR102004479B1 - Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato - Google Patents

Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato Download PDF

Info

Publication number
KR102004479B1
KR102004479B1 KR1020170137334A KR20170137334A KR102004479B1 KR 102004479 B1 KR102004479 B1 KR 102004479B1 KR 1020170137334 A KR1020170137334 A KR 1020170137334A KR 20170137334 A KR20170137334 A KR 20170137334A KR 102004479 B1 KR102004479 B1 KR 102004479B1
Authority
KR
South Korea
Prior art keywords
seq
nos
primer set
set consisting
primer
Prior art date
Application number
KR1020170137334A
Other languages
Korean (ko)
Other versions
KR20180111454A (en
Inventor
박순주
박승혜
김대헌
백소현
Original Assignee
원광대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 원광대학교산학협력단 filed Critical 원광대학교산학협력단
Publication of KR20180111454A publication Critical patent/KR20180111454A/en
Application granted granted Critical
Publication of KR102004479B1 publication Critical patent/KR102004479B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Abstract

본 발명은 야생종 토마토 및 재배종 토마토 판별용 토마토 삽입-결실 마커 프라이머 세트에 관한 것으로, 구체적으로 야생종 토마토인 솔라눔 핌피넬리포리움(S. pimpinellifolium)과 재배종 토마토인 솔라눔 리코퍼시쿰(S. lycopersicum)의 유전자 염기서열을 비교하여 12개의 토마토 염색체 각각에서 5개의 삽입-결실(Indel) 부위를 선별하였고, 상기 Indel 부위를 증폭하기 위한 프라이머를 이용하여 야생종 토마토 솔라눔 핌피넬리포리움과 2종의 재배종 토마토(솔라눔 리코퍼시쿰 및 마이크로-톰(Micro-Tom))을 판별할 수 있음을 확인하였으므로, 본 발명의 토카토 삽입-결실 마커 프라이머 세트를 야생종 토마토 및 재배종 토마토 판별용 프라이머 세트로 이용할 수 있다.The present invention relates to a tomato insert-deletion marker primer set for distinguishing wild tomatoes and cultivated tomatoes. More particularly, the present invention relates to a wild-type tomatoes such as S. pimpinellifolium and cultivar tomatoes such as S. lycopersicum ). Five insert-deleted (Indel) regions were selected from each of the 12 tomato chromosomes. Using the primers for amplifying the Indel region, the wild-type tomato Solanum pimepeneri- Cultivated tomatoes (Solanum Lycopersicum And Micro-Tom), it is possible to use the Tocato insert-deletion marker primer set of the present invention as a primer set for distinguishing wild tomatoes and cultivated tomatoes.

Description

야생종 토마토 및 재배종 토마토 판별용 토마토 삽입-결실 마커 프라이머 세트{Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato}[0001] The present invention relates to a method for preparing a wild-type tomato and a cultivated tomato,

본 발명은 야생종 토마토 및 재배종 토마토 판별용 토마토 삽입-결실(Indel) 마커 프라이머 세트에 관한 것으로, 보다 구체적으로 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 2종의 재배종 토마토(솔라눔 리코퍼시쿰(Solanum lycopersicum ) 및 마이크로-톰(Micro-Tom))를 판별하기 위한 Indel 마커, 상기 마커를 증폭하기 위한 프라이머 세트에 관한 것이다.
The present invention relates to a tomato insert-Indel marker primer set for distinguishing wild tomatoes and cultivated tomatoes. More specifically, the present invention relates to a wild-type tomato Solanum pimpinellifolium and two cultivar tomatoes Solanum lycopersicum ) and Micro-Tom), and a primer set for amplifying the marker.

농산물 시장 개방에 따라 어려움에 처해 있는 국내 농업의 발전과 식량안보 주권을 확립하기 위해서는 고품질 품종개발을 통한 종자산업 육성이 필요하다. 특히, 외국 도입 품종에 의존하고 있는 화훼, 관상, 과수, 기능성 특약용 작물 및 버섯 등 균류의 국산 품종개발 활용이 시급한 실정이다. 세계적인 환경파괴에 따른 생물 다양성의 감소와 국제식물신품종보호동맹 (UPOV) 가입에 따른 품종 로열티 강화 추세에 따라 국산 종자 및 유전자원 지적재산권 확보 필요성이 증대되고 있다. 주요 식물의 유전자 염기서열이 밝혀짐에 따라 유전자의 기능을 밝히는 기능유전체(functional genomics) 연구 소재용의 돌연변이 유전자원의 수요가 급속도로 증가하고 있어, 방사선 등을 이용한 돌연변이 육종기술로 대량의 유용 변이체의 창출과 공급이 필요한 상황이다.
In order to establish domestic agricultural development and food sovereignty, which are in trouble due to the opening of the agricultural products market, it is necessary to nurture the seed industry through the development of high quality varieties. In particular, it is urgent to develop domestic varieties of flora, corn, fruit trees, functional crops, and mushrooms that depend on foreign introduced varieties. The need to secure intellectual property rights for domestic seeds and genetic resources is increasing due to the decline in biodiversity due to global environmental destruction and the tendency to increase the royalties of varieties due to the joining of the International Plant Protection Alliance (UPOV). Functional genomics that reveal the function of genes as the genome sequence of major plants is revealed Demand for mutant genetic resources for research materials is rapidly increasing, and mutation breeding techniques using radiation, etc., It is a situation that needs to be created and supplied.

농산물 시장에서 토마토는 전세계적으로 경제적으로 가장 중요한 작물 중 하나로, 원예작물 중 생산량과 소비량이 1위인 작물이며, 연간 146백만 톤이 생산되고 있다(FAO 2010). 토마토(Solanum lycopersicum L.)는 2배체(2n=24) 작물로 가지과(Solanaceae family)에 속한다. 가지과는 약 90개의 속(genus)을 가지며 종류가 다양하다(D`Arcy 1979). 일반적으로 재배되고 있는 S. lycopersicum과 야생종 S. cheesmaniae, S. chilense, S. habrochaites, S. chmielewskii, S. parviflorum, S. peruvianum, S. pimpinellifolium 등이 알려져 있다(Peralata 2000; Rick 1976). 이처럼 다양한 토마토 종류가 있으나, 재배종 토마토 및 야생종 토마토를 판별하기 위한 연구가 부족한 실정이다.
In the agricultural market, tomatoes are one of the most economically important crops in the world, with crops with the highest production and consumption of horticultural crops, producing 146 million tons per year (FAO 2010). Tomatoes ( Solanum lycopersicum L.) is a diploid (2n = 24) crop belonging to the Solanaceae family. Branches have about 90 genuses and vary in variety (D`Arcy 1979). In general, S. lycopersicum and wild species S. cheesmaniae , S. chilense , S. habrochaites , S. chmielewskii , S. parviflorum , S. peruvianum , S. pimpinellifolium and the like are known (Peralata 2000; Rick 1976). Although there are a variety of tomato varieties, research to identify cultivated tomatoes and wild tomatoes is lacking.

최근 분자유전학이 발달하면서 작물의 육종에 이용되는 품종이나 유전자원의 유전적 다양성과 그들간의 유연관계 분석이 유전 변이의 확대와 품종 육성 효율성 증대에 매우 효과적으로 이용되고 있다. 과거에는 형태적 및 생화학적 특성에 의하여 유전적 다양성을 평가하여 왔으나 이러한 평가방법은 유전적 특성이 가까운 근연종간에는 사용이 매우 제한적이며, 대상형질이 환경의 영향을 받기 때문에 다양성의 평가가 어려운 실정이다.Recently, the development of molecular genetics has enabled the genetic diversity of the varieties or genetic resources used for breeding of crops and the relationship between them to be very effective in expanding genetic variation and increasing breeding efficiency. In the past, genetic diversity has been evaluated by morphological and biochemical characteristics. However, these evaluation methods are very limited in use between closely related genotypes and the evaluation of diversity is difficult because the target traits are affected by the environment to be.

이에 따라, 염색체 내 제한효소 인식부위의 변이의 의해 발생하는 염기서열 길이 차이를 이용한 RFLPs(Restriction Fragment Length Polymorphisms) 방법이 개발되었으나 이 방법은 방사선 동위원소를 사용해야 하는 번거로움이 있다. 이후 PCR(Polymerase Chain Reaction)을 이용한 핵산지문법(fingerprinting)으로서, RAPD(randomly amplified polymorphic DNA) 방법 등이 개발되었다. PCR 방법은 10~20여 개의 뉴클레오티드로 구성된 작은 올리고뉴클레오타이드(이하 프라이머)을 생물체의 DNA 또는 RNA와 결합(annealing)시킨 후, 내열성 DNA 중합 효소(Tag DNA Polymerase)를 첨가하여 합성반응이 반복적으로 이루어지게 하는 방법이다. 이것은 다른 방법에 비해 소량의 DNA(1-50ng)만을 요구하며, 간편하고 빠르게 결과를 확인할 수 있다는 장점을 갖고 있다. PCR 방법으로 분석하는 상기 방법 중 RAPD 방법은 비특이적 PCR 산물이 증폭되므로 재현성이 떨어지는 단점이 있고, AFLP(Amplified Fragment Length polymorphism) 방법은 높은 DNA 다형성(polymorphism) 검출로 각광을 받고 있지만 재현성이 떨어지는 밴드의 출현과 분석이 복잡하다는 단점이 있다. 또한, SSR (single sequence repeat) 방법은 DNA 반복배열인 초위성체(microsatellite) 영역의 염기배열 정보를 근거로 PCR 프라이머를 제작하여 개체 내의 초위성체를 분석하는 방법으로 상기 단순염기서열의 반복수는 품종 간 또는 개체 간에 다르게 때문에 이 부분을 PCR 반응으로 증폭하였을 때 다형화 현상이 나타나게 되며 이를 동물과 식물의 유전 연구에 활발히 이용하고 있으나 고밀도 유전자 지도 제작에는 충분하지 않는 단점이 있다.Thus, RFLPs (Restriction Fragment Length Polymorphisms) have been developed based on differences in nucleotide sequence lengths caused by mutations in restriction enzyme recognition sites in chromosomes. However, this method requires the use of radioactive isotopes. Thereafter, a randomly amplified polymorphic DNA (RAPD) method has been developed as a nucleic acid fingerprinting method using PCR (Polymerase Chain Reaction). In the PCR method, a small oligonucleotide composed of 10 to 20 nucleotides (hereinafter referred to as a "primer") is annealed with DNA or RNA of an organism, and then a heat-resistant DNA polymerase It is a way to lose. This requires only a small amount of DNA (1-50 ng) compared to other methods, and has the advantage of being able to confirm the results easily and quickly. Among these methods, the RAPD method has the disadvantage that the reproducibility is low because the nonspecific PCR product is amplified. The AFLP (Amplified Fragment Length Polymorphism) method is a method for detecting a high DNA polymorphism, There is a disadvantage that the appearance and analysis are complicated. The SSR (Single Sequence Repeat) method is a method of analyzing a supersatellite in an individual by preparing a PCR primer based on nucleotide sequence information in a microsatellite region, which is a DNA repeat sequence, This phenomenon is caused by polymorphism when amplified by PCR reaction, and this gene is actively used for genetic studies of animals and plants, but it is not sufficient for high density gene mapping.

이에 반해 삽입-결실(insertion　or deletion: Indel) 마커를 이용한 방법은 특정 위치에 있는 DNA의 염기서열 분석을 통해 품종간 염기서열의 삽입 또는 결실을 기반으로 PCR 프라이머를 제작하는 방법으로 PCR 반응으로 증폭하였을 때 다형화 현상이 나타나게 하는 장점을 유지하며 고밀도 유전자지도 제작도 가능하게 한다.
On the other hand, the method using the insertion or deletion (Indel) marker is a method of preparing a PCR primer based on insertion or deletion of a nucleotide sequence between cultivars by analyzing the DNA sequence at a specific position. , It is possible to produce a high-density gene map while retaining the advantage of displaying a polymorphism phenomenon.

한편, 토마토 품종 판별을 위한 마커와 관련하여, 토마토의 SSR 마커가 미국(Broun and Tanksley. 1996), 네덜란드(Smulders et al. 1997), 독일(Areshchenkova and Ganal. 1999), 이스라엘(Suliman-pollatchek et al. 2002), 캐나다(He et al. 2003)에서 이미 개발되어 분자 육종 연구에 활용해 오고 있으며, 최근에 국제가지과 식물 유전체 컨소시엄이 조직되면서 608개 이상의 SSR 마커를 개발하여 그 결과를 공개하고 있다(Http://www.sgn.cornell.edu/). 특히 네덜란드에서는 20개의 SSR 마커를 이용하여 토마토 521 품종을 분석하여 이를 데이터베이스화한 바 있고(Bredemeijer et al. 2002), 영국에서는 토마토 품종보호 출원품종의 균일성 분석에 SSR 마커의 이용 가능성을 제시한 바 있으나(Cook et al. 2003), 이들 마커의 염기서열 자체는 공개되어 있지 않고 있는 실정이다. 우리나라의 경우 토마토의 조직배양이나 형질전환 기법에 대한 다양한 연구가 수행되어 왔으나(park et al. 2002), 분자표지인자를 이용한 품종식별에 대한 연구결과는 거의 없는 실정이다.
On the other hand, the SSR markers of tomatoes have been identified in the USA (Smulders et al., 1997), Germany (Areshchenkova and Ganal. 1999), Israel (Suliman-pollatchek et al. (2002) and Canada (He et al., 2003) and have been used in molecular breeding studies. Recently, the international stem and plant genome consortium has been organized and more than 608 SSR markers have been developed and their results are being disclosed (Http://www.sgn.cornell.edu/). In the Netherlands, 20 SSR markers were used to analyze 521 tomato varieties (Bredemeijer et al. 2002), and in the UK, the possibility of using SSR markers in the uniformity analysis of tomato varieties (Cook et al. 2003), but the nucleotide sequence of these markers is not disclosed. In Korea, various studies on the tissue culture and transformation of tomato have been conducted (Park et al., 2002), but there are few studies on the identification of breeds using molecular markers.

이에, 본 발명자들은 토마토 품종을 구별하기 위해 효율적으로 이용될 수 있는 분자표지인자를 개발하기 위해 노력한 결과, 야생종 토마토인 솔라눔 핌피넬리포리움(Solanum pimpinellifolium LA1854)과 재배종 토마토인 솔라눔 리코퍼시쿰(Solanum lycopersicum cv Heinz 1706)의 유전자 염기서열을 비교하여 12개의 토마토 염색체 각각에서 5개의 삽입-결실(Indel) 부위를 선별하였고, 상기 Indel 부위를 증폭하기 위한 프라이머를 이용하여 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 2종의 재배종 토마토(솔라눔 리코퍼시쿰(Solanum lycopersicum cv M82) 및 마이크로-톰(Micro-Tom))을 판별할 수 있음을 밝힘으로써, 본 발명을 완성하였다.
Accordingly, the present inventors have made efforts to develop a molecular marker that can be efficiently used to distinguish tomato varieties. As a result, the present inventors have found that Solanum pimpinellifolium LA1854, a wild tomato, and Solanum pycnolipolium LA1854, ( Solanum lycopersicum cv Heinz 1706). Five insert-deleted (Indel) regions were selected from each of the 12 tomato chromosomes. Using the primers for amplifying the indel regions, the wild-type tomato Solanum pimpinelli Four Leeum (Solanum pimpinellifolium ) and two cultivated tomatoes ( Solanum lycopersicum cv M82) And Micro-Tom) can be discriminated, thereby completing the present invention.

본 발명의 목적은 토마토 삽입-결실(Indel) 마커 프라이머 세트를 포함하는 야생종 토마토와 재배종 토마토를 판별하기 위한 프라이머 세트를 제공하기 위한 것이다.It is an object of the present invention to provide a primer set for discriminating between wild type tomatoes and cultivated tomatoes comprising a set of tomato insert-deletion (Indel) marker primers.

본 발명의 다른 목적은 토마토 삽입-결실(Indel) 마커 프라이머 세트를 이용하여 야생종 토마토와 재배종 토마토를 판별하는 방법을 제공하기 위한 것이다.Another object of the present invention is to provide a method for discriminating between wild tomatoes and cultivated tomatoes using a set of tomato insert-deleted marker primers.

본 발명의 또 다른 목적은 토마토 삽입-결실(Indel) 마커 프라이머 세트를 포함하는 야생종 토마토와 재배종 토마토를 판별하기 위한 키트를 제공하기 위한 것이다.
Another object of the present invention is to provide a kit for discriminating between wild type tomatoes and cultivated tomatoes including a set of tomato insert-deletion (Indel) marker primers.

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 포함하는 야생종 토마토와 재배종 토마토를 판별하기 위한 프라이머 세트를 제공한다.In order to accomplish the object of the present invention, the present invention provides a primer set consisting of SEQ ID NOS: 1 and 2; A primer set consisting of SEQ ID NOS: 3 and 4; A primer set consisting of SEQ ID NOS: 5 and 6; A primer set consisting of SEQ ID NOS: 7 and 8; A primer set consisting of SEQ ID NOS: 9 and 10; A primer set consisting of SEQ ID NOS: 17 and 18; A primer set consisting of SEQ ID NOS: 23 and 24; A primer set consisting of SEQ ID NOS: 25 and 26; A primer set consisting of SEQ ID NOS: 31 and 32; A primer set consisting of SEQ ID NOS: 41 and 42; A primer set consisting of SEQ ID NOS: 63 and 64; A primer set consisting of SEQ ID NOS: 65 and 66; A primer set consisting of SEQ ID NOS: 67 and 68; A primer set consisting of SEQ ID NOS: 69 and 70; A primer set consisting of SEQ ID NOS: 71 and 72; A primer set consisting of SEQ ID NOS: 73 and 74; A primer set consisting of SEQ ID NOS: 75 and 76; A primer set consisting of SEQ ID NOS: 77 and 78; A primer set consisting of SEQ ID NOS: 79 and 80; A primer set consisting of SEQ ID NOS: 81 and 82; A primer set consisting of SEQ ID NOS: 85 and 86; A primer set consisting of SEQ ID NOS: 87 and 88; A primer set consisting of SEQ ID NOS: 91 and 92; A primer set consisting of SEQ ID NOS: 93 and 94; A primer set consisting of SEQ ID NOS: 95 and 96; A primer set consisting of SEQ ID NOS: 97 and 98; A primer set consisting of SEQ ID NOS: 101 and 102; A primer set consisting of SEQ ID NOS: 121 and 122; And a set of primers consisting of SEQ ID NOS: 127 and 128. The primer set includes at least one primer set selected from the group consisting of SEQ.

또한, 본 발명은 In addition,

1) 대상 시료에서 게놈 DNA를 분리하는 단계;1) separating the genomic DNA from the target sample;

2) 상기 단계 1)에서 분리한 게놈 DNA를 주형으로 하고, 상기 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및2) amplifying the target sequence by performing amplification reaction using the genomic DNA isolated in step 1) as a template and using the primer set; And

3) 상기 단계 2)에서 증폭한 산물을 검출하는 단계를 포함하는, 야생종 토마토와 재배종 토마토를 판별하는 방법을 제공한다.3) detecting the amplified product in step 2). The method of discriminating between wild tomato and cultivated tomato is provided.

아울러, 본 발명은 상기 프라이머 세트를 포함하는 야생종 토마토와 재배종 토마토를 판별하기 위한 키트를 제공한다.
In addition, the present invention provides a kit for discriminating between a wild type tomato and a cultivated tomato containing the primer set.

본 발명의 삽입-결실(Indel) 마커 및 상기 마커를 증폭하는 프라이머를 이용하는 경우, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 2종의 재배종 토마토(솔라눔 리코퍼시쿰(Solanum lycopersicum) 및 마이크로-톰(Micro-Tom))의 판별이 가능하며, 특정 표현형의 원인이 되는 변이 유전자의 위치의 예측이 가능하다.
When using the insert marker (Indel) marker of the present invention and the primer amplifying the marker, the wild type tomato Solanum pimplineriolium ( Solanum pimpinellifolium ) and two cultivated tomatoes ( Solanum lycopersicum ) and Micro-Tom), and it is possible to predict the position of a mutation gene that causes a specific phenotype.

도 1은 12개의 토마토 염색체상에서 본 연구에 사용한 삽입-결실(Indel) 마커의 분포를 나타낸 것이다.
도 2는 Indel 마커 프라이머를 이용한 야생종 토마토 솔라눔 핌피넬리포리움(S. pimpinellifolium) 및 재배종 토마토 솔라눔 리코퍼시쿰(S. lycopersicum cv M82)의 Indel 마커 증폭 결과를 나타낸 것으로, Indel 마커의 증폭에 주형(template)으로 사용한 게놈 DNA는 다음과 같다:
p: 야생종 토마토 S. pimpinellifolium의 게놈 DNA;
m: 야생종 토마토 S. pimpinellifolium의 게놈 DNA와 재배종 토마토 S. lycopersicum cv M82의 게놈 DNA 혼합물; 및
c: 재배종 토마토 S. lycopersicum cv M82의 게놈 DNA.
도 3은 Indel 마커 프라이머를 이용한 야생종 토마토 S. pimpinellifolium, 재배종 토마토 S. lycopersicum cv M82 및 재배종 토마토 마이크로-톰(Micro-Tom)의 Indel 마커 증폭 결과를 나타낸 것으로, Indel 마커의 증폭에 주형으로 사용한 게놈 DNA는 다음과 같다:
μ: 재배종 토마토 Micro-Tom의 게놈 DNA;
M8: 재배종 토마토 S. lycopersicum cv M82의 게놈 DNA; 및
p: 야생종 토마토 S. pimpinellifolium의 게놈 DNA.Figure 1 shows the distribution of insert-deleted (Indel) markers used in this study on 12 tomato chromosomes.
FIG. 2 shows the results of a comparison between the wild type S. pimpinellifolium and the cultivar S. lycopersicum using an Indel marker primer cv M82). The genomic DNA used as a template for the amplification of the Indel marker is as follows:
p: genomic DNA of wild type tomato S. pimpinellifolium ;
m: genomic DNA of wild type tomato S. pimpinellifolium and cultivated tomato S. lycopersicum cv genomic DNA mixture of M82; And
c: Cultivated tomatoes S. lycopersicum cv Genomic DNA of M82.
FIG. 3 is a graph showing the results of analysis of wild type tomato S. pimpinellifolium using Indel marker primer, cultivated tomato S. lycopersicum cv M82 and cultivated tomato micro-Tom Indel marker amplification. The genomic DNA used as a template for the amplification of the Indel marker is as follows:
μ: Genomic DNA of cultivated tomato Micro-Tom;
M8: Cultivated tomatoes S. lycopersicum genomic DNA of cv M82; And
p: Genomic DNA of wild-type tomato S. pimpinellifolium .

이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.

본 발명은 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 포함하는 야생종 토마토와 재배종 토마토를 판별하기 위한 프라이머 세트를 제공한다.The present invention relates to a primer set consisting of SEQ ID NOS: 1 and 2; A primer set consisting of SEQ ID NOS: 3 and 4; A primer set consisting of SEQ ID NOS: 5 and 6; A primer set consisting of SEQ ID NOS: 7 and 8; A primer set consisting of SEQ ID NOS: 9 and 10; A primer set consisting of SEQ ID NOS: 17 and 18; A primer set consisting of SEQ ID NOS: 23 and 24; A primer set consisting of SEQ ID NOS: 25 and 26; A primer set consisting of SEQ ID NOS: 31 and 32; A primer set consisting of SEQ ID NOS: 41 and 42; A primer set consisting of SEQ ID NOS: 63 and 64; A primer set consisting of SEQ ID NOS: 65 and 66; A primer set consisting of SEQ ID NOS: 67 and 68; A primer set consisting of SEQ ID NOS: 69 and 70; A primer set consisting of SEQ ID NOS: 71 and 72; A primer set consisting of SEQ ID NOS: 73 and 74; A primer set consisting of SEQ ID NOS: 75 and 76; A primer set consisting of SEQ ID NOS: 77 and 78; A primer set consisting of SEQ ID NOS: 79 and 80; A primer set consisting of SEQ ID NOS: 81 and 82; A primer set consisting of SEQ ID NOS: 85 and 86; A primer set consisting of SEQ ID NOS: 87 and 88; A primer set consisting of SEQ ID NOS: 91 and 92; A primer set consisting of SEQ ID NOS: 93 and 94; A primer set consisting of SEQ ID NOS: 95 and 96; A primer set consisting of SEQ ID NOS: 97 and 98; A primer set consisting of SEQ ID NOS: 101 and 102; A primer set consisting of SEQ ID NOS: 121 and 122; And a set of primers consisting of SEQ ID NOS: 127 and 128. The primer set includes at least one primer set selected from the group consisting of SEQ.

본 발명에서, 상기 야생종 토마토는 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)이고, 상기 재배종 토마토는 솔라눔 리코퍼시쿰(Solanum lycopersicum) 또는 마이크로-톰(Micro-Tom)인 것이 바람직하나, 이에 한정되는 것은 아니다.In the present invention, the wild type tomato is Solanum pimpinellifolium , and the cultivated tomato is preferably Solanum lycopersicum or Micro-Tom, but is limited thereto It is not.

또한, 상기 솔라눔 리코퍼시쿰을 판별하기 위하여, 서열번호 13 및 14로 이루어진 프라이머 세트; 서열번호 15 및 16으로 이루어진 프라이머 세트; 서열번호 21 및 22로 이루어진 프라이머 세트; 서열번호 27 및 28로 이루어진 프라이머 세트; 서열번호 39 및 40으로 이루어진 프라이머 세트; 서열번호 43 및 44로 이루어진 프라이머 세트; 서열번호 53 및 54로 이루어진 프라이머 세트; 서열번호 55 및 56으로 이루어진 프라이머 세트; 서열번호 57 및 58로 이루어진 프라이머 세트; 서열번호 59 및 60으로 이루어진 프라이머 세트; 서열번호 61 및 62로 이루어진 프라이머 세트; 서열번호 119 및 120으로 이루어진 프라이머 세트; 서열번호 123 및 124로 이루어진 프라이머 세트; 및 서열번호 125 및 126으로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가적으로 포함할 수 있다.Also, in order to discriminate the Solanum licococusum, a primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOS: 15 and 16; A primer set consisting of SEQ ID NOS: 21 and 22; A primer set consisting of SEQ ID NOS: 27 and 28; A primer set consisting of SEQ ID NOS: 39 and 40; A primer set consisting of SEQ ID NOS: 43 and 44; A primer set consisting of SEQ ID NOS: 53 and 54; A primer set consisting of SEQ ID NOS: 55 and 56; A primer set consisting of SEQ ID NOS: 57 and 58; A primer set consisting of SEQ ID NOS: 59 and 60; A primer set consisting of SEQ ID NOS: 61 and 62; A primer set consisting of SEQ ID NOS: 119 and 120; A primer set consisting of SEQ ID NOS: 123 and 124; And a set of primers consisting of SEQ ID NOs: 125 and 126. The primer set of SEQ ID NO:

또한, 상기 마이크로-톰을 판별하기 위하여, 서열번호 19 및 20으로 이루어진 프라이머 세트; 서열번호 29 및 30으로 이루어진 프라이머 세트; 서열번호 35 및 36으로 이루어진 프라이머 세트; 서열번호 37 및 38로 이루어진 프라이머 세트; 서열번호 105 및 106으로 이루어진 프라이머 세트; 및 서열번호 107 및 108로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가적으로 포함할 수 있다.Further, in order to identify the micro-tom, a primer set consisting of SEQ ID NOs: 19 and 20; A primer set consisting of SEQ ID NOS: 29 and 30; A primer set consisting of SEQ ID NOS: 35 and 36; A primer set consisting of SEQ ID NOS: 37 and 38; A primer set consisting of SEQ ID NOS: 105 and 106; And a set of primers consisting of SEQ ID NOS: 107 and 108. In addition,

상기 프라이머 세트는 본 발명의 상세한 설명의 표 1에 표시된 재배종 토마토 판별을 위한 삽입-결실(Indel) 마커를 증폭시키기 위한 프라이머 세트에 해당한다.The primer set corresponds to a primer set for amplifying an insert marker for discrimination of cultivated tomatoes shown in Table 1 of the detailed description of the present invention.

본 발명에서 용어, "삽입-결실 마커" 또는 "Indel(Insertion/deletion) 마커"는 DNA의 염기서열에서 일부 염기가 중간에 삽입되거나(insertion) 결실된(deletion) 변이를 총칭한다. 상기 Indel 마커는 표준유전체와 실험에 사용된 품종의 유전체 정보를 비교 분석하는 방법을 통해 표준유전체보다 삽입(insertion) 또는 결실(deletion)된 영역을 탐색하고 그 정보를 바탕으로 프라이머를 제작한다. 따라서 그 증폭 결과는 표준유전체와 비교하여 밴드크기가 큰 경우(insertion)와 작은 경우(deletion)의 두 종류 타입을 나타낼 수 있다.The term "insertion-deletion marker" or "Indel (insertion / deletion) marker" in the present invention collectively refers to a mutation in which some bases are inserted or deleted in the nucleotide sequence of DNA. The Indel marker searches for insertion or deletion regions of the standard dielectric by comparing and analyzing the genomic information of the genotypes used in the experiment and the primers based on the information. Therefore, the amplification result can show two types of insertion and deletion in comparison with the standard genome.

본 발명에서 용어. "표준유전체"는 본 발명의 재배종 토마토 또는 변이된 왜성 토마토를 판별함에 있어 기준이 되는 야생종 토마토 유전체를 의미한다.The term in the present invention. "Standard dielectric" refers to a wild-type tomato genome as a basis for discriminating cultivated tomatoes or dwarf dwarf tomatoes of the present invention.

본 발명에서 용어, "프라이머(primer)"는 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형(template)와 염기쌍(base pair)을 형성할 수 있고 주형의 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 하며, 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라, 온도 및 이온 강도와 같은 이용 조건에 의존할 것이다. 구체적 예로, 프라이머의 구체적인 길이 및 서열은 구아닌 및 시토신의 함량(GC contents), GC배열, 어닐링(annealing) 온도 및 이온 강도 등 여러 조건을 고려하여 결정해야 한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트(dNTPs)의 존재 하에서 DNA 합성을 개시할 수 있다.The term "primer" as used herein refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming a base pair with a complementary template, &Quot; means a short nucleic acid sequence functioning as a starting point for < / RTI > The length and sequence of the primer should allow for the start of the synthesis of the extension product and the specific length and sequence of the primer depends not only on the complexity of the desired DNA or RNA target but also on the conditions of use such as temperature and ionic strength something to do. As a specific example, the specific length and sequence of the primer should be determined in consideration of various conditions such as the contents of guanine and cytosine (GC contents), GC arrangement, annealing temperature and ionic strength. Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates (dNTPs) at appropriate buffer solutions and temperatures.

본 발명에서, 상기 프라이머 세트는, 표적 서열의 증폭을 위하여 사용될 수 있으며, 바람직하게는 재배종 토마토 판별을 위한 삽입-결실(Indel) 마커의 증폭을 위하여 사용될 수 있다.
In the present invention, the primer set can be used for amplification of a target sequence, and can be preferably used for amplification of an insert marker for discrimination of cultivated tomatoes.

본 발명의 구체적인 실시예에서, 본 발명자들은 솔라눔 핌피넬리포리움(Solanum pimpinellifolium (LA1584), S. pimpinellifolium (LA1584)) 및 재배종 토마토인 솔라눔 리코퍼시쿰(Solanum lycopersicum (cv Heinz 1706), S. lycopersicum (cv Heinz 1706))의 유전자 염기서열을 비교하여 12개의 토마토 염색체 각각에서 5개의 삽입-결실(Indel) 부위를 선별하고 표 1에 나타낸 바와 같이 상기 Indel 부위를 증폭하기 위한 64개의 프라이머 세트를 제작하였다.In a specific embodiment of the present invention, the present inventors have found that Solanum < RTI ID = 0.0 > pimpinellifolium (LA1584), S. pimpinellifolium (LA1584)) and cultivated tomatoes Solanum lycopersicum (cv Heinz 1706), and S. lycopersicum (cv Heinz 1706)) were selected and five insert-deleted regions were selected from each of the 12 tomato chromosomes. As shown in Table 1, 64 primer sets were prepared.

또한, 상기 제작한 프라이머 세트 중 43개의 프라이머 세트를 이용하여 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 S. lycopersicum cv M82를 판별할 수 있음을 확인하였다(표 4).In addition, 43 primer sets among the primer sets prepared above were used to prepare wild type tomato S. pimpinellifolium and cultivated tomato S. lycopersicum cv M82 (Table 4).

또한, 상기 제작한 프라이머 세트 중 35개의 프라이머 세트를 이용하여 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 Micro-Tom을 판별할 수 있음을 확인하였다(표 5).In addition, it was confirmed that 35 primer sets among the primer sets prepared above can be used to discriminate the wild-type tomato S. pimpinellifolium and the cultivated tomato Micro-Tom (Table 5).

따라서, 본 발명의 프라이머 세트를 야생종 토마토 S. pimpinellifolium와 재배종 토마토 S. lycopersicum, 및 야생종 토마토 S. pimpinellifolium와 재배종 토마토 Micro-Tom을 판별하기 위한 Indel 마커 프라이머 세트로 이용할 수 있다.
Therefore, the primer set of the present invention can be used as a set of Indel marker primers for discriminating the wild-type tomato S. pimpinellifolium and the cultivated tomato S. lycopersicum , and the wild-type tomato S. pimpinellifolium and the cultivated tomato Micro-Tom.

또한, 본 발명은 In addition,

1) 대상 시료에서 게놈 DNA를 분리하는 단계;1) separating the genomic DNA from the target sample;

2) 상기 단계 1)에서 분리한 게놈 DNA를 주형으로 하고, 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및2) a primer set consisting of SEQ ID NOS: 1 and 2, using the genomic DNA isolated in step 1) as a template; A primer set consisting of SEQ ID NOS: 3 and 4; A primer set consisting of SEQ ID NOS: 5 and 6; A primer set consisting of SEQ ID NOS: 7 and 8; A primer set consisting of SEQ ID NOS: 9 and 10; A primer set consisting of SEQ ID NOS: 17 and 18; A primer set consisting of SEQ ID NOS: 23 and 24; A primer set consisting of SEQ ID NOS: 25 and 26; A primer set consisting of SEQ ID NOS: 31 and 32; A primer set consisting of SEQ ID NOS: 41 and 42; A primer set consisting of SEQ ID NOS: 63 and 64; A primer set consisting of SEQ ID NOS: 65 and 66; A primer set consisting of SEQ ID NOS: 67 and 68; A primer set consisting of SEQ ID NOS: 69 and 70; A primer set consisting of SEQ ID NOS: 71 and 72; A primer set consisting of SEQ ID NOS: 73 and 74; A primer set consisting of SEQ ID NOS: 75 and 76; A primer set consisting of SEQ ID NOS: 77 and 78; A primer set consisting of SEQ ID NOS: 79 and 80; A primer set consisting of SEQ ID NOS: 81 and 82; A primer set consisting of SEQ ID NOS: 85 and 86; A primer set consisting of SEQ ID NOS: 87 and 88; A primer set consisting of SEQ ID NOS: 91 and 92; A primer set consisting of SEQ ID NOS: 93 and 94; A primer set consisting of SEQ ID NOS: 95 and 96; A primer set consisting of SEQ ID NOS: 97 and 98; A primer set consisting of SEQ ID NOS: 101 and 102; A primer set consisting of SEQ ID NOS: 121 and 122; And a primer set consisting of SEQ ID NOS: 127 and 128, and amplifying the target sequence by performing amplification reaction using at least one primer set selected from the group consisting of SEQ ID NOS: And

3) 상기 단계 2)에서 증폭한 산물을 검출하는 단계를 포함하는, 야생종 토마토와 재배종 토마토를 판별하는 방법을 제공한다.3) detecting the amplified product in step 2). The method of discriminating between wild tomato and cultivated tomato is provided.

본 발명의 방법에 있어서, 상기 단계 1)은 대상 시료에서 게놈 DNA를 분리하는 단계로, 상기 대상 시료는 품종을 판별하기 위한 토마토라면 제한 없이 사용할 수 있다.In the method of the present invention, the step 1) is a step of isolating the genomic DNA from the target sample, and the target sample can be used without restriction as long as it is a tomato for discriminating a variety.

상기 게놈 DNA의 추출은 당업계에 공지된 통상적인 방법에 의해 수행할 수 있으며, 예를 들어, 페놀/클로로포름 추출법, SDS 추출법 (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB 분리법(Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), 또는 상업적으로 판매되는 DNA 추출 키트를 이용하여 수행할 수 있으나, 이에 제한되지 않는다.Extraction of the genomic DNA can be carried out by conventional methods known in the art. For example, phenol / chloroform extraction, SDS extraction (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303 , 1990), Cetyl Trimethyl Ammonium Bromide (Murray et al., Nuc. Res., 4321-4325, 1980), or commercially available DNA extraction kits.

본 발명의 방법에 있어서, 상기 단계 2)는 판별하고자 하는 토마토의 게놈 DNA에 대하여 상기 프라이머 세트를 사용하여 표적 서열을 증폭시키는 단계로, 상기 "표적 서열"은 변이 영역에 특이적인 Indel 마커를 의미한다.In the method of the present invention, the step 2) is a step of amplifying the target sequence using the primer set for the genomic DNA of the tomato to be discriminated, and the "target sequence" means an Indel marker specific to the mutation region do.

상기 단계 2)에서 증폭 반응은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 및 Qβ 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 적당한 방법을 제한 없이 사용할 수 있다.
In the step 2), the amplification reaction may be carried out using a polymerase chain reaction (PCR), a ligase chain reaction, nucleic acid sequence-based amplification, a transcription-based amplification system, , Strand displacement amplification and amplification through Q [beta] replicase, or any suitable method for amplifying nucleic acid molecules known in the art can be used without limitation.

본 발명의 방법에 있어서, 상기 야생종 토마토는 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)이고, 상기 재배종 토마토는 솔라눔 리코퍼시쿰(Solanum lycopersicum ) 또는 마이크로-톰(Micro-Tom)인 것이 바람직하나, 이에 한정되는 것은 아니다.In the method of the present invention, the wild-type tomato is selected from the group consisting of Solanum < RTI ID = 0.0 > pimpinellifolium ), and the cultivated tomato was Solanum ( Solanum < RTI ID = 0.0 > lycopersicum) or micro-in to one preferred Tom (Micro-Tom), but it is not limited to such.

또한, 상기 솔라눔 리코퍼시쿰을 판별하기 위하여, 상기 단계 2)에서 서열번호 13 및 14로 이루어진 프라이머 세트; 서열번호 15 및 16으로 이루어진 프라이머 세트; 서열번호 21 및 22로 이루어진 프라이머 세트; 서열번호 27 및 28로 이루어진 프라이머 세트; 서열번호 39 및 40으로 이루어진 프라이머 세트; 서열번호 43 및 44로 이루어진 프라이머 세트; 서열번호 53 및 54로 이루어진 프라이머 세트; 서열번호 55 및 56으로 이루어진 프라이머 세트; 서열번호 57 및 58로 이루어진 프라이머 세트; 서열번호 59 및 60으로 이루어진 프라이머 세트; 서열번호 61 및 62로 이루어진 프라이머 세트; 서열번호 119 및 120으로 이루어진 프라이머 세트; 서열번호 123 및 124로 이루어진 프라이머 세트; 및 서열번호 125 및 126으로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가적으로 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다.Also, in order to discriminate the Solanum licococusum, a primer set consisting of SEQ ID NOs: 13 and 14 in the above step 2); A primer set consisting of SEQ ID NOS: 15 and 16; A primer set consisting of SEQ ID NOS: 21 and 22; A primer set consisting of SEQ ID NOS: 27 and 28; A primer set consisting of SEQ ID NOS: 39 and 40; A primer set consisting of SEQ ID NOS: 43 and 44; A primer set consisting of SEQ ID NOS: 53 and 54; A primer set consisting of SEQ ID NOS: 55 and 56; A primer set consisting of SEQ ID NOS: 57 and 58; A primer set consisting of SEQ ID NOS: 59 and 60; A primer set consisting of SEQ ID NOS: 61 and 62; A primer set consisting of SEQ ID NOS: 119 and 120; A primer set consisting of SEQ ID NOS: 123 and 124; And a primer set consisting of SEQ ID NOS: 125 and 126 may be additionally used to amplify the target sequence.

또한, 상기 마이크로-톰을 판별하기 위하여, 상기 단계 2)에서 서열번호 19 및 20으로 이루어진 프라이머 세트; 서열번호 29 및 30으로 이루어진 프라이머 세트; 서열번호 35 및 36으로 이루어진 프라이머 세트; 서열번호 37 및 38로 이루어진 프라이머 세트; 서열번호 105 및 106으로 이루어진 프라이머 세트; 및 서열번호 107 및 108로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가적으로 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다.
Further, in order to identify the micro-tom, a primer set consisting of SEQ ID NOS: 19 and 20 in the step 2); A primer set consisting of SEQ ID NOS: 29 and 30; A primer set consisting of SEQ ID NOS: 35 and 36; A primer set consisting of SEQ ID NOS: 37 and 38; A primer set consisting of SEQ ID NOS: 105 and 106; And a primer set consisting of SEQ ID NOS: 107 and 108 may be additionally used to amplify the target sequence.

본 발명의 방법에 있어서, 상기 단계 3)은 상기 증폭한 산물을 검출 및 분석하는 단계로, 상기 증폭한 산물의 분석은 DNA 칩, 전기영동, 방사성 측정, 형광 측정 또는 인광 측정 방법으로 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABi Sequencer를 이용할 수 있다. 또한, 겔 전기영동을 수행할 수 있으며, 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행 시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다. 또한, 은염색 키트(Bioneer, Daejeon, Korea)를 사용하여 가시화될 수 있다.
In the method of the present invention, the step (3) is a step of detecting and analyzing the amplified product, and the amplified product can be analyzed by DNA chip, electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement method But is not limited thereto. As one method of detecting the amplification product, capillary electrophoresis can be performed. Capillary electrophoresis, for example, can use the ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is performed, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as 32 P or 35 S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter. It can also be visualized using a silver salt kit (Bioneer, Daejeon, Korea).

또한, 본 발명은 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 포함하는 야생종 토마토와 재배종 토마토를 판별하기 위한 키트를 제공한다.The present invention also relates to a primer set consisting of SEQ ID NOS: 1 and 2; A primer set consisting of SEQ ID NOS: 3 and 4; A primer set consisting of SEQ ID NOS: 5 and 6; A primer set consisting of SEQ ID NOS: 7 and 8; A primer set consisting of SEQ ID NOS: 9 and 10; A primer set consisting of SEQ ID NOS: 17 and 18; A primer set consisting of SEQ ID NOS: 23 and 24; A primer set consisting of SEQ ID NOS: 25 and 26; A primer set consisting of SEQ ID NOS: 31 and 32; A primer set consisting of SEQ ID NOS: 41 and 42; A primer set consisting of SEQ ID NOS: 63 and 64; A primer set consisting of SEQ ID NOS: 65 and 66; A primer set consisting of SEQ ID NOS: 67 and 68; A primer set consisting of SEQ ID NOS: 69 and 70; A primer set consisting of SEQ ID NOS: 71 and 72; A primer set consisting of SEQ ID NOS: 73 and 74; A primer set consisting of SEQ ID NOS: 75 and 76; A primer set consisting of SEQ ID NOS: 77 and 78; A primer set consisting of SEQ ID NOS: 79 and 80; A primer set consisting of SEQ ID NOS: 81 and 82; A primer set consisting of SEQ ID NOS: 85 and 86; A primer set consisting of SEQ ID NOS: 87 and 88; A primer set consisting of SEQ ID NOS: 91 and 92; A primer set consisting of SEQ ID NOS: 93 and 94; A primer set consisting of SEQ ID NOS: 95 and 96; A primer set consisting of SEQ ID NOS: 97 and 98; A primer set consisting of SEQ ID NOS: 101 and 102; A primer set consisting of SEQ ID NOS: 121 and 122; And a set of primers consisting of SEQ ID NOS: 127 and 128. The present invention also provides a kit for discriminating between wild type tomatoes and cultivated tomatoes.

본 발명에서, 상기 야생종 토마토는 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)이고, 상기 재배종 토마토는 솔라눔 리코퍼시쿰(Solanum lycopersicum) 또는 마이크로-톰(Micro-Tom)인 것이 바람직하나, 이에 한정되는 것은 아니다.In the present invention, the wild type tomato is Solanum pimpinellifolium , and the cultivated tomato is preferably Solanum lycopersicum or Micro-Tom, but is limited thereto It is not.

또한, 상기 솔라눔 리코퍼시쿰을 판별하기 위하여, 서열번호 13 및 14로 이루어진 프라이머 세트; 서열번호 15 및 16으로 이루어진 프라이머 세트; 서열번호 21 및 22로 이루어진 프라이머 세트; 서열번호 27 및 28로 이루어진 프라이머 세트; 서열번호 39 및 40으로 이루어진 프라이머 세트; 서열번호 43 및 44로 이루어진 프라이머 세트; 서열번호 53 및 54로 이루어진 프라이머 세트; 서열번호 55 및 56으로 이루어진 프라이머 세트; 서열번호 57 및 58로 이루어진 프라이머 세트; 서열번호 59 및 60으로 이루어진 프라이머 세트; 서열번호 61 및 62로 이루어진 프라이머 세트; 서열번호 119 및 120으로 이루어진 프라이머 세트; 서열번호 123 및 124로 이루어진 프라이머 세트; 및 서열번호 125 및 126으로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가적으로 포함할 수 있다.Also, in order to discriminate the Solanum licococusum, a primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOS: 15 and 16; A primer set consisting of SEQ ID NOS: 21 and 22; A primer set consisting of SEQ ID NOS: 27 and 28; A primer set consisting of SEQ ID NOS: 39 and 40; A primer set consisting of SEQ ID NOS: 43 and 44; A primer set consisting of SEQ ID NOS: 53 and 54; A primer set consisting of SEQ ID NOS: 55 and 56; A primer set consisting of SEQ ID NOS: 57 and 58; A primer set consisting of SEQ ID NOS: 59 and 60; A primer set consisting of SEQ ID NOS: 61 and 62; A primer set consisting of SEQ ID NOS: 119 and 120; A primer set consisting of SEQ ID NOS: 123 and 124; And a set of primers consisting of SEQ ID NOs: 125 and 126. The primer set of SEQ ID NO:

또한, 상기 마이크로-톰을 판별하기 위하여, 서열번호 19 및 20으로 이루어진 프라이머 세트; 서열번호 29 및 30으로 이루어진 프라이머 세트; 서열번호 35 및 36으로 이루어진 프라이머 세트; 서열번호 37 및 38로 이루어진 프라이머 세트; 서열번호 105 및 106으로 이루어진 프라이머 세트; 및 서열번호 107 및 108로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가적으로 포함할 수 있다.Further, in order to identify the micro-tom, a primer set consisting of SEQ ID NOs: 19 and 20; A primer set consisting of SEQ ID NOS: 29 and 30; A primer set consisting of SEQ ID NOS: 35 and 36; A primer set consisting of SEQ ID NOS: 37 and 38; A primer set consisting of SEQ ID NOS: 105 and 106; And a set of primers consisting of SEQ ID NOS: 107 and 108. In addition,

본 발명에서, 상기 키트에는 증폭 반응을 수행하기 위한 시약 및 필요에 따라 제한효소를 포함할 수 있으며, 상기 증폭 반응을 수행하기 위한 시약은 DNA 중합효소, dNTPs 및 반응완충액을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 설명서를 추가로 포함할 수 있다.
In the present invention, the kit may contain a reagent for performing an amplification reaction and, if necessary, a restriction enzyme, and the reagent for performing the amplification reaction may include a DNA polymerase, dNTPs, and a reaction buffer. In addition, the kit of the present invention may further include a user's manual describing optimal reaction performing conditions.

이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 한정되는 것은 아니다.
However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the present invention is not limited to the following Examples and Experimental Examples.

<< 실시예Example 1> 야생종 토마토 및  1> wild tomato and 재배종Cultivar 토마토 판별용Tomato identification 삽입-결실( Insertion - deletion ( IndelIndel ) ) 마커Marker 선별 Selection

본 발명의 마커 선별을 위하여, 야생종 토마토인 솔라눔 핌피넬리포리움 LA1584(Solanum pimpinellifolium LA1584, S. pimpinellifolium LA1584) 및 재배종 토마토인 솔라눔 리코퍼시쿰 cv Heinz 1706(Solanum lycopersicum cv Heinz 1706, S. lycopersicum cv Heinz 1706)의 유전자 염기서열을 비교하여 12개의 토마토 염색체 각각에서 5개의 삽입-결실(Indel) 부위를 선별하고 상기 Indel 부위를 증폭하기 위한 프라이머를 제작하였다.In order to select the markers of the present invention, wild type tomatoes Solanum pimpinellifolium LA1584 and S. pimpinellifolium LA1584 and cultivated tomatoes Solinum piscuit cv Heinz 1706 ( Solanum lycopersicum cv Heinz 1706, and S. lycopersicum cv Heinz 1706) were selected, and five insert-deleted (Indel) sites were selected from each of 12 tomato chromosomes, and a primer for amplifying the indel site was prepared.

구체적으로, 기존에 구축된 데이터베이스(https://solgenomics.net/organism/Solanum_lycopersicum/tomato_150)로부터 제공되는 재배종 토마토와 야생종 토마토의 유전체 염기서열로서 S. lycopersicum cv Heinz 1706 유전체 염기서열과 S. pimpinellifolium LA1584 유전체 염기서열 비교정보상에 나타나는 Indel 위치정보(ftp://ftp.solgenomics.net/genomes/tomato_150/)들을 이용하여 12개의 토마토 염색체에서 Indel 위치를 확인하였으며 데이터베이스상에서 유추되는 삽입 또는 결실 염기쌍의 길이를 크기별로 분류하였고, 염색체 위치별 Indel 사이즈가 25염기쌍 이상되는 것을 선별하였다. 그리고 Indel 위치 위아래 염기서열의 150염기쌍 이내에 프라이머를 제작하였다. 도 1에 나타낸 바와 같이 적절한 간격을 두고 각 염색체에서 5개의 Indel 마커를 선별하였다. 또한, 상기 선별한 Indel 마커 부위를 증폭할 수 있는 프라이머 제작하여 하기 표 1에 나타내었다.
Specifically, S. lycopersicum cv Heinz 1706 genome sequence and S. pimpinellifolium LA1584 (SEQ ID NO: 1) were used as the genomic sequence of cultivated tomatoes and wild-type tomatoes provided from a database (https://solgenomics.net/organism/Solanum_lycopersicum/tomato_150) Indel position was confirmed on 12 tomato chromosomes using Indel location information (ftp://ftp.solgenomics.net/genomes/tomato_150/) on the genome sequence comparison information and the length of inserted or deleted base pairs deduced on the database Size, and indel size of more than 25 base pairs per chromosome location. The primers were constructed within 150 bases of nucleotide sequence upstream and downstream of the Indel site. Five Indel markers were selected from each chromosome at appropriate intervals as shown in Fig. In addition, a primer capable of amplifying the selected Indel marker region was prepared and shown in Table 1 below.

Chromo-
some
locationChromo-
some
location Forward primer
(5'→3')
Forward primer
(5 '- &gt;3')
서열번호SEQ ID NO: Reverse primer
(5'→3')
Reverse primer
(5 '- &gt;3')
서열번호SEQ ID NO: InDel
size (bp)InDel
size (bp) 1번 염색체Chromosome 1 1-16Mb1-16Mb CCTCTTTGTGACTCGTTATCCACCTCTTTGTGACTCGTTATCCA 1One CCCGCAGACACAGTGATTAGCCCGCAGACACAGTGATTAG 22 29 -29 - 1-32Mb1-32 Mb TGCAACATAGGGTTCTGCTGTGCAACATAGGGTTCTGCTG 33 TGATAGCAATGGCGTTCAAGTGATAGCAATGGCGTTCAAG 44 70 +70 + 1-49Mb1-49 Mb GAGTTCAAACTTCAATGGAGTCGAGTTCAAACTTCAATGGAGTC 55 CCCCGTAATTATGTGGTCGTCCCCGTAATTATGTGGTCGT 66 40 +40 + 1-64Mb1-64 Mb CGATAGCCATGAAAAAGCAACGATAGCCATGAAAAAGCAA 77 TGAGGTGAAGGTCCAATGTGTGAGGTGAAGGTCCAATGTG 88 35 -35 - 1-82Mb1-82 Mb GGCATTGAATGGTGACCCTAGGCATTGAATGGTGACCCTA 99 TGCAAAACGGTCTAATCACGTGCAAAACGGTCTAATCACG 1010 34 -34 - 2번 염색체Chromosome 2 2-3Mb2-3 Mb CAAGACAGACGGTCAGACGACAAGACAGACGGTCAGACGA 1111 GTGTGTTGCCAAAGGGCTATGTGTGTTGCCAAAGGGCTAT 1212 53 +53 + 2-15Mb2-15 Mb GCTCCCATCAGAGATGCAATGCTCCCATCAGAGATGCAAT 1313 AGCTTCCATGCCTGGAGTTAAGCTTCCATGCCTGGAGTTA 1414 45 +45 + 2-25Mb2-25 Mb AACGACGTGTTCCAGTGTCAAACGACGTGTTCCAGTGTCA 1515 CTTGGACGATGTCACCTGACCTTGGACGATGTCACCTGAC 1616 48 +48 + 2-33Mb2-33 Mb TCAAACCCCGATTTGAGATTTCAAACCCCGATTTGAGATT 1717 GGTTAGGTATGGTCTTGGATCGGGTTAGGTATGGTCTTGGATCG 1818 55 or 18 +55 or 18 + 2-41Mb2-41Mb GATCCCACACGCATACACACGATCCCACACGCATACACAC 1919 TCAAAAGTCCCACATTGGTGTCAAAAGTCCCACATTGGTG 2020 26 -26 - 3번 염색체Chromosome 3 3-11Mb3-11 Mb CTGCTCACTTGGAGACCTGACTGCTCACTTGGAGACCTGA 2121 GAACCCTTCCAATGTGATGCGAACCCTTCCAATGTGATGC 2222 36 -36 - 3-23Mb3-23 Mb ATGACGCCATCCCTTCCTATATGACGCCATCCCTTCCTAT 2323 GGGACGACCATGAGTTCAGAGGGACGACCATGAGTTCAGA 2424 33 -33 - 3-35Mb3-35Mb TTTCCCCCTCTCCCTAGTGTTTTCCCCCTCTCCCTAGTGT 2525 ATTCGCCAAGCTTGTTTTTGATTCGCCAAGCTTGTTTTTG 2626 34 -34 - 3-47Mb3-47 Mb TTTTTGAACCATGCCAAAGGTTTTTGAACCATGCCAAAGG 2727 GGCATATCGACATTGGCTTTGGCATATCGACATTGGCTTT 2828 35 +35 + 3-58Mb3-58Mb AAAGCCTTTCACGACATTGAAAAGCCTTTCACGACATTGA 2929 CGAACAACCCCGAGAGTAAACGAACAACCCCGAGAGTAAA 3030 42 -42 - 4번 염색체Chromosome 4 4-7Mb4-7Mb TCAAAATAGGAATAAAGCTGATGATCAAAATAGGAATAAAGCTGATGA 3131 CCTAACAACGATCGGTGAGGCCTAACAACGATCGGTGAGG 3232 58 -58 - 4-23Mb4-23Mb TGACTACATGGTTTATGGAGACTTGTGACTACATGGTTTATGGAGACTTG 3333 GAAAGGGAACGTTGATTCCAGAAAGGGAACGTTGATTCCA 3434 40 -40 - 4-31Mb4-31 Mb AAGGCCCCGTTTAATTTTTGAAGGCCCCGTTTAATTTTTG 3535 CATGTTCCGATCATCCCACTCATGTTCCGATCATCCCACT 3636 28 +28 + 4-44Mb4-44Mb AATCCCCATGCAAGAAAAGAAATCCCCATGCAAGAAAAGA 3737 AGGATTAGGCCATGGGATTTAGGATTAGGCCATGGGATTT 3838 66 -66 - 4-56Mb4-56Mb GGAGCACGTGAGACTTTTGCGGAGCACGTGAGACTTTTGC 3939 GCACTGCAGTTTTCTCTTGCTGCACTGCAGTTTTCTCTTGCT 4040 69 -69 - 5번 염색체Chromosome 5 5-5Mb5-5Mb TGAGCTTCCTAGGACTTGAAGGGATGAGCTTCCTAGGACTTGAAGGGA 4141 TCCATTTTCACATGCTACTCCAACATCCATTTTCACATGCTACTCCAACA 4242 80 -80 - 5-24Mb5-24 Mb CGAATCGCAATTGAGCCAAACGAATCGCAATTGAGCCAAA 4343 TGACGATCTTATATGCGGTAGGATGACGATCTTATATGCGGTAGGA 4444 60 -60 - 5-29Mb5-29 Mb TTTGTTCAAGCAGCCAGATGTTTGTTCAAGCAGCCAGATG 4545 GACACAAGTAGCACTGCAAACAGACACAAGTAGCACTGCAAACA 4646 33 +33 + 5-35Mb5-35Mb TGCATGGAGGGTGTGTTCTTGTCCTGCATGGAGGGTGTGTTCTTGTCC 4747 TGAGCTATGAATGTTGAGGCTTGAGCTATGAATGTTGAGGCT 4848 78 +78 + 5-47Mb5-47 Mb AAACATTTGGGTACGACTCGCCAAAACATTTGGGTACGACTCGCCA 4949 GACATCCCAACCCACGCCCCGACATCCCAACCCACGCCCC 5050 62 -62 - 5-48Mb5-48Mb TGTTGGGCGGAATAACTCTTTGTTGGGCGGAATAACTCTT 5151 CAAATAGGACTTATCTAGGGACCAAATAGGACTTATCTAGGGAC 5252 50 +50 + 5-61Mb5-61 Mb TCAAGAGAACATTCTCCTCCGTTCAAGAGAACATTCTCCTCCGT 5353 TTAGATGAGTTTGATGTGATCTTTTTTAGATGAGTTTGATGTGATCTTTT 5454 85 -85 - 6번 염색체Chromosome 6 6-9Mb6-9Mb GAAAACGGGGTTAGCACTCAGAAAACGGGGTTAGCACTCA 5555 TCATGGTTTCAAGTGTGTTGGTCATGGTTTCAAGTGTGTTGG 5656 43 -43 - 6-16Mb6-16 Mb CCTTGGTTTCCTTGACCTTGCCTTGGTTTCCTTGACCTTG 5757 ACATGCGTGAGGAGAGGACTACATGCGTGAGGAGAGGACT 5858 32 +32 + 6-26Mb6-26Mb CATTTCGGTAATCCATGCAACATTTCGGTAATCCATGCAA 5959 TTGAACCAACCAATGCAAGATTGAACCAACCAATGCAAGA 6060 44 -44 - 6-33Mb6-33Mb ATATCCTTGGCCTGTGCATCATATCCTTGGCCTGTGCATC 6161 TCTTCAGTTTTTCCCCCAGATCTTCAGTTTTTCCCCCAGA 6262 67 +67 + 6-41Mb6-41Mb CTATGTTGCTCGGGCTCTTCCTATGTTGCTCGGGCTCTTC 6363 CAGAAGTGCCAGAAGGGATTCAGAAGTGCCAGAAGGGATT 6464 66 +66 + 7번 염색체Chromosome 7 7-11Mb7-11Mb CGCTAAGACCAAAAGCATCCCGCTAAGACCAAAAGCATCC 6565 GGCAACCAAAGGAGAACATCGGCAACCAAAGGAGAACATC 6666 31 -31 - 7-22Mb7-22Mb TATTACCCCCGAAACAATCGTATTACCCCCGAGAAACAATCG 6767 GGGAGGTCGAGTTGTGGTAAGGGAGGTCGAGTTGTGGTAA 6868 64 +64 + 7-34Mb7-34Mb TCCCTCCTTACCACTCGAAATCCCTCCTTACCACTCGAAA 6969 CCTTATGCTCGAGCTCTGCTCCTTATGCTCGAGCTCTGCT 7070 59 +59 + 7-45Mb7-45Mb ATTCCCATCTGAGGCACTGTATTCCCATCTGAGGCACTGT 7171 ATGCACCGTGGAACTCTAGCATGCACCGTGGAACTCTAGC 7272 38 +38 + 7-56Mb7-56 Mb GGACCATTGTTGGACTTTGGGGACCATTGTTGGACTTTGG 7373 AAACAATAAAGCGCGACGATAAACAATAAAGCGCGACGAT 7474 42 -42 - 8번 염색체Chromosome 8 8-10Mb8-10Mb AAGGCAAGGGCATTAAGAGGAAGGCAAGGGCATTAAGAGG 7575 GGCAAACTAAATCGCCAAGTGGCAAACTAAATCGCCAAGT 7676 49 +49 + 8-21Mb8-21 Mb TCAAATGAAGAAGCGAGCACTCAAATGAAGAAGCGAGCAC 7777 ATCGGCCTTCTTCAAAATCCATCGGCCTTCTTCAAAATCC 7878 75 +75 + 8-33Mb8-33Mb TCATTTAACCGAGCCTATGAGTCATTTAACCGAGCCTATGAG 7979 TGGCTTTGCGAAGTGATTCTTGGCTTTGCGAAGTGATTCT 8080 47 +47 + 8-42Mb8-42Mb GCAAAATGCAGAAGGAGCTAGCAAAATGCAGAAGGAGCTA 8181 GTCATGATCCGGGGAAACTAGTCATGATCCGGGGAAACTA 8282 49 -49 - 8-55Mb8-55Mb TCACCAGTTCTCCCCTATCAATCACCAGTTCTCCCCTATCAA 8383 TCATTCTCTATTGGCTCGAGATTTCATTCTCTATTGGCTCGAGATT 8484 79 -79 - 9번 염색체Chromosome 9 9-7Mb9-7 Mb AACTCCCGGACTTGGTCTCTAACTCCCGGACTTGGTCTCT 8585 TTAATCATCCCCGGAATCAATTAATCATCCCCGGAATCAA 8686 32 -32 - 9-18Mb9-18 Mb CTTCATCGTCATGAAACACACACTTCATCGTCATGAAACACACA 8787 TTGTGAAAAATAGGGCCTCATTGTGAAAAATAGGGCCTCA 8888 42 -42 - 9-31Mb9-31Mb GGCTTTTTGTGGACTATTCTGAGGCTTTTTGTGGACTATTCTGA 8989 TTGAATGTGTTTGGCCTAGGTATTGAATGTGTTTGGCCTAGGTA 9090 59 +59 + 9-41Mb9-41Mb TCAAAAATGTTAAAGACAAGCTTCATCAAAAATGTTAAAGACAAGCTTCA 9191 CCCTCCTTCATGTTTAGGAAGACCCTCCTTCATGTTTAGGAAGA 9292 30 +30 + 9-57Mb9-57Mb GGGGTTTGGGCTAAAATCATGGGGTTTGGGCTAAAATCAT 9393 ATGGAGATTTGGGAGGAGGTATGGAGATTTGGGAGGAGGT 9494 26 +26 + 10번 염색체Chromosome 10 10-9Mb10-9 Mb ACGACCTCACAGACTAAGAGACGACCTCACAGACTAAGAG 9595 ACACAAGTGTGGGCGTCACAACACAAGTGTGGGCGTCACA 9696 32 +32 + 10-19Mb10-19Mb CAGACAAAGGGTTCGCTTGCAGACAAAGGGTTCGCTTG 9797 TCGGGAAGAGGAAAACTTGATCGGGAAGAGGAAAACTTGA 9898 84 -84 - 10-31Mb10-31Mb CTAAAGACACCATCCTCCCCTCTAAAGACACCATCCTCCCCT 9999 GGTTGTCGAGATTGGGTGTTGGTTGTCGAGATTGGGTGTT 100100 34 -34 - 10-39Mb10-39Mb GAGTCGTGGTGGAGGTCATTGAGTCGTGGTGGAGGTCATT 101101 AGTTTGGTGCCAAATCAAGGAGTTTGGTGCCAAATCAAGG 102102 18 or 25 +18 or 25 + 10-49Mb10-49Mb CCAGCAGTTGAGGGAGTGACCAGCAGTTGAGGGAGTGA 103103 GGTTGAAATGGCCAGACCTAGGTTGAAATGGCCAGACCTA 104104 37 +37 + 11번 염색체Chromosome 11 11-1Mb11-1 Mb TGGGTACTCTACCTTCCATTCAATGGGTACTCTACCTTCCATTCAA 105105 TCCGGCTGCCATGGAGCAATTCCGGCTGCCATGGAGCAAT 106106 81 -81 - 11-5Mb11-5 Mb ACTTACGGTACTCTTTACGTAGTACTTACGGTACTCTTTACGTAGT 107107 TCATATGGCCCATTGCTCGTTCATATGGCCCATTGCTCGT 108108 72-72- 11-7Mb11-7Mb TATCACGAGCTCGGTTCAAATATCACGAGCTCGGTTCAAA 109109 GGTGGCACCTCTACAACCATGGTGGCACCTCTACAACCAT 110110 55/22/19 -55/22/19 - 11-15Mb11-15 Mb TTGCACAGGCTAAGCATCACTTGCACAGGCTAAGCATCAC 111111 AGTTGGGGATCATGTGGTTGAGTTGGGGATCATGTGGTTG 112112 38 +38 + 11-22Mb11-22 Mb TGAATTTGGTGCTTCGTTCATGAATTTGGTGCTTCGTTCA 113113 CAGTTTTGCGCACATAGAGGCAGTTTTGCGCACATAGAGG 114114 34 -34 - 11-30Mb11-30 Mb TGGGCGGATATACAAAAAGGTGGGCGGATATACAAAAAGG 115115 TGCACAAAATCGAGACCAAG TGCACAAAATCGAGACCAAG 116116 72 -72 - 11-37Mb11-37Mb CCTTCGATCCTTGATCTCCACCTTCGATCCTTGATCTCCA 117117 TGAGACGCACTGTAGGAGCATGAGACGCACTGTAGGAGCA 118118 51 +51 + 12번 염색체Chromosome 12 12-14Mb12-14Mb CCCCCAGCTCATACATCTCTATCCCCCCAGCTCATACATCTCTATC 119119 TTTTTAGGAGGGTTATATGCACCTGTTTTTTAGGAGGGTTATATGCACCTGT 120120 41 +41 + 12-25Mb12-25 Mb CCCAACTTAACATACTTGATAGACCCAACTTAACATACTTGATAGA 121121 GTGTGCACTGGAAGTCCAAATAGTGTGCACTGGAAGTCCAAATA 122122 29 -29 - 12-35Mb12-35Mb CAAATCCTCAAAACTCGTTCGCAAATCCTCAAAACTCGTTCG 123123 TGTCGATGTTAATTGGTGCTCTGTCGATGTTAATTGGTGCTC 124124 32 -32 - 12-46Mb12-46Mb GCGTCAAATATCAAATGTCCACGCGTCAAATATCAAATGTCCAC 125125 ATCTACCGCATCGAATTTGCATCTACCGCATCGAATTTGC 126126 77 -77 - 12-54Mb12-54 Mb TGGTGAATGGTTTTGATGATGTGGTGAATGGTTTTGATGATG 127127 TGTACGTGCACTTCCTACGCTGTACGTGCACTTCCTACGC 128128 80 +80 +

<< 실시예Example 2> 삽입-결실( 2> insertion - deletion ( IndelIndel ) ) 마커를Marker 이용한 야생종 토마토  Used wild tomato S.S. pimpinellifoliumpimpinellifolium 및  And 재배종Cultivar 토마토  tomato S. S. lycopersicumlycopersicum 판별Discrimination

상기 <실시예 1>에서 선별한 Indel 마커를 이용하여 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 S. lycopersicum을 판별할 수 있는지 알아보기 위하여, 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 S. lycopersicum의 게놈 DNA(genomic DNA) 분리하고 상기 <실시예 1>에서 제조한 Indel 마커 프라이머를 이용하여 PCR을 수행하였다.The <Example 1> Using a Indel marker selected from wild tomato S. pimpinellifolium and tomato cultivars to investigate if it can determine the S. lycopersicum, wild tomato genome of S. pimpinellifolium and cultivated tomato S. lycopersicum DNA (genomic DNA) and PCR was performed using the Indel marker primer prepared in Example 1 above.

구체적으로, 유전형 분석(genotyping)을 위한 게놈 DNA 분리를 위하여, 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 S. lycopersicum cv M82 식물체의 어린잎 2~3장을 수확한 후 액체 질소를 처리하여 동결하고 분말화하였다. 상기 어린잎 분말에 700 ㎕의 마이크로프렙 버퍼(microprep buffer)를 첨가하고 65℃에 15분간 배양하면서 5분 간격으로 혼합하였다. 그 다음, 700 ㎕의 클로로포름:이소아밀알코올(chloroform:isoamylalcohol = 24:1)을 첨가하고 1분간 혼합한 후 11,000 rpm으로 15분간 원심분리하여 상층액을 획득하였다. 분리한 상측액에 약 60% 부피의 이소프로판올(isopropanol)을 첨가하고 DNA가 응축될 때까지 혼합한 후, 13,000 rpm에서 5분간 원심분리하고 상층액을 제거하여 DNA 펠렛(pellet)를 획득하였다. 상기 획득한 DNA 펠렛을 70% 에탄올로 세척 및 건조한 후, RNaseA가 50 mg/L 첨가된 1xTE 버퍼 50 ㎕를 첨가하고 37℃에서 120분간 두어 DNA 펠렛 내 포함된 RNA를 제거하여 야생종 토마토 및 재배종 토마토 DNA 각각을 획득하였다. 그 후, 증폭 반응에 주형(template)으로 사용하기 위하여 상기 야생종 토마토 및 재배종 토마토 DNA 각각의 농도를 측정하고 약 100 ng/㎕가 되도록 희석하였다. Specifically, for isolation of genomic DNA for genotyping, wild type tomato S. pimpinellifolium and cultivated tomato S. lycopersicum cv Two or three leaves of M82 plant were harvested and treated with liquid nitrogen, frozen and powdered. 700 [mu] l of microprep buffer was added to the young leaf powder, and the mixture was incubated at 65 [deg.] C for 15 minutes while mixing at 5 minute intervals. Then, 700 μl of chloroform: isoamylalcohol (= 24: 1) was added and mixed for 1 minute, and centrifuged at 11,000 rpm for 15 minutes to obtain supernatant. About 60% volume of isopropanol was added to the supernatant, and the mixture was mixed until the DNA was condensed. Then, the mixture was centrifuged at 13,000 rpm for 5 minutes, and the supernatant was removed to obtain a DNA pellet. The obtained DNA pellet was washed with 70% ethanol and dried. Then, 50 μl of 1 × TE buffer containing 50 mg / L of RNase A was added and the RNA was removed from the DNA pellet at 37 ° C. for 120 minutes to remove wild type tomato and cultivated tomato DNA was obtained. Then, the concentration of each of the wild-type tomato and cultivated tomato DNA was measured to be used as a template in the amplification reaction and diluted to about 100 ng / l.

그 다음, Indel 마커를 증폭하기 위하여 상기 획득한 야생종 토마토 DNA (p), 재배종 토마토 DNA (c), 및 상기 야생종 토마토 DNA 및 재배종 토마토 DNA를 1:1로 혼합한 혼합물 (m) 각각을 주형으로 하여 상기 <실시예 1>에서 제조한 Indel 마커 프라이머(표 1)를 이용하여 PCR을 수행하였다. PCR을 위하여 하기 [표 2]에 기재된 반응물 조성으로 PCR 반응물을 구성하였고, 하기 [표 3]의 조건으로 PCR을 수행하여 증폭된 Indel 마커 산물을 획득하였다. 그 다음, 상기 증폭된 Indel 마커 산물은 2.5% 아가로오스 겔(agarose gel)에 로딩하고, 100V에서 50-60분간 전기영동하여 증폭 밴드를 확인하였고, 상기 증폭 밴드를 비교하여 야생종 토마토와 구분되는 재배종 토마토의 Indel 마커를 확인하여 [표 4]에 나타내었다.
Then, each mixture (m) obtained by mixing the obtained wild type tomato DNA (p), cultivated tomato DNA (c), and the wild type tomato DNA and cultivated tomato DNA in a 1: 1 mixture to amplify the Indel marker was used as a template PCR was carried out using the Indel marker primers (Table 1) prepared in Example 1 above. For PCR, PCR reaction products were constructed with the reactant compositions shown in [Table 2] below, and PCR was performed under the conditions shown in Table 3 below to obtain amplified Indel marker products. Then, the amplified Indel marker product was loaded on 2.5% agarose gel and electrophoresed at 100 V for 50-60 minutes to confirm amplification bands. By comparing the amplification bands, Indel markers of cultivated tomatoes were identified and shown in Table 4.

PCR 반응물 성분PCR reactant component 함량(㎕)Content (μl) template genomic DNAtemplate genomic DNA 1 (=100 ng)1 (= 100 ng) 10x PCR buffer10x PCR buffer 22 dNTP mix (2.5mM each)dNTP mix (2.5 mM each) 1One Forward primerForward primer 1One Reverse primerReverse primer 1One Taq polymeraseTaq polymerase 0.20.2 pure waterpure water 13.813.8 totaltotal 2020

PCR 조건PCR conditions 95℃, 3분95 ° C, 3 minutes 1 cycle1 cycle 95℃, 20초95 ° C, 20 seconds
35 cycle
35 cycles
58℃, 30초58 ℃, 30 seconds 72℃, 1분72 ° C, 1 minute 72℃, 5분72 ° C, 5 min 1 cycle1 cycle 보관 4-12℃Storage 4-12 ℃

그 결과, 도 2 및 표 4에 나타낸 바와 같이, 특정 Indel 마커 프라이머를 이용한 경우, 야생종 토마토 S. pimpinellifolium와 재배종 토마토 S. lycopersicum cv M82에서 각각 특이적인 밴드를 증폭하는 것을 확인하였다. 따라서, 표 4에 나타낸 본 발명의 특정 Indel 마커를 이용하여 야생종 토마토 S. pimpinellifolium와 재배종 토마토 S. lycopersicum의 구분이 가능함을 확인하였다.
As a result, as shown in FIG. 2 and Table 4, when a specific Indel marker primer was used, wild type tomato S. pimpinellifolium and cultivated tomato S. lycopersicum cv M82 amplified specific bands. Therefore, it was confirmed that the indel markers of the present invention shown in Table 4 can be used to distinguish between the wild-type tomato S. pimpinellifolium and the cultivated tomato S. lycopersicum .

Chromosome
locationChromosome
location M82
구분 여부M82
Classification Chromosome
locationChromosome
location M82
구분 여부M82
Classification 1번 염색체Chromosome 1 7번 염색체Chromosome 7 1-16Mb1-16Mb ○○ 7-11Mb7-11Mb ○○ 1-32Mb1-32 Mb ○○ 7-22Mb7-22Mb ○○ 1-49Mb1-49 Mb ○○ 7-34Mb7-34Mb ○○ 1-64Mb1-64 Mb ○○ 7-45Mb7-45Mb ○○ 1-82Mb1-82 Mb ○○ 7-56Mb7-56 Mb ○○ 2번 염색체Chromosome 2 8번 염색체Chromosome 8 2-3Mb2-3 Mb ×× 8-10Mb8-10Mb ○○ 2-15Mb2-15 Mb ○○ 8-21Mb8-21 Mb ○○ 2-25Mb2-25 Mb ○○ 8-33Mb8-33Mb ○○ 2-33Mb2-33 Mb ○○ 8-42Mb8-42Mb ○○ 2-41Mb2-41Mb ×× 8-55Mb8-55Mb ×× 3번 염색체Chromosome 3 9번 염색체Chromosome 9 3-11Mb3-11 Mb ○○ 9-7Mb9-7 Mb ○○ 3-23Mb3-23 Mb ○○ 9-18Mb9-18 Mb ○○ 3-35Mb3-35Mb ○○ 9-31Mb9-31Mb ×× 3-47Mb3-47 Mb ○○ 9-41Mb9-41Mb ○○ 3-58Mb3-58Mb ×× 9-57Mb9-57Mb ○○ 4번 염색체Chromosome 4 10번 염색체Chromosome 10 4-7Mb4-7Mb ○○ 10-9Mb10-9 Mb ○○ 4-23Mb4-23Mb ×× 10-19Mb10-19Mb ○○ 4-31Mb4-31 Mb ×× 10-31Mb10-31Mb ×× 4-44Mb4-44Mb ×× 10-39Mb10-39Mb ○○ 4-56Mb4-56Mb ○○ 10-49Mb10-49Mb ×× 5번 염색체Chromosome 5 11번 염색체Chromosome 11 5-5Mb5-5Mb ○○ 11-7Mb11-7Mb ×× 5-24Mb5-24 Mb ○○ 11-15Mb11-15 Mb ×× 5-29Mb5-29 Mb ×× 11-22Mb11-22 Mb ×× 5-48Mb5-48Mb ×× 11-30Mb11-30 Mb ×× 5-61Mb5-61 Mb ○○ 11-37Mb11-37Mb ×× 6번 염색체Chromosome 6 12번 염색체Chromosome 12 6-9Mb6-9Mb ○○ 12-14Mb12-14Mb ○○ 6-16Mb6-16 Mb ○○ 12-25Mb12-25 Mb ○○ 6-26Mb6-26Mb ○○ 12-35Mb12-35Mb ○○ 6-33Mb6-33Mb ○○ 12-46Mb12-46Mb ○○ 6-41Mb6-41Mb ○○ 12-54Mb12-54 Mb ○○

<< 실시예Example 3> 삽입-결실( 3> insertion - deletion ( IndelIndel ) ) 마커를Marker 이용한 야생종 토마토  Used wild tomato S.S. pimpinellifolium pimpinellifolium 및 And 재배종Cultivar 토마토 Micro-Tom 판별 Determination of Tomato Micro-Tom

Micro-Tom은 일반 토마토 육종과정에서 파생된 왜형토마토의 품종으로 줄기마디와 잎이 짧아서 좁은 공간과 실내에서 재배가 가능하며, 열매는 일반 방울토마토 크기이다. 특히, 이 품종은 왜성 크기의 장점으로 토마토 유전연구 및 돌연변이 육종에 많이 쓰이고 있으며, 최근에서는 관상용 토마토의 소재로 많이 쓰이고 있다. 이에, 상기 <실시예 1>에서 선별한 Indel 마커를 이용하여 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 Micro-Tom를 판별할 수 있는지 알아보기 위하여, 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 Micro-Tom의 게놈 DNA(genomic DNA)를 분리하고 상기 <실시예 1>에서 제조한 Indel 마커 프라이머를 이용하여 PCR을 수행하였다.Micro-Tom is a varieties of genetically modified tomatoes derived from general tomato breeding process. It is possible to cultivate in a narrow space and indoors because its stem nodes and leaves are short, and the fruit is a normal drop tomato size. Especially, this variety is used for tomato genetic research and mutation breeding due to the advantage of dwarf size. Recently, it is widely used as an ornamental tomato material. Thus, the <Example 1> wild tomato using a marker selected from Indel S. pimpinellifolium and cultivated to examine whether tomato to determine the Micro-Tom, wild tomato S. pimpinellifolium and genomic DNA of the tomato cultivar Micro-Tom (genomic DNA) was isolated and PCR was carried out using the Indel marker primer prepared in Example 1 above.

구체적으로, 유전형 분석(genotyping)을 위한 게놈 DNA 분리를 위하여, 재배종 토마토 Micro-Tom 식물체의 어린잎 2~3장을 수확한 후 액체 질소를 처리하여 동결하고 분말화하였다. 그 후, 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 DNA를 획득하고 약 100 ng/㎕가 되도록 희석하였다. Specifically, to isolate genomic DNA for genotyping, two to three young leaves of cultivated tomatoes Micro-Tom were harvested, treated with liquid nitrogen, and frozen and powdered. Thereafter, DNA was obtained and diluted to about 100 ng / μl by the same method as described in <Example 2>.

그 다음, Indel 마커를 증폭하기 위하여 상기 획득한 Micro-Tom (μ), 상기 <실시예 2>에서 획득한 야생종 토마토 DNA (p), 및 상기 <실시예 2>에서 획득한 재배종 토마토 DNA (M8) 각각을 주형으로 하여 상기 <실시예 1>에서 제조한 Indel 마커 프라이머(표 1)를 이용하여 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 PCR을 수행하였다. 그 다음, 증폭된 Indel 마커 산물은 2.5% 아가로오스 겔에 로딩하고, 100V에서 50-60분간 전기영동하여 증폭 밴드를 확인하였고, 상기 증폭 밴드를 비교하여 야생종 토마토 S. pimpinellifolium와 구분되는 재배종 토마토 Micro-Tom의 Indel 마커를 확인하여 [표 5]에 나타내었다.Then, the obtained micro-Tom (.mu.), The wild type tomato DNA (p) obtained in the above Example 2, and the cultivated tomato DNA (M8 PCR was performed in the same manner as described in Example 2 using the Indel marker primers (Table 1) prepared in Example 1 described above as a template. The amplified Indel marker product was then loaded on a 2.5% agarose gel and electrophoresed at 100 V for 50-60 min to confirm amplification bands. The amplification bands were compared and compared to the wild type tomato S. pimpinellifolium Indel markers of Micro-Tom were identified and shown in Table 5.

그 결과, 도 3 및 표 5에 나타낸 바와 같이, 특정 Indel 마커 프라이머를 이용한 경우, 야생종 토마토 S. pimpinellifolium와 재배종 토마토 Micro-Tom에서 각각 특이적인 밴드를 증폭하는 것을 확인하였다. 따라서, 표 5에 나타낸 본 발명의 특정 Indel 마커를 이용하여 야생종 토마토 S. pimpinellifolium와 재배종 토마토 Micro-Tom의 구분이 가능함을 확인하였다.
As a result, as shown in Fig. 3 and Table 5, when specific Indel marker primers were used, it was confirmed that specific bands were amplified in wild type tomato S. pimpinellifolium and cultivated tomato Micro-Tom respectively. Therefore, it was confirmed that the indel markers of the present invention shown in Table 5 can be used to distinguish between the wild-type tomato S. pimpinellifolium and the cultivated tomato Micro-Tom.

Chromosome
locationChromosome
location Micro-Tom
구분 여부Micro-Tom
Classification Chromosome
locationChromosome
location Micro-Tom
구분 여부Micro-Tom
Classification 1번 염색체Chromosome 1 7번 염색체Chromosome 7 1-16Mb1-16Mb ○○ 7-11Mb7-11Mb ○○ 1-32Mb1-32 Mb ○○ 7-22Mb7-22Mb ○○ 1-49Mb1-49 Mb ○○ 7-34Mb7-34Mb ○○ 1-64Mb1-64 Mb ○○ 7-45Mb7-45Mb ○○ 1-82Mb1-82 Mb ○○ 7-56Mb7-56 Mb ○○ 2번 염색체Chromosome 2 8번 염색체Chromosome 8 2-3Mb2-3 Mb ×× 8-10Mb8-10Mb ○○ 2-15Mb2-15 Mb ×× 8-21Mb8-21 Mb ○○ 2-25Mb2-25 Mb ×× 8-33Mb8-33Mb ○○ 2-33Mb2-33 Mb ○○ 8-42Mb8-42Mb ○○ 2-41Mb2-41Mb ○○ 8-55Mb8-55Mb ×× 3번 염색체Chromosome 3 9번 염색체Chromosome 9 3-11Mb3-11 Mb ×× 9-7Mb9-7 Mb ○○ 3-23Mb3-23 Mb ○○ 9-18Mb9-18 Mb ○○ 3-35Mb3-35Mb ○○ 9-31Mb9-31Mb ×× 3-47Mb3-47 Mb ×× 9-41Mb9-41Mb ○○ 3-58Mb3-58Mb ○○ 9-57Mb9-57Mb ○○ 4번 염색체Chromosome 4 10번 염색체Chromosome 10 4-7Mb4-7Mb ○○ 10-9Mb10-9 Mb ○○ 4-23Mb4-23Mb ×× 10-19Mb10-19Mb ○○ 4-31Mb4-31 Mb ○○ 10-31Mb10-31Mb ×× 4-44Mb4-44Mb ○○ 10-39Mb10-39Mb ○○ 4-56Mb4-56Mb ×× 10-49Mb10-49Mb ×× 5번 염색체Chromosome 5 11번 염색체Chromosome 11 5-5Mb5-5Mb ○○ 11-7Mb11-7Mb ○○ 5-24Mb5-24 Mb ×× 11-15Mb11-15 Mb ○○ 5-29Mb5-29 Mb ×× 11-22Mb11-22 Mb ×× 5-48Mb5-48Mb ×× 11-30Mb11-30 Mb ×× 5-61Mb5-61 Mb ×× 11-37Mb11-37Mb ×× 6번 염색체Chromosome 6 12번 염색체Chromosome 12 6-9Mb6-9Mb ×× 12-14Mb12-14Mb ×× 6-16Mb6-16 Mb ×× 12-25Mb12-25 Mb ○○ 6-26Mb6-26Mb ×× 12-35Mb12-35Mb ×× 6-33Mb6-33Mb ×× 12-46Mb12-46Mb ×× 6-41Mb6-41Mb ○○ 12-54Mb12-54 Mb ○○

<110> Industry-academic cooperation foundation wonkwang university <120> Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato <130> PB2017-150 <150> KR 10-2017-0041779 <151> 2017-03-31 <160> 128 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1-16Mb forward primer <400> 1 cctctttgtg actcgttatc ca 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-16Mb reverse primer <400> 2 cccgcagaca cagtgattag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-32Mb forward primer <400> 3 tgcaacatag ggttctgctg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-32Mb reverse primer <400> 4 tgatagcaat ggcgttcaag 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1-49Mb forward primer <400> 5 gagttcaaac ttcaatggag tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-49Mb reverse primer <400> 6 ccccgtaatt atgtggtcgt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-64Mb forward primer <400> 7 cgatagccat gaaaaagcaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-64Mb reverse primer <400> 8 tgaggtgaag gtccaatgtg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-82Mb forward primer <400> 9 ggcattgaat ggtgacccta 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-82Mb reverse primer <400> 10 tgcaaaacgg tctaatcacg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-3Mb forward primer <400> 11 caagacagac ggtcagacga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-3Mb reverse primer <400> 12 gtgtgttgcc aaagggctat 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-15Mb forward primer <400> 13 gctcccatca gagatgcaat 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-15Mb reverse primer <400> 14 agcttccatg cctggagtta 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-25Mb forward primer <400> 15 aacgacgtgt tccagtgtca 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-25Mb reverse primer <400> 16 cttggacgat gtcacctgac 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-33Mb forward primer <400> 17 tcaaaccccg atttgagatt 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 2-33Mb reverse primer <400> 18 ggttaggtat ggtcttggat cg 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-41Mb forward primer <400> 19 gatcccacac gcatacacac 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-41Mb reverse primer <400> 20 tcaaaagtcc cacattggtg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-11Mb forward primer <400> 21 ctgctcactt ggagacctga 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-11Mb reverse primer <400> 22 gaacccttcc aatgtgatgc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-23Mb forward primer <400> 23 atgacgccat cccttcctat 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-23Mb reverse primer <400> 24 gggacgacca tgagttcaga 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-35Mb forward primer <400> 25 tttccccctc tccctagtgt 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-35Mb reverse primer <400> 26 attcgccaag cttgtttttg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-47Mb forward primer <400> 27 tttttgaacc atgccaaagg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-47Mb reverse primer <400> 28 ggcatatcga cattggcttt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-58Mb forward primer <400> 29 aaagcctttc acgacattga 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-58Mb reverse primer <400> 30 cgaacaaccc cgagagtaaa 20 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4-7Mb forward primer <400> 31 tcaaaatagg aataaagctg atga 24 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-7Mb reverse primer <400> 32 cctaacaacg atcggtgagg 20 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 4-23Mb forward primer <400> 33 tgactacatg gtttatggag acttg 25 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-23Mb reverse primer <400> 34 gaaagggaac gttgattcca 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-31Mb forward primer <400> 35 aaggccccgt ttaatttttg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-31Mb reverse primer <400> 36 catgttccga tcatcccact 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-44Mb forward primer <400> 37 aatccccatg caagaaaaga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-44Mb reverse primer <400> 38 aggattaggc catgggattt 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-56Mb forward primer <400> 39 ggagcacgtg agacttttgc 20 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 4-56Mb reverse primer <400> 40 gcactgcagt tttctcttgc t 21 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5-5Mb forward primer <400> 41 tgagcttcct aggacttgaa ggga 24 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5-5Mb reverse primer <400> 42 tccattttca catgctactc caaca 25 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-24Mb forward primer <400> 43 cgaatcgcaa ttgagccaaa 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5-24Mb reverse primer <400> 44 tgacgatctt atatgcggta gga 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-29Mb forward primer <400> 45 tttgttcaag cagccagatg 20 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-29Mb reverse primer <400> 46 gacacaagta gcactgcaaa ca 22 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5-35Mb forward primer <400> 47 tgcatggagg gtgtgttctt gtcc 24 <210> 48 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 5-35Mb reverse primer <400> 48 tgagctatga atgttgaggc t 21 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5-47Mb forward primer <400> 49 aaacatttgg gtacgactcg cca 23 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-47Mb reverse primer <400> 50 gacatcccaa cccacgcccc 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-48Mb forward primer <400> 51 tgttgggcgg aataactctt 20 <210> 52 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-48Mb reverse primer <400> 52 caaataggac ttatctaggg ac 22 <210> 53 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-61Mb forward primer <400> 53 tcaagagaac attctcctcc gt 22 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5-61Mb reverse primer <400> 54 ttagatgagt ttgatgtgat ctttt 25 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-9Mb forward primer <400> 55 gaaaacgggg ttagcactca 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 6-9Mb reverse primer <400> 56 tcatggtttc aagtgtgttg g 21 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-16Mb forward primer <400> 57 ccttggtttc cttgaccttg 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-16Mb reverse primer <400> 58 acatgcgtga ggagaggact 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-26Mb forward primer <400> 59 catttcggta atccatgcaa 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-26Mb reverse primer <400> 60 ttgaaccaac caatgcaaga 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-33Mb forward primer <400> 61 atatccttgg cctgtgcatc 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-33Mb reverse primer <400> 62 tcttcagttt ttcccccaga 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-41Mb forward primer <400> 63 ctatgttgct cgggctcttc 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-41Mb reverse primer <400> 64 cagaagtgcc agaagggatt 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-11Mb forward primer <400> 65 cgctaagacc aaaagcatcc 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-11Mb reverse primer <400> 66 ggcaaccaaa ggagaacatc 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-22Mb forward primer <400> 67 tattaccccc gaaacaatcg 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-22Mb reverse primer <400> 68 gggaggtcga gttgtggtaa 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-34Mb forward primer <400> 69 tccctcctta ccactcgaaa 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-34Mb reverse primer <400> 70 ccttatgctc gagctctgct 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-45Mb forward primer <400> 71 attcccatct gaggcactgt 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-45Mb reverse primer <400> 72 atgcaccgtg gaactctagc 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-56Mb forward primer <400> 73 ggaccattgt tggactttgg 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-56Mb reverse primer <400> 74 aaacaataaa gcgcgacgat 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-10Mb forward primer <400> 75 aaggcaaggg cattaagagg 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-10Mb reverse primer <400> 76 ggcaaactaa atcgccaagt 20 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-21Mb forward primer <400> 77 tcaaatgaag aagcgagcac 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-21Mb reverse primer <400> 78 atcggccttc ttcaaaatcc 20 <210> 79 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 8-33Mb forward primer <400> 79 tcatttaacc gagcctatga g 21 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-33Mb reverse primer <400> 80 tggctttgcg aagtgattct 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-42Mb forward primer <400> 81 gcaaaatgca gaaggagcta 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-42Mb reverse primer <400> 82 gtcatgatcc ggggaaacta 20 <210> 83 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 8-55Mb forward primer <400> 83 tcaccagttc tcccctatca a 21 <210> 84 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 8-55Mb reverse primer <400> 84 tcattctcta ttggctcgag att 23 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-7Mb forward primer <400> 85 aactcccgga cttggtctct 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-7Mb reverse primer <400> 86 ttaatcatcc ccggaatcaa 20 <210> 87 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-18Mb forward primer <400> 87 cttcatcgtc atgaaacaca ca 22 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-18Mb reverse primer <400> 88 ttgtgaaaaa tagggcctca 20 <210> 89 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-31Mb forward primer <400> 89 ggctttttgt ggactattct ga 22 <210> 90 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-31Mb reverse primer <400> 90 ttgaatgtgt ttggcctagg ta 22 <210> 91 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 9-41Mb forward primer <400> 91 tcaaaaatgt taaagacaag cttca 25 <210> 92 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-41Mb reverse primer <400> 92 ccctccttca tgtttaggaa ga 22 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-57Mb forward primer <400> 93 ggggtttggg ctaaaatcat 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-57Mb reverse primer <400> 94 atggagattt gggaggaggt 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-9Mb forward primer <400> 95 acgacctcac agactaagag 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-9Mb reverse primer <400> 96 acacaagtgt gggcgtcaca 20 <210> 97 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 10-19Mb forward primer <400> 97 cagacaaagg gttcgcttg 19 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-19Mb reverse primer <400> 98 tcgggaagag gaaaacttga 20 <210> 99 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 10-31Mb forward primer <400> 99 ctaaagacac catcctcccc t 21 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-31Mb reverse primer <400> 100 ggttgtcgag attgggtgtt 20 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-39Mb forward primer <400> 101 gagtcgtggt ggaggtcatt 20 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-39Mb reverse primer <400> 102 agtttggtgc caaatcaagg 20 <210> 103 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 10-49Mb forward primer <400> 103 ccagcagttg agggagtga 19 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-49Mb reverse primer <400> 104 ggttgaaatg gccagaccta 20 <210> 105 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 11-1Mb forward primer <400> 105 tgggtactct accttccatt caa 23 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-1Mb reverse primer <400> 106 tccggctgcc atggagcaat 20 <210> 107 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 11-5Mb forward primer <400> 107 acttacggta ctctttacgt agt 23 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-5Mb reverse primer <400> 108 tcatatggcc cattgctcgt 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-7Mb forward primer <400> 109 tatcacgagc tcggttcaaa 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-7Mb reverse primer <400> 110 ggtggcacct ctacaaccat 20 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-15Mb forward primer <400> 111 ttgcacaggc taagcatcac 20 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-15Mb reverse primer <400> 112 agttggggat catgtggttg 20 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-22Mb forward primer <400> 113 tgaatttggt gcttcgttca 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-22Mb reverse primer <400> 114 cagttttgcg cacatagagg 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-30Mb forward primer <400> 115 tgggcggata tacaaaaagg 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-30Mb reverse primer <400> 116 tgcacaaaat cgagaccaag 20 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-37Mb forward primer <400> 117 ccttcgatcc ttgatctcca 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-37Mb reverse primer <400> 118 tgagacgcac tgtaggagca 20 <210> 119 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 12-14Mb forward primer <400> 119 cccccagctc atacatctct atc 23 <210> 120 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 12-14Mb reverse primer <400> 120 tttttaggag ggttatatgc acctgt 26 <210> 121 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 12-25Mb forward primer <400> 121 cccaacttaa catacttgat aga 23 <210> 122 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12-25Mb reverse primer <400> 122 gtgtgcactg gaagtccaaa ta 22 <210> 123 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-35Mb forward primer <400> 123 caaatcctca aaactcgttc g 21 <210> 124 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-35Mb reverse primer <400> 124 tgtcgatgtt aattggtgct c 21 <210> 125 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12-46Mb forward primer <400> 125 gcgtcaaata tcaaatgtcc ac 22 <210> 126 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 12-46Mb reverse primer <400> 126 atctaccgca tcgaatttgc 20 <210> 127 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-54Mb forward primer <400> 127 tggtgaatgg ttttgatgat g 21 <210> 128 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 12-54Mb reverse primer <400> 128 tgtacgtgca cttcctacgc 20 <110> Industry-academic cooperation foundation wonkwang university <120> Primer set of tomato InDel marker for detection of wild-type          tomato and cultivated-type tomato <130> PB2017-150 <150> KR 10-2017-0041779 <151> 2017-03-31 <160> 128 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1-16 Mb forward primer <400> 1 cctctttgtg actcgttatc ca 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-16 Mb reverse primer <400> 2 cccgcagaca cagtgattag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-32 Mb forward primer <400> 3 tgcaacatag ggttctgctg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-32 Mb reverse primer <400> 4 tgatagcaat ggcgttcaag 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1-49 Mb forward primer <400> 5 gagttcaaac ttcaatggag tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-49 Mb reverse primer <400> 6 ccccgtaatt atgtggtcgt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-64 Mb forward primer <400> 7 cgatagccat gaaaaagcaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-64 Mb reverse primer <400> 8 tgaggtgaag gtccaatgtg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-82 Mb forward primer <400> 9 ggcattgaat ggtgacccta 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-82 Mb reverse primer <400> 10 tgcaaaacgg tctaatcacg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-3 Mb forward primer <400> 11 caagacagac ggtcagacga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-3 Mb reverse primer <400> 12 gtgtgttgcc aaagggctat 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-15 Mb forward primer <400> 13 gctcccatca gagatgcaat 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-15 Mb reverse primer <400> 14 agcttccatg cctggagtta 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-25 Mb forward primer <400> 15 aacgacgtgt tccagtgtca 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-25 Mb reverse primer <400> 16 cttggacgat gtcacctgac 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-33 Mb forward primer <400> 17 tcaaaccccg atttgagatt 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 2-33 Mb reverse primer <400> 18 ggttaggtat ggtcttggat cg 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-41 Mb forward primer <400> 19 gatcccacac gcatacacac 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-41 Mb reverse primer <400> 20 tcaaaagtcc cacattggtg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-11 Mb forward primer <400> 21 ctgctcactt ggagacctga 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-11 Mb reverse primer <400> 22 gaacccttcc aatgtgatgc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-23 Mb forward primer <400> 23 atgacgccat cccttcctat 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-23 Mb reverse primer <400> 24 gggacgacca tgagttcaga 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-35 Mb forward primer <400> 25 tttccccctc tccctagtgt 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-35 Mb reverse primer <400> 26 attcgccaag cttgtttttg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-47 Mb forward primer <400> 27 tttttgaacc atgccaaagg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-47 Mb reverse primer <400> 28 ggcatatcga cattggcttt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-58 Mb forward primer <400> 29 aaagcctttc acgacattga 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-58 Mb reverse primer <400> 30 cgaacaaccc cgagagtaaa 20 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4-7 Mb forward primer <400> 31 tcaaaatagg aataaagctg atga 24 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-7 Mb reverse primer <400> 32 cctaacaacg atcggtgagg 20 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 4-23 Mb forward primer <400> 33 tgactacatg gtttatggag acttg 25 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-23 Mb reverse primer <400> 34 gaaagggaac gttgattcca 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-31 Mb forward primer <400> 35 aaggccccgt ttaatttttg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-31 Mb reverse primer <400> 36 catgttccga tcatcccact 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-44 Mb forward primer <400> 37 aatccccatg caagaaaaga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-44 Mb reverse primer <400> 38 aggattaggc catgggattt 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-56 Mb forward primer <400> 39 ggagcacgtg agacttttgc 20 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 4-56 Mb reverse primer <400> 40 gcactgcagt tttctcttgc t 21 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5-5 Mb forward primer <400> 41 tgagcttcct aggacttgaa ggga 24 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5-5 Mb reverse primer <400> 42 tccattttca catgctactc caaca 25 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-24 Mb forward primer <400> 43 cgaatcgcaa ttgagccaaa 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5-24 Mb reverse primer <400> 44 tgacgatctt atatgcggta gga 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-29 Mb forward primer <400> 45 tttgttcaag cagccagatg 20 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-29 Mb reverse primer <400> 46 gacacaagta gcactgcaaa ca 22 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5-35 Mb forward primer <400> 47 tgcatggagg gtgtgttctt gtcc 24 <210> 48 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 5-35 Mb reverse primer <400> 48 tgagctatga atgttgaggc t 21 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5-47 Mb forward primer <400> 49 aaacatttgg gtacgactcg cca 23 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-47 Mb reverse primer <400> 50 gacatcccaa cccacgcccc 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-48 Mb forward primer <400> 51 tgttgggcgg aataactctt 20 <210> 52 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-48 Mb reverse primer <400> 52 caaataggac ttatctaggg ac 22 <210> 53 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-61 Mb forward primer <400> 53 tcaagagaac attctcctcc gt 22 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5-61 Mb reverse primer <400> 54 ttagatgagt ttgatgtgat ctttt 25 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-9 Mb forward primer <400> 55 gaaaacgggg ttagcactca 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 6-9 Mb reverse primer <400> 56 tcatggtttc aagtgtgttg g 21 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-16 Mb forward primer <400> 57 ccttggtttc cttgaccttg 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-16 Mb reverse primer <400> 58 acatgcgtga ggagaggact 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-26 Mb forward primer <400> 59 catttcggta atccatgcaa 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-26 Mb reverse primer <400> 60 ttgaaccaac caatgcaaga 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-33 Mb forward primer <400> 61 atatccttgg cctgtgcatc 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-33 Mb reverse primer <400> 62 tcttcagttt ttcccccaga 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-41 Mb forward primer <400> 63 ctatgttgct cgggctcttc 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-41 Mb reverse primer <400> 64 cagaagtgcc agaagggatt 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-11 Mb forward primer <400> 65 cgctaagacc aaaagcatcc 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-11 Mb reverse primer <400> 66 ggcaaccaaa ggagaacatc 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-22 Mb forward primer <400> 67 tattaccccc gaaacaatcg 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-22 Mb reverse primer <400> 68 gggaggtcga gttgtggtaa 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-34 Mb forward primer <400> 69 tccctcctta ccactcgaaa 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-34 Mb reverse primer <400> 70 ccttatgctc gagctctgct 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-45 Mb forward primer <400> 71 attcccatct gaggcactgt 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-45 Mb reverse primer <400> 72 atgcaccgtg gaactctagc 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-56 Mb forward primer <400> 73 ggaccattgt tggactttgg 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-56 Mb reverse primer <400> 74 aaacaataaa gcgcgacgat 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-10 Mb forward primer <400> 75 aaggcaaggg cattaagagg 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-10 Mb reverse primer <400> 76 ggcaaactaa atcgccaagt 20 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-21 Mb forward primer <400> 77 tcaaatgaag aagcgagcac 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-21 Mb reverse primer <400> 78 atcggccttc ttcaaaatcc 20 <210> 79 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 8-33 Mb forward primer <400> 79 tcatttaacc gagcctatga g 21 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-33 Mb reverse primer <400> 80 tggctttgcg aagtgattct 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-42 Mb forward primer <400> 81 gcaaaatgca gaaggagcta 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-42 Mb reverse primer <400> 82 gtcatgatcc ggggaaacta 20 <210> 83 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 8-55 Mb forward primer <400> 83 tcaccagttc tcccctatca a 21 <210> 84 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 8-55 Mb reverse primer <400> 84 tcattctcta ttggctcgag att 23 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-7 Mb forward primer <400> 85 aactcccgga cttggtctct 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-7 Mb reverse primer <400> 86 ttaatcatcc ccggaatcaa 20 <210> 87 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-18 Mb forward primer <400> 87 cttcatcgtc atgaaacaca ca 22 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-18 Mb reverse primer <400> 88 ttgtgaaaaa tagggcctca 20 <210> 89 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-31 Mb forward primer <400> 89 ggctttttgt ggactattct ga 22 <210> 90 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-31 Mb reverse primer <400> 90 ttgaatgtgt ttggcctagg ta 22 <210> 91 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 9-41 Mb forward primer <400> 91 tcaaaaatgt taaagacaag cttca 25 <210> 92 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-41 Mb reverse primer <400> 92 ccctccttca tgtttaggaa ga 22 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-57 Mb forward primer <400> 93 ggggtttggg ctaaaatcat 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-57 Mb reverse primer <400> 94 atggagattt gggaggaggt 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-9 Mb forward primer <400> 95 acgacctcac agactaagag 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-9 Mb reverse primer <400> 96 acacaagtgt gggcgtcaca 20 <210> 97 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 10-19 Mb forward primer <400> 97 cagacaaagg gttcgcttg 19 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-19 Mb reverse primer <400> 98 tcgggaagag gaaaacttga 20 <210> 99 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 10-31 Mb forward primer <400> 99 ctaaagacac catcctcccc t 21 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-31 Mb reverse primer <400> 100 ggttgtcgag attgggtgtt 20 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-39 Mb forward primer <400> 101 gagtcgtggt ggaggtcatt 20 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-39 Mb reverse primer <400> 102 agtttggtgc caaatcaagg 20 <210> 103 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 10-49 Mb forward primer <400> 103 ccagcagttg agggagtga 19 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-49 Mb reverse primer <400> 104 ggttgaaatg gccagaccta 20 <210> 105 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 11-1 Mb forward primer <400> 105 tgggtactct accttccatt caa 23 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 11-1 Mb reverse primer <400> 106 tccggctgcc atggagcaat 20 <210> 107 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 11-5 Mb forward primer <400> 107 acttacggta ctctttacgt agt 23 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-5 Mb reverse primer <400> 108 tcatatggcc cattgctcgt 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-7 Mb forward primer <400> 109 tatcacgagc tcggttcaaa 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-7 Mb reverse primer <400> 110 ggtggcacct ctacaaccat 20 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-15 Mb forward primer <400> 111 ttgcacaggc taagcatcac 20 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-15 Mb reverse primer <400> 112 agttggggat catgtggttg 20 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-22 Mb forward primer <400> 113 tgaatttggt gcttcgttca 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-22 Mb reverse primer <400> 114 cagttttgcg cacatagagg 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-30 Mb forward primer <400> 115 tgggcggata tacaaaaagg 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-30 Mb reverse primer <400> 116 tgcacaaaat cgagaccaag 20 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-37 Mb forward primer <400> 117 ccttcgatcc ttgatctcca 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-37 Mb reverse primer <400> 118 tgagacgcac tgtaggagca 20 <210> 119 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 12-14 Mb forward primer <400> 119 cccccagctc atacatctct atc 23 <210> 120 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 12-14 Mb reverse primer <400> 120 tttttaggag ggttatatgc acctgt 26 <210> 121 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 12-25 Mb forward primer <400> 121 cccaacttaa catacttgat aga 23 <210> 122 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12-25 Mb reverse primer <400> 122 gtgtgcactg gaagtccaaa ta 22 <210> 123 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-35 Mb forward primer <400> 123 caaatcctca aaactcgttc g 21 <210> 124 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-35 Mb reverse primer <400> 124 tgtcgatgtt aattggtgct c 21 <210> 125 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12-46 Mb forward primer <400> 125 gcgtcaaata tcaaatgtcc ac 22 <210> 126 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 12-46 Mb reverse primer <400> 126 atctaccgca tcgaatttgc 20 <210> 127 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-54 Mb forward primer <400> 127 tggtgaatgg ttttgatgat g 21 <210> 128 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 12-54 Mb reverse primer <400> 128 tgtacgtgca cttcctacgc 20

Claims (9)

서열번호 19 및 20으로 이루어진 프라이머 세트; 서열번호 29 및 30으로 이루어진 프라이머 세트; 서열번호 35 및 36으로 이루어진 프라이머 세트; 서열번호 37 및 38로 이루어진 프라이머 세트; 서열번호 109 및 110으로 이루어진 프라이머 세트; 및 서열번호 111 및 112로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 마이크로-톰(Micro-Tom)을 판별하기 위한 프라이머 세트.
A primer set consisting of SEQ ID NOS: 19 and 20; A primer set consisting of SEQ ID NOS: 29 and 30; A primer set consisting of SEQ ID NOS: 35 and 36; A primer set consisting of SEQ ID NOS: 37 and 38; A primer set consisting of SEQ ID NOS: 109 and 110; To determine the tom (Micro-Tom) - SEQ ID NO: 111 and any one or more primers including a set, wild tomato solar num pimpi Marinelli Four Solarium (Solanum pimpinellifolium) and cultivated tomato micro selected from the group consisting of a primer set consisting of 112 Primer set for.
제 1항에 있어서, 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가로 포함하는 것을 특징으로 하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 마이크로-톰(Micro-Tom)을 판별하기 위한 프라이머 세트.
2. The primer set of claim 1, comprising a primer set consisting of SEQ ID NOS: 1 and 2; A primer set consisting of SEQ ID NOS: 3 and 4; A primer set consisting of SEQ ID NOS: 5 and 6; A primer set consisting of SEQ ID NOS: 7 and 8; A primer set consisting of SEQ ID NOS: 9 and 10; A primer set consisting of SEQ ID NOS: 17 and 18; A primer set consisting of SEQ ID NOS: 23 and 24; A primer set consisting of SEQ ID NOS: 25 and 26; A primer set consisting of SEQ ID NOS: 31 and 32; A primer set consisting of SEQ ID NOS: 41 and 42; A primer set consisting of SEQ ID NOS: 63 and 64; A primer set consisting of SEQ ID NOS: 65 and 66; A primer set consisting of SEQ ID NOS: 67 and 68; A primer set consisting of SEQ ID NOS: 69 and 70; A primer set consisting of SEQ ID NOS: 71 and 72; A primer set consisting of SEQ ID NOS: 73 and 74; A primer set consisting of SEQ ID NOS: 75 and 76; A primer set consisting of SEQ ID NOS: 77 and 78; A primer set consisting of SEQ ID NOS: 79 and 80; A primer set consisting of SEQ ID NOS: 81 and 82; A primer set consisting of SEQ ID NOS: 85 and 86; A primer set consisting of SEQ ID NOS: 87 and 88; A primer set consisting of SEQ ID NOS: 91 and 92; A primer set consisting of SEQ ID NOS: 93 and 94; A primer set consisting of SEQ ID NOS: 95 and 96; A primer set consisting of SEQ ID NOS: 97 and 98; A primer set consisting of SEQ ID NOS: 101 and 102; A primer set consisting of SEQ ID NOS: 121 and 122; And a set of primers consisting of SEQ ID NOS: 127 and 128. The wild-type tomato Solanum pimpinellifolium and the cultivated tomato micro- Lt; RTI ID = 0.0 &gt; -Tom). &Lt; / RTI &gt;
삭제delete 삭제delete 1) 대상 시료에서 게놈 DNA를 분리하는 단계;
2) 상기 단계 1)에서 분리한 게놈 DNA를 주형으로 하고, 제 1항 또는 제 2항의 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및
3) 상기 단계 2)에서 증폭한 산물을 검출하는 단계를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 마이크로-톰(Micro-Tom)을 판별하는 방법.
1) separating the genomic DNA from the target sample;
2) amplifying the target sequence by performing amplification reaction using the genomic DNA isolated in step 1) as a template and using the primer set of the first or second aspect; And
3) detecting the wild-type tomato Solanum pimpinellifolium and cultivated tomato micro-Tom, comprising the step of detecting the product amplified in step 2).
삭제delete 제 5항에 있어서, 상기 단계 2)에서 증폭 반응은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 및 Qβ 복제효소(replicase)를 통한 증폭으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 마이크로-톰(Micro-Tom)을 판별하는 방법.
6. The method according to claim 5, wherein the amplification reaction in step 2) is performed using a polymerase chain reaction (PCR), a ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification, and amplification through a Qβ replicase . The present invention relates to a method for producing a wild-type tomato Solanum pimpinellifolium and a cultivar How to identify Tomato Micro-Tom.
제 1항 또는 제 2항의 프라이머 세트를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 마이크로-톰(Micro-Tom)을 판별하기 위한 키트.
A kit for discriminating between a wild type tomato Solanum pimpinellifolium and a cultivated tomato micro-Tom comprising the primer set of claim 1 or 2.
제 8항에 있어서, 상기 키트에는 DNA 중합효소, dNTPs 및 반응완충액을 추가로 포함하는 것을 특징으로 하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 마이크로-톰(Micro-Tom)을 판별하기 위한 키트.
9. The method according to claim 8, wherein the kit further comprises a wild-type tomato Solanum pimpinellifolium and cultivated tomato micro-Tom, which further comprises DNA polymerase, dNTPs and a reaction buffer. .
KR1020170137334A 2017-03-31 2017-10-23 Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato KR102004479B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020170041779 2017-03-31
KR20170041779 2017-03-31

Related Child Applications (1)

Application Number Title Priority Date Filing Date
KR1020190088449A Division KR102009627B1 (en) 2019-07-22 2019-07-22 Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato

Publications (2)

Publication Number Publication Date
KR20180111454A KR20180111454A (en) 2018-10-11
KR102004479B1 true KR102004479B1 (en) 2019-07-26

Family

ID=63865580

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020170137334A KR102004479B1 (en) 2017-03-31 2017-10-23 Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato

Country Status (1)

Country Link
KR (1) KR102004479B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101493978B1 (en) 2013-10-08 2015-02-17 대한민국 Indel marker for discrimination of soybean cultivar
US20150096076A1 (en) 2012-04-19 2015-04-02 Vilmorin & Cie High yield tomato plants

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010147467A2 (en) * 2009-06-17 2010-12-23 Monsanto Invest N.V. Novel tomato plants
EP2292774A1 (en) * 2009-08-17 2011-03-09 Syngenta Participations AG. Disease resistant tomato plants
KR101604831B1 (en) * 2014-03-24 2016-03-18 안동대학교 산학협력단 Primer set to judge tomato resitant to verticillium wilt, Method to judge tomato resitant to verticillium wilt using the same, and Kit to judge tomato resitant to verticillium wilt using the same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150096076A1 (en) 2012-04-19 2015-04-02 Vilmorin & Cie High yield tomato plants
KR101493978B1 (en) 2013-10-08 2015-02-17 대한민국 Indel marker for discrimination of soybean cultivar

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DNA Research, (2014), Vol..21, pp429-438. 1부.*

Also Published As

Publication number Publication date
KR20180111454A (en) 2018-10-11

Similar Documents

Publication Publication Date Title
Agarwal et al. Advances in molecular marker techniques and their applications in plant sciences
Sánchez-Pérez et al. Comparison of SSR polymorphisms using automated capillary sequencers, and polyacrylamide and agarose gel electrophoresis: implications for the assessment of genetic diversity and relatedness in almond
de Sousa Araújo et al. Assessment of genetic variability in sesame accessions using SSR markers and morpho-agronomic traits
KR101382406B1 (en) Primer sets for discrimination of grape cultivars and use thereof
KR20130078111A (en) Scar markers for discrimination of grape cultivars and use thereof
KR102004479B1 (en) Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato
Gutiérrez-Calle et al. Capillary electrophoresis as a tool for genotyping SH3 mediated coffee leaf rust resistance
KR101783347B1 (en) CAPS marker for discriminating presence or absence of pollen in pear and uses thereof
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
KR102009627B1 (en) Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato
KR102458440B1 (en) Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set
KR101219546B1 (en) Development of grain weevils resistive molecular markers in mung beans and uses thereof
KR20160095213A (en) DNA marker for selecting fruit shape of watermelon
KR101822390B1 (en) Maker for cultivar discrimination in Korean breeding wheat and method for determination using the same
Ryzhova et al. Analysis of microsatellite locus polymorphism in potato (Solanum tuberosum) cultivars of Russian breeding
KR102154701B1 (en) Novel genetic markers for selection of watermelon dwarf entities and use thereof
KR102142011B1 (en) S-SAP marker for discriminating Fuji apple and its bud mutation cultivar and use thereof
KR101649589B1 (en) SSR primer derived from apple and use thereof
KR20130091434A (en) Primer for selecting variety resistant to rice stripe disease containing stv-bi gene and the selecting method thereof
KR101546428B1 (en) SCAR marker for cultivar discrimination in Korean breeding wheat and use thereof
KR101144990B1 (en) PCR-based method of discriminating ginseng cultivars using STS primers
Mahdy et al. Date palm genetic identification and improvement utilizing molecular markers and DNA barcoding
KR102276917B1 (en) EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same
KR101972081B1 (en) Markers for classification of fagopyrum tataricum cultivars
KR101955071B1 (en) Snp markers for discrimination of raphanus sativus

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
A107 Divisional application of patent
GRNT Written decision to grant