KR102154701B1 - Novel genetic markers for selection of watermelon dwarf entities and use thereof - Google Patents

Abstract

The present invention relates to a novel genetic marker for discriminating watermelon dwarf entities and a use thereof and, more specifically, to a single nucleotide polymorphism (SNP) marker composition, a primer set, and a kit for discriminating watermelon dwarf entities, and to a method of discriminating watermelon dwarf entities using the marker. By providing the watermelon dwarf genetic marker according to the present invention, it is possible to quickly and easily check the dwarf by extracting the DNA of young plants or seeds when developing dwarf systems and varieties, thereby enabling efficient identification and cultivation of watermelon varieties showing dwarf. Therefore, it is expected to be very useful in reducing the time, cost, and effort required for breeding.

Description

[Novel genetic markers for selection of watermelon dwarf entities and use thereof]

The present invention relates to a novel genetic marker for selecting a watermelon dwarf individual and its use, and more specifically, a single nucleotide polymorphism (SNP) marker composition, a primer set, and a kit for determining a watermelon dwarf individual, and watermelon using the same. It relates to a method of identifying a dwarf entity.

Watermelon is produced worldwide in Asia (82.4%), Europe (5.8%), Oceania (0.1%), Africa (5.3%), and the Americas (6.3%). Among Asia, China (about 50 million tons) Produces the largest number of watermelons in the country. In Korea, watermelon is a fruit and vegetable that is consumed throughout the year as well as in summer. However, as the temperature of the cultivation area rises due to the abnormal climate phenomena caused by global warming and the over-humid climatic conditions are created, anthrax, vine blight, and pestilence frequently occur in the watermelon cultivation area, resulting in a decrease in production.

On the other hand, with the recent development of next-generation sequencing methods, sequencing costs have been reduced, so plant sequencing is also rapidly progressing. In the case of gourds, cucumbers (2009), melons (2012), watermelons (2013) ) Has been revealed. In the case of watermelon, high-density genetic maps based on genomic sequence have been recently created through sequencing of the genome, and as a result of a large amount of SNP (single nucleotide polymorphism) information based on this, various plant lines and varieties In addition to classification, the utilization as a molecular marker is increasing. In the past, in traditional breeding, the genomic site of the desired trait was transduced through cross breeding, but to confirm this, there was a problem that it took a lot of labor and time to observe the corresponding phenotype. To solve this problem, molecular markers related to desired traits are being developed, and further research and development are being made to reduce labor, increase breeding efficiency, and shorten breeding period by selecting individuals during seedling with the developed markers.

The dwarf trait is one of the important traits in the plant world. In crops such as rice and barley, the dwarf phenotype is considered to be an important trait for creeping, disease resistance, and yield. In the case of watermelon, the yield and fruit size per unit area are important vegetables, so a lot of agricultural land is required for cultivation of the crop. On the other hand, if it has the characteristic of a watermelon dwarf, it can be cultivated at high density per unit area, and it is very fine and is an important trait in improving yield. In addition, a lot of labor is administered to the geodetic harvesting and arranging branches during watermelon cultivation. In the case of the watermelon dwarf, since the length between nodes is short, there is an advantage of saving labor in plant management. However, research on the genetic factors that induce watermelon dwarfism is insufficient.

KR 10-1923647 B1

The present invention has been conceived to solve the above-described problem, and an object of the present invention is to provide a single nucleotide polymorphism (SNP) marker composition for discriminating a watermelon dwarf individual.

Another object of the present invention is to provide a primer set for discriminating a watermelon dwarf individual.

Another object of the present invention is to provide a method for discriminating hundreds of dwarf stars.

However, the technical task to be achieved by the present invention is not limited to the above-mentioned tasks, and other tasks that are not mentioned can be clearly understood by those of ordinary skill in the technical field to which the present invention belongs from the following description. will be.

In order to achieve the object of the present invention as described above, the present invention is a polynucleotide consisting of 8 to 100 consecutive bases including single nucleotide polymorphism (SNP) located at the 501st base in the nucleotide sequence of SEQ ID NO: 1 Sequence or its complementary polynucleotide sequence; And at least one polynucleotide sequence selected from the group consisting of a polynucleotide sequence consisting of 8 to 100 consecutive bases including the SNP located at the 501st base in the nucleotide sequence of SEQ ID NO: 2 or a complementary polynucleotide sequence thereof. Or it provides a SNP marker composition for discriminating a watermelon dwarf individual comprising a polynucleotide sequence that is complementary.

In one embodiment of the present invention, the SNP marker composition provides a SNP marker composition for determining a watermelon dwarf individual, characterized in that it is applied to a marker-assisted backcross (MABC) using a genetic marker of watermelon.

In addition, the present invention specifically binds to a polynucleotide having 8 to 100 consecutive nucleotide sequences including the 501st nucleotide of SEQ ID NO: 1, or the 501st nucleotide of SEQ ID NO: 2, watermelon It provides a set of primers for discriminating dwarf individuals.

In one embodiment of the present invention, the primer set, a primer set consisting of SEQ ID NOs: 3 and 4; And it provides a primer set for identifying a watermelon dwarf individual comprising at least one primer set selected from the group consisting of a primer set consisting of SEQ ID NOs: 5 and 6.

In one embodiment of the present invention, the primer set according to the present invention may be a primer set for high-resolution melting (HRM) analysis.

In addition, the present invention provides a kit for discriminating a watermelon dwarf individual comprising the primer set according to the present invention.

In addition, the present invention (a) separating the genome (genomic) DNA from the watermelon to be determined; (b) detecting the 501st base of SEQ ID NO: 1 or the 501st base type of SEQ ID NO: 2 in the isolated genomic DNA; And (c) determining a watermelon dwarf individual from the detected base type.

In one embodiment of the present invention, step (b) may be to perform a polymerase chain reaction (PCR) using the primer set according to the present invention.

In another embodiment of the present invention, step (c) is one or more methods selected from the group consisting of high-resolution fusion, capillary electrophoresis, DNA chip, gel-electrophoresis, sequencing, radiometric measurement, fluorescence measurement, and phosphorescence measurement. Can be done with

With the provision of a genetic marker for selecting a watermelon dwarf individual according to the present invention, when developing a dwarf strain, DNA of a young plant or seed is extracted to immediately check the presence or absence of a dwarf, thereby efficiently discriminating and cultivating a watermelon variety exhibiting a dwarf character. Therefore, it is expected to be very useful in reducing the time, cost, and effort required for breeding.

1 shows the family tree of the F2 group, where DwfHS4450 ( dwf/dwf ) represents a dwarf phenotype, and HS4450 ( Dwf/Dwf ) represents a normal phenotype.
2 is a diagram showing the shape of stems, leaves, and seeds (in order from the top) of the dwarf phenotype DwfHS4450 (left) and the normal phenotype HS4450 (right).
3 is a graph showing the average of the lengths between the lower hypocotyl and the nodes by repeating 15 parental plants.
4 is a diagram showing candidate genes present on chromosome 9 of watermelon based on the Δ SNP-index.
5 is a diagram showing SNPs on a watermelon chromosome on a window to confirm the distribution of SNPs in the genome.
6 is a graph of P-values of 0.01 and 0.05 using SNP-index values according to BSA analysis.
FIG. 7 is a graph showing the derivation of G'-values using regression analysis in order to show the correlation between SNPs and phenotypes in the genome of watermelon according to BSA analysis.
8 is a graph of -log ₁₀ (P-value) values according to BSA analysis.
9 is a diagram showing a melting curve according to HRM analysis.
10 is a graph showing the results of measuring the expression levels of Cla015405 and Cla015406 genes in dwarf individuals.
11 is a view showing the alignment of the amino acid sequence of GAs synthase of Arabidopsis thaliana based on the sequence of Cla015405 .
12 is a view showing the sequence of Cla015405 and a phylogenetic tree created based on the GAs biosynthetic gene of Arabidopsis thaliana.
13 is a diagram showing SNP mutations and non- synonymous amino acid substitutions of Cla015405 .

The inventors of the present inventors intensively researched to develop a genetic marker related to the watermelon dwarf trait that can increase the yield per unit area of watermelon and reduce labor in prune and pruning.As a result, bases 1,866,655 and 1,872,994 on chromosome 9 It was confirmed that SNP (single nucleotide polymorphism) was associated with the dwarf character of watermelon. Accordingly, the present invention was completed by experimentally confirming that it is possible to accurately determine whether or not watermelon dwarf in all individuals as a result of developing a primer set capable of confirming the corresponding SNP and testing in the F ₂ isolated group.

In an embodiment of the present invention, the parental dwarf phenotype showed a phenotype of the length of the short lower hypocotyl, the length between the short nodes, the dark leaf color, and the size of the small seed when compared to the normal phenotype, and the dwarf phenotype was Mendel It was confirmed that it is a single recessive inheritance according to the genetic rule of (see Example 1).

In another embodiment of the present invention, candidates for loci associated with dwarf traits are selected using BSA (Bulked Segregant Analysis), and between 1.7Mbp and 2.0Mbp of chromosome 9 of watermelon and 5.6Mbp through ΔSNP-index analysis. Two regions of 6.2 Mbp were selected as candidate loci (see Example 2).

In another embodiment of the present invention, Cla-655 and Cla-994 HRM primers amplifying SNPs located at 1,866,655 and 1,872,994 regions of chromosome 9 of watermelon through high-resolution melt analysis are F ₂ It was confirmed that the phenotype and genotype were 100% identical in all 162 individuals of the isolated group (see Example 3).

In another embodiment of the present invention, it was confirmed that the Cla015405 gene was overexpressed in the dwarf line through real-time PCR, and the gene was a homogenous to GA2ox through analysis of the amino acid sequence and phylogenetic tree. It was confirmed that it appeared (see Example 5).

In another embodiment of the invention, it was of the exons (exon) 1420bp in a full-length genome of Cla015405 C is verified by mutation of the DNA sequence that varies by A, which asynchronous substituted (non-synonymous substitution of carrying a mutation of the amino acid sequence ) (See Example 6).

Therefore, the SNP markers involved in the watermelon dwarf trait identified through the above examples and the primers for detecting the same can be used to discriminate the watermelon dwarf individual.

That is, a polynucleotide sequence consisting of 8 to 100 consecutive bases including a single nucleotide polymorphism (SNP) located at the 501st base in the nucleotide sequence of SEQ ID NO: 1 according to the present invention, or a complementary polynucleotide sequence thereof, Or using a novel SNP marker composition comprising a polynucleotide sequence consisting of 8 to 100 consecutive bases including a SNP located at the 501st base in the nucleotide sequence of SEQ ID NO: 2 or a complementary polynucleotide sequence thereof Watermelon dwarf individuals can be identified faster and more accurately than conventional methods.

In the SNP marker according to the present invention, when the 501st base in the nucleotide sequence of SEQ ID NO: 1 is (A → C) and the 501st base in the nucleotide sequence of SEQ ID NO: 2 is (G → T) , Watermelon can be determined as a dwarf individual, by using a primer set capable of amplifying the SNP marker as a genetic marker, when developing a variety, DNA of a young plant or seed can be extracted and the presence or absence of a dwarf can be immediately confirmed.

The nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 according to the present invention may be a nucleotide sequence present on chromosome 9 of watermelon, and preferably may be a region of 1.8 Mb to 1.9 Mb, but is not limited thereto.

The term "watermelon ( Citrullus lanatus , watermelon)" as used herein refers to a watermelon cultivated on the Korean Peninsula or bred for the purpose of breeding, but is not limited thereto.

The term "polymorphism" as used herein refers to a case where two or more alleles are present in a single locus, and "polymorphic site" refers to a locus in which the allele is present. . Among the polymorphic sites, one that differs only in a single base depending on the individual is called'single nucleotide polymorphism', or SNP (single nucleotide polymorphism).

The term "SNP marker" as used herein refers to a single base polymorphic allele base pair on a DNA sequence used to identify an individual or species. SNPs are relatively high in frequency, stable, and distributed throughout the genome, thereby generating genetic diversity of individuals, so the SNP marker can serve as an indicator of genetic proximity between individuals. SNP markers generally include phenotypic changes associated with monobasic polymorphism, but in some cases may not. In the case of the SNP marker of the present invention, it may represent a variation in an amino acid sequence or a difference in phenotype of an individual such as dwarfism.

The term "marker" as used herein refers to a nucleotide sequence used as a reference point when identifying a genetically unspecified related locus. The term also applies to nucleic acid sequences that are complementary to marker sequences, such as nucleic acids used as a set of primers capable of amplifying the marker sequence. The location of a genetic marker on the genetic map is called a genetic locus.

The term “gene marker” or “DNA marker” as used herein can be usefully used because it is possible to quickly distinguish traits without being affected by the cultivation environment or growth timing of the crop. Genetic markers or DNA markers are a method of expressing polymorphism between individuals based on differences in the nucleotide sequence of DNA, which is the essence of genetic phenomena, mainly using microsatellite or gene nucleotide sequences consisting of repetitive simple nucleotide sequences. A marker or a Restriction Fragment Length Polymorphism (RFLP) probe or a Sequence Characterized Amplified Region (SCAR) marker is used.

According to one embodiment of the present invention, the SNP marker composition may be applied to a marker-assisted backcross (MABC) using a genetic marker of watermelon.

The term "Marker-assisted backcross (MABC)" as used herein refers to the use of genetic markers to confirm the overall composition of the chromosomes of the female hybrid offspring during the nursery, so that the female hybrid offspring has the superior trait of the recovered parent. It refers to a breeding technique that can shorten the time it takes to recover to the genome composition. In the case of conventional female hybrid breeding, it takes more than 6 to 7 generations, but MABC breeding using genetic markers can select individuals from the second generation of female hybrids. By reducing the cost, the scale and efficiency of breeding can be increased. SNP is mainly used to make markers for MABC, which is one of the structural mutations that occur more frequently in the genome compared to mutations such as simple sequence repeat or insertion/deletion (indel). This is because the entire process of reaching can be automated. However, since excessively many SNPs consume a lot of time and cost for the experiment, it is important to select SNPs with high accuracy and high utilization.

In addition, the present invention can provide a primer set for detecting the novel SNP marker or amplifying a polynucleotide containing SNP. Preferably, the primer set may be at least one selected from the group consisting of a primer set consisting of SEQ ID NOs: 3 and 4 and a primer set consisting of SEQ ID NOs: 5 and 6, but a primer for detecting the SNP marker disclosed herein Ramen is not limited thereto.

The term "nucleotide" or "polynucleotide" as used herein refers to deoxyribonucleotides or ribonucleotides present in the form of single-stranded or double-stranded, and includes analogs of natural (poly)nucleotides unless otherwise stated. .

The term "primer" as used herein is a single-stranded oligonucleotide, under suitable conditions (the presence of four different nucleoside triphosphates and a polymerase such as DNA or RNA polymerase), a suitable temperature, and a suitable buffer. It is meant to serve as a starting point from which template-directed DNA synthesis can be initiated. The suitable length of the primer is determined by the properties of the primer to be used, but is usually used in a length of 15 bp to 30 bp. The primer does not have to be exactly complementary to the sequence of the template, but must be complementary enough to form a hybrid-complex with the template.

According to another embodiment of the present invention, the primer set may be a primer set for high-resolution melting (HRM) analysis.

In the present invention, "High-resolution melting (HRM)" refers to the temperature of the amplified product DNA bound to the fluorescent reagent from about 60°C to 90°C, depending on the SNP on the DNA present in the region amplified by PCR. It refers to a method of measuring the change in fluorescence intensity when denatured into single-stranded DNA.

In addition, the primer set according to the present invention may be included in a kit for discriminating a watermelon dwarf individual. Specifically, the kit may be applied to a marker-assisted backcross (MABC) using a genetic marker of watermelon, but is not limited thereto. In addition, the kit may include conventional components included in the PCR kit, in addition to the primer set according to the present invention. Typical components included in the kit may be a reaction buffer, a polymerase, dNTP (dATP, dCTP, dGTP and dTTP), and a cofactor such as Mg ²⁺ . Various DNA polymerases can be used in the amplification step of the present invention, and include Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species. Most of these polymerases can be isolated from the bacteria themselves or are commercially available.

In addition, the present invention can provide a method for discriminating a watermelon dwarf individual comprising the step of detecting the 501st base of SEQ ID NO: 1 or the 501st base type of SEQ ID NO: 2 in genomic DNA.

According to an embodiment of the present invention, the detection step may be to perform a polymerase chain reaction (PCR) using the primer set according to the present invention, but is not limited thereto as long as it is intended to achieve substantially the same purpose.

According to another embodiment of the present invention, experimental techniques such as high-resolution melting, capillary electrophoresis, DNA chip, gel-electrophoresis, sequencing, radiation measurement, fluorescence measurement, and phosphorescence measurement as a method for discriminating a watermelon dwarf individual Although it may be used, it is not limited thereto as long as it uses the SNP marker according to the present invention.

The terms or words used in this specification and claims should not be construed as being limited to their usual or dictionary meanings, and the inventor may appropriately define the concept of terms in order to describe his own invention in the best way. It should be interpreted as a meaning and concept consistent with the technical idea of the present invention based on the principle that there is.

Hereinafter, a preferred embodiment is presented to aid the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1: Normal line, dwarf line F _One And F ₂ Group acquisition and phenotypic analysis

1.1. Secure normal and dwarf systems

For the development of genetic markers associated with watermelon dwarf traits, a parental model representing a dwarf phenotype (hereinafter referred to as "DwfHS4450") and a copy representing a normal phenotype (hereinafter referred to as "HS4450") (Partner Jongmyo, Korea) were obtained as parents. 1 hybrids (F ₁ hybrid) and the self-F ₁ F ₂ was used for generation obtained by water (self-pollination) (see Fig. 1).

1.2. Phenotypic test of parental copy and F1, F2 isolated groups

The phenotypic test of the parental copy was performed at the stage of 25 main leaves of the plant, and the test was performed with 15 repetitions of the individual. In the phenotypic test, leaf color, seed size, and the length between the lower hypocotyl and node were compared, and the length between the lower hypocotyl and the node was measured using the average inter-node length of 15 individuals after measuring the length of each node. It was plotted using graphs. The phenotypic test of the F ₁ and F ₂ isolated groups was performed 6 weeks after sowing (sowing together with the parent copy and phenotypic test).

As a result, the parent counterpart and F _1, F ₂ separation phenotype black in the group result dwarf (also the right side of Fig. 2) and normal (FIG left in Fig. 2) phenotype were clearly distinguishable, in both of the F ₁ phenotype normal individual phenotypes and It was confirmed that they showed the same phenotype. When compared with the normal phenotype, the parental dwarf phenotype showed a short inferior hypocotyl length, interstitial length, dark leaf color, and small seed size phenotypes, which were different from the dwarf and normal phenotypes in the F ₂ isolated group. It was confirmed that it was inherited together (Fig. 2).

In addition, as a result of phenotypic test of the length between the nodes of the parent, it was found that the length growth of the parent dwarf lineage proceeds from the 8th node, and even when the length was grown, it was confirmed that the phenotype was remarkably short compared to the normal lineage. (Fig. 3, Student's t test, *** P <0.001). Accordingly, 15 parent specimens of the plant were repeated and plotted in a graph using the average of the lengths between the lower hypocotyl and nodes (the length between nodes 0 to 4 and 4 to 8 of the dwarf line is the average value of each in the graph. Marked using ).

As for the phenotype of the F2 segregation group, as a result of testing the initial 117 individuals, 87 normal phenotypes and 30 dwarf phenotypes were observed, and then F for additional high-resolution melting (hereinafter referred to as "HRM") test. ₂ When further phenotypic tests were performed on 45 isolated groups, 34 normal phenotypes and 11 dwarf phenotypes were observed. As a result of the phenotypic test of a total of 162 individuals in the F ₂ isolated group, as shown in Table 1 below, a normal: dwarf phenotype was observed as 121:41, and 3 inherited by a single recessive gene according to Mendel's genetic law. The phenotypic separation ratio of :1 was confirmed.

Generation Number of observed plants Normal: Dwarf total
(Total) normal
(wild type) dwarf star
(Dwarf) Observation rate Expected rate P1 15 - 15 1:0 1:0 P2 15 15 - 0:1 0:1 F1 5 5 - 1:0 1:0 F2 162 121 41 2.99:1.01 3:1

Example 2: Search for candidate loci of dwarf traits through bulked segregant analysis (BSA) of the parental copy

2.1. DNA extraction

For DNA extraction, a sample of 85 mg of plant leaves was placed in a 2 ml tube (Eppendorf, Germany), frozen using liquid nitrogen, and ground using an Automill (Tokken, Japan). After grinding the plant, 850 µl of DNA extraction buffer (1.5M NaCl, 200mM Tris-HCl, 50mM EDTA, 2% SDS, 2% β-mercaptoethanol, 300mM potassium acetate) was reacted with the sample at 65°C for 20 minutes. . After completion of the reaction, 900 µl of PCI (Phenol: Chloroform: Isoamylalcohol = 25: 24: 1, v/v/v) was added and mixed, followed by centrifugation at 4° C. 13,000 rpm. Thereafter, the supernatant was transferred to a new 1.5ml tube (Sarstedt, Germany), and the same amount of isopropanol was added to the supernatant, mixed, and allowed to stand at -20°C for 20 minutes. Thereafter, centrifugation was performed at 4° C. at 13,000 rpm to obtain a pellet. This was washed for 1 minute at 4° C. 13,000 rpm using 70% ethanol, and after removing the ethanol, the pellet was dissolved in 600 µl of 1xTE (Tris-EDTA) buffer. Thereafter, 1 µl of 10 mg/ml RnaseA was added and treated for 15 minutes in a 37° C. constant temperature water bath, and purification was performed in the same manner as above using PCI in the same amount as the supernatant. Afterwards, the same amount of CI (Chloroform: Isoamylalcohol = 24: 1, v/v) was added to the used PCI and centrifuged at 13,000rpm at 4℃, and the supernatant was transferred to a new 1.5ml tube. 5M NaCl and the same amount of isopropanol were added, mixed, and allowed to stand at -20°C for 20 minutes. After that, washing was performed in the same manner as described above, and the pellet was dissolved in 50 µl of 1xTE to complete DNA extraction. The quality of DNA was confirmed using an electrophoresis and spectrophotometer (Spectrophotometer; DS-11, 28 DeNovix, USA), and quantification was measured using a fluorescence photometer (flourometer; Qubit ^® 2.0, Invitrogen, USA).

2.2. Resequencing of the parent copy

Resequencing of each parental copy was performed to analyze the base sequence of the parental DwfHS4450 and the auxiliary HS4450 used in this experiment. To this end, 50 µg of each parental DNA was first prepared, and then it was confirmed that the DNA was of Next-Generation Sequencing (NGS) according to the above-described DNA quality check method. Thereafter, paired-end sequencing was performed using a HiSeq-4000 system (illumina, USA) based on a read length of 150 bp. Subsequently, filtering of the sequence created based on the FASTQ data of the sequence obtained through sequencing was performed, and the alignment was analyzed with the watermelon reference genome sequence published in 2013, and contig and scaffold ( scaffold) was prepared and the SNP variable of the two parent copies was identified.

2.3. Sequencing library production for BSA

In BSA (Bulked Segregant Analysis) using NGS, individuals with bipolar phenotypes are selected from the group in which the desired phenotype is separated, DNA of the selected individuals is extracted, and then DNA is pooled for each individual with the same phenotype. This is a method of analyzing the difference of SNPs by sequencing the pooled DNA as each DNA bulk. Since the two bulks have different phenotypes and genotypes, the locus of the target trait can be found by comparing and analyzing the phenotype and genotype of individuals selected from the isolated group.

Accordingly, the present inventors selected 20 individuals each having a dwarf phenotype and a normal phenotype from the F ₂ isolated group for BSA analysis and extracted DNA. After that, DNA pooling for each phenotype was performed. The pooled DNA of the dwarf phenotype was named D-bulk, and the pooled DNA of the normal phenotype was named W-bulk. For DNA pooling, the same amount of DNA was used for each individual, and 175ng of DNA was used for each individual after the extracted DNA was diluted to 20ng/µl, and 3.5µg of DNA for each bulk was sequenced.

Resequencing of each bulk was performed with a read length of 101 bp and paired-end sequencing using the HiSeq-2500 system (illumina, USA), and the reads made through this were analyzed in the same manner as the parent copy. VCF (Variant Calling Format) was written. Using this, SNPs of the F ₂ isolated group were searched and candidate loci were determined.

As a result of sequencing the parent copy, the data of about 15 Gbp for the parent and about 13 Gbp for the parent were produced, and as a result of sequencing for the BSA bulk, about 17 Gbp for the W-bulk and about 18 Gbp for the D-bulk were produced. Candidate loci were searched using the sequencing results of the parent copy and the prepared two BSA bulks. D-bulk with dwarf phenotype and W-bulk with normal phenotype, respectively, were subjected to ΔSNP-index analysis using read data aligned after sequencing.

2.4. Search for candidate loci through ΔSNP-index comparison

After performing bulk sequencing for BSA, candidate loci were determined through the SNP index of each bulk. The SNP-index refers to the ratio of reads with an alternative sequence in which SNP was found in the number of aligned reads derived through bulk sequencing, which is a reference sequence ) Was calculated by dividing the total number of aligned reads by the number of reads with SNPs aligned in ). Candidate loci were determined by calculating the difference between the SNP-index values of the two bulks using the SNP-index. This is referred to as ΔSNP-index, and was derived using the difference in the index of the dwarf phenotype D-bulk from the SNP-index of the normal phenotype W-bulk. That is, in the case of the SNP associated with the dwarf trait, the desired trait, the SNP of the D-bulk does not have an alternative sequence different from the reference sequence, so the index value increases and approaches 1, and in the case of W-bulk, the same sequence as the reference sequence is Because it has, the SNP-index value decreases. Therefore, a ΔSNP-index value was derived, and a portion where the value converged to -1 was selected as a candidate locus (FIG. 4).

As a result, as shown in Figure 4, the ΔSNP-index value representing the candidate locus was derived to be about 0.6 to 0.7. This is because the phenotype test result showed the same phenotype as the normal copy and F ₁ , so that the W-bulk could be produced in the F ₂ isolated group. When heterozygous individuals were selected, the results seem to be underestimated. In addition, because it is the result of the analysis in the isolated group, even if the ΔSNP-index value is close to -1, the part where the SNP is not concentrated was excluded from the candidate locus.

The present inventors also selected candidate loci associated with the dwarf trait, the target trait, using the index values of SNPs derived through the BSA method. To this end, SNPs were first loaded using GATK (Genome Analysis Toolkit), and the SNPs on the watermelon chromosome were displayed on a window using the QTLseqr tool to confirm the distribution of SNPs in the genome (Fig. 5). Thereafter, in order to find a candidate locus, the SNP-index value was used and graphed according to P-values of 0.01 and 0.05 (FIG. 6). In addition, in order to show the correlation between SNPs and phenotype in the genome, a G'-value was derived using regression analysis, and candidate loci were derived at a threshold of 5.8 (Fig. 7), -log ₁₀ A candidate locus was confirmed at a (P-value) threshold of 12.6 (Fig. 8).

As a result of ΔSNP-index analysis, candidate loci for watermelon dwarf traits were identified as between 1.7Mbp and 2.0Mbp of watermelon chromosome 9 and between 5.6Mbp and 6.2Mbp, and between 1.2Mbp and 1.4Mbp of chromosome 10. However, as a result of the phenotypic test of the watermelon isolate, the watermelon dwarf gene is inherited by a single gene, so the two regions between 1.7Mbp and 2.0Mbp and 5.6Mbp to 6.2Mbp of chromosome 9, which exceeded the critical value, were ultimately selected as candidate loci. I chose. Thereafter, HRM analysis was performed in the F ₂ isolated group using the HRM technique for final selection of candidate loci.

Example 3: Development of a dwarf trait-related gene marker through HRM (High-resolution melting)

The present inventors selected two candidate loci through Example 2, and conducted an experiment by constructing a high-resolution melting (HRM) primer for the production of a marker based on a single nucleotide sequence mutation associated with a watermelon dwarf. Each primer sequence is shown in Table 2 below. The term "region" used in the specification including Table 2 below means a base located at a location corresponding to the number indicated on chromosome 9 of watermelon, and SEQ ID NOs: 1, 2, and 7 to 14 include SNPs of the corresponding region The nucleotide sequence of 1001 bp in length is indicated.

By confirming the results obtained through BSA-sequencing, candidate regions were selected, and HRM primers were prepared, and the experiment was conducted using a LightCycler ^® 96 system (Roche Life Science, USA). The HRM reagents used for each sample are as follows: 2 ng (1 ng/µl, 2 µl) of genomic DNA of the analysis sample, 5 µl of 2X HRM master mix, 1 µl of 5pmole forward primer, 1 µl of 5pmole reverse primer, 25 mM MgCl ₂ 1.2 µl (Roche Life Science, USA), nuclease-free water (Noble bio, Korea) was added to a total volume of 10 µl. PCR conditions were denatured at 95°C for 10 minutes, followed by 45 cycles with 10 seconds at 95°C, 15 seconds at 60°C, and 15 seconds at 72°C. After the completion of PCR, the temperature was increased by 4.4°C per second to draw the melting curve of the PCR product, and the temperature was decreased by 2.2°C per second to complete the melting curve. HRM analysis was performed using LightCycler ^® 96 application software (Roche Life Science, USA).

HRM analysis analyzed the candidate locus 1.7Mbp~2.0Mbp and 5.8Mbp~6.2Mbp of chromosome 9 of watermelon (Fig. 9). First, for the selection of candidate loci, the phenotypes of the 1,805,434, 5,819,222, and 6,180,850 regions SNPs on chromosome 9 were analyzed using 106 F ₂ isolates. As a result, there were 2 discrepancy out of 106 individuals in 1,805,434 areas, and 46 discrepancies in 5,819,222 and 6,180,850 areas respectively. Therefore, finally, the locus of the watermelon dwarf trait was selected from 1.7Mbp to 2.0Mbp. Thereafter, in order to narrow the locus and produce the nearest HRM marker, 7 HRM primers shown in Table 2 were additionally prepared in the 1,805,434 to 1,897,481 regions, and HRM analysis was performed in 162 F ₂ isolated groups.

As a result of HRM analysis using the seven primers (Cla-186, 359, 655, 994, 167, 997, and 481), Cla-655, and Cla- that amplify SNPs located in the 1,866,655 and 1,872,994 regions on chromosome 9 All 162 individuals of the F ₂ isolated group of 994 HRM primers showed 100% matching of phenotype and genotype (Table 3 and Table 4). In particular, the SNP marker showed a degree of concordance of about 99.4%, and compared with the SNPs in the 1,827,186 and 1,857,359 areas, which can identify watermelon dwarf individuals with very high accuracy, it is possible to completely discriminate watermelon dwarf individuals with higher accuracy. It is believed that the point has technical significance.

primer area SNP Number of mismatches/number of objects Cla-434 1,805,434 G→C 6/162 Cla-186 1,827,186 A→C 1/162 Cla-359 1,857,359 C→A 1/162 Cla-655 1,866,655 A→C 0/162 Cla-994 1,872,994 G→T 0/162 Cla-167 1,879,167 TG→Inserted A 1/162 Cla-997 1,887,997 T→G 2/162 Cla-481 1,897,481 G→T 2/162 Cla-222 5,819,222 G→A 46/162 Cla-850 6,180,850 C→A 46/162

* D/D=normal, D/d=semi-dwarf or normal, d/d=dwarf

Example 4: Identification of dwarf trait-associated gene

The HRM analysis result of Example 3 and CuGenDB (Cucurbit Genomics Database) were checked to find two candidate genes associated with Gibberellin (hereinafter referred to as “GAs”) biosynthesis. As a result of the HRM analysis, the genes found to have a discrepancy of 0 were Cla015405 and Cla015406 , and these were all 2-oxoglutarate-dependent dioxygenase, hereinafter “2-OGD” ), and it was confirmed that the gene has the same function. In addition, as a result of confirming the nucleotide sequence similarity of the two genes through homology search of Cla015405 and Cla015406 , it was confirmed that they are homologs having 85.7% sequence similarity.

The 2OGD superfamily is the second largest group of enzymes in the plant genome, and each family member is known to be involved in various oxygenation/hydroxylation reactions in the plant. The 2OGD superfamily is classified according to the phylogenetic or amino acid sequence similarity, of which 2OGD, which is involved in the biosynthesis of GAs, is preserved in the vascular genus, and 2OGD, which is involved in the biosynthesis of flavonoids and ethylene, is classified with the naja plant. Preserved in pizza plants. In addition, 2OGD, which is involved in the biosynthesis of GAs and flavonoids, has been studied most extensively because of its agricultural significance. The superfamily of 2OGD is divided into DOXA, DOXB, and DOXC groups according to the similarity of the amino acid sequence. Of these, the genes involved in the biosynthesis of GAs are the DOXC group, respectively, from DOXC3 to GA3ox (Gibberellin 3-oxidase), and DOXC7 to GA20ox (Gibberellin 20). -oxidase), GA2ox (Gibberellin 2-oxidase) was found in DOXC12. It can be said that proteins involved in the biosynthetic pathway of GAs are conserved in the ortholog of 2OGD of vascular plants. GA3ox is used as an enzyme that catalyzes the hydroxylation of GA ₉ and GA ₂₀ during the biosynthesis of GAs to synthesize GA ₄ and GA ₁ , which are active GAs in plants. GA20ox is used as an enzyme that synthesizes GA ₁₂ and GA ₂₄ . It is known to have a function of catalyzing the synthesis of GA ₉ by catalyzing decarboxylation. In addition, it is known that GA2ox catalyzes the hydroxylation of GA ₁ and GA ₅ , which are bioactive GAs, and catalyzes the synthesis of GA ₅ and GA ₃₄ , which are inactive GAs. Therefore, we predicted that 2OGD, which is associated with GAs biosynthesis, might be a gene associated with watermelon dwarfism.

Example 5: Analysis of the expression level and function of the gene containing the final selected SNP marker

5.1. RNA extraction and cDNA synthesis for real-time PCR

2OGD is GA2ox one converts the GAs represents a physiologically active (bioactive) gene GA20ox or GA3ox or physiological activity of a significant role in the biosynthesis of GAs representing in plants As described in Example 4 in an inactive state Therefore, it was predicted that the phenotype would have changed due to abnormal expression of the gene expressed in the pathway for biosynthesizing GAs of the watermelon line where the dwarf phenotype was observed. Accordingly, two primers were prepared for each of the Cla015405 gene and the Cla015406 gene to analyze the gene expression of the parent copy.

In order to analyze the expression level of the gene and search for its function, RNA sampling was performed with 3 repetitions of 80 mg shoots by selecting one 80 mg shoot at the step of 4 main leaves where the phenotype of the parental copy can be compared. Since GA ₃ biosynthesis is known to occur a lot in shoots, growth points, and apical meristems of roots where cell division occurs actively, the expression level of the gene was confirmed by extracting RNA from the shoot site.

RNA extraction for real-time PCR was extracted with a protocol partially modified from the known TRIzol method. To extract RNA, 80 mg of plant leaves were prepared in a 2 ml tube, and the leaves were finely ground using a striker. After grinding, 900 µl of Trizol (Molecular Research Center, USA) buffer was added, and the buffer was reacted with the ground leaf sample, followed by centrifugation at 13000 rpm for 3 minutes. Then, the supernatant was transferred to a new 2ml tube, 300µl of chloroform was added, vortexed for 15 seconds, and centrifuged for 15 minutes at 13000rpm at 4°C. Transfer the supernatant to a new 1.5ml tube, and add the same amount of PCI (phenol: chloroform: isoamylalcohol = 25: 24: 1, v/v/v) phenol (pH 4.3; Sigma, USA) to the supernatant for 15 seconds. After vortexing, it was centrifuged for 15 minutes at 13000 rpm. Thereafter, the supernatant was transferred to a new 1.5 ml tube, and the same amount of CI (chloroform: isoamylalcohol = 24:1, v/v) was added to the supernatant, vortexed for 15 seconds, and then centrifuged at 13000 rpm for 15 minutes. Again, the supernatant was transferred to a new 1.5 ml tube, and the same amount of isopropanol (Merck, Germany) was added, allowed to stand at -20°C for 10 minutes, and centrifuged at 13000 rpm for 10 minutes. After washing twice for 10 minutes at 13000 rpm using 75% ethanol (ethanol), the pellet was dissolved using 50 µl of nuclease-free water (Noble bio, Republic of Korea). After that, the extracted DNA was removed using a Dnase1 kit (Roche Life Science, USA) to remove the DNA mixed with the extracted RNA. The purity and quantification of RNA was measured using a spectrophotometer (DS-11, 28 DeNovix, USA).

CDNA synthesis for real-time PCR was performed using a cDNA synthesis kit (Roche Life Science, Germany). Nuclease-free water was added to 1 µl of 1µg RNA (500ng/µl, 2µl) and Anchored-oligo(dT)18 primer (50pmole) to a total volume of 13µl at 65℃. Primer annealing for 10 minutes, 5X Transcriptor Reverse Transcriptase reaction buffer 4 µl, 40 U/µl Protector RNase Inhibitor 1 µl, 10 mM deoxynucleotide mix, respectively 2 Μl, 20U/µl, 0.5µl of Transcriptor Reverse Transcriptase was added to synthesize cDNA at 50°C for 60 minutes. Thereafter, the enzyme was inactivated at 85°C for 5 minutes to complete cDNA synthesis and then stored at -20°C.

5.2. Analysis of gene expression level through real-time PCR (rt-PCR)

Using the synthesized cDNA, primers for each candidate gene were prepared and real-time PCR was performed. The primers used are shown in Table 5 below.

Rt-PCR was performed using a LightCycler ^® 480 SYBR Green I master kit, and the cDNA synthesized in Example 5.2 was diluted to 1/32 and used. More specifically, PCR was performed by making a total volume of 20 µl with distilled water (PCR grade) in 10 µl of 2X master mix, 2 µl of 5pmole PCR primer, and 4 µl of cDNA diluted with 1/32. The experiment was carried out with 3 repetitions and 2 technical repetitions for each individual, and each primer NTC (No template control) was performed with 3 technical repetitions. The RT-qPCR assay of the gene was carried out by producing two primers for each gene, and 18s rRNA was used as a reference gene for the comparative Ct analysis. PCR conditions were denatured at 95°C for 10 minutes, followed by amplification of DNA for 45 cycles with 1 cycle at 95°C for 10 seconds, 60°C for 10 seconds, and 72°C for 10 seconds. The results were analyzed by creating a melting curve. The results were analyzed using LightCycler ^® 96 application software (Roche Life Science, USA), and the results were confirmed by analyzing according to the 2 ^{ΔΔ Ct} value.

As a result, as shown in FIG. 10, it was confirmed that Cla015405 showed a higher expression level in the dwarf line, and in the case of Cla015406 , it was confirmed that no statistically significant difference in expression level appeared in the parental copy (value is mean±SD. , Significant differences (P <0.05) in student's t-test are marked with'*').

5.3. Gene function prediction

Cla015405, and features of Cla015406 gene real-time PCR using a sequence of product NCBI (National Center for Biotechnology Information) the result of proceeding the domain search through BLASTx and centromere of MEGA6 sopeuteuweeoeul gene create a phylogenetic tree (phylogenetic tree) using ( ortholog) to predict gene function.

As a result, the domain region of GA2ox could be found in the PCR products of the primers Cla-405-2 and Cla-406-1 in Table 5 (Fig. 11), and Arabidopsis thaliana using the amino acid sequence of the region As a result of drawing and confirming the GAs biosynthetic genes (GA20ox, GA3ox, GA2ox) and the phylogenetic tree, it was confirmed that the 2OGD gene was a mobilizer with GA2ox (FIG. 12 ).

Accordingly, the gene is expected to function as GA2ox in plants as DOXC12 of the 2OGD superfamily. Since the above gene inactivates GAs, which exhibit physiological activity, dwarfism can be induced through overexpression of the gene. This is a new form of dwarfism that is different from the previously reported dwarf stars involving GA20ox. Accordingly, the present inventors confirmed that dwarf stars appear in watermelons by the gene Cla015405 , which is highly expressed in watermelons of the dwarf line and low in watermelons of the normal lineage.

Example 6: SNP variant search of the final selected gene

The present inventors performed Sanger sequencing to accurately identify mutations in the gene sequence and amino acid sequence of Cla015405 . For sequencing, PCR was performed by inserting a BamH I recognition site in the 5'region of the gene and an EcoR I recognition site in the 3'region using a primer targeting the gene. The primer sequences are shown in Table 6 below.

Gene name primer order Length Gene size Product size Cla015405 Cla405san-F
(SEQ ID NO: 41) ATTGGATCCAAGCCATGATAGCCATCAAAT 30 2132 2200 Cla405san-R
(SEQ ID NO: 42) ATTGAATTCTGTTGATTCAAAGGCCACAA 29

For PCR, GXL taq (TaKaRa, Japan) was used, and the reagents for each sample were as follows: 5 ng (1 ng/µl, 5 µl) of genomic DNA of each parent and counterpart, 10 µl of 5X PCR buffer, before 5 pmoles. 1 µl of a direction primer, 1 µl of 5pmole reverse, and 4 µl (TaKaRa, Japan) of dNTP (each 2.5mM) were added to a final volume of 50 µl with nuclease-free water (Noble bio, Korea). . PCR conditions were denatured at 95°C for 1 minute, followed by 30 cycles at 98°C for 10 seconds, 55°C for 15 seconds, and 68°C for 300 seconds. After completion of PCR, the finished product was ligated to the multiple cloning site (MCS) of the pUC19 vector to proceed with cloning, and transformed into E. coli , and then the transformed E. coli A large amount of plasmid was extracted from and sequencing was performed.

As a result, as shown in Figure 13, it was possible to find four SNP mutations in the Cla015405 full genome (full genome). In the SNP mutation of Cla015405, a mutation in the DNA sequence where T changed to C at 1037 bp of the intron and T to G at 1749 bp was confirmed, and C to T at 1230 bp of exon, and C to A at 1420 bp. Variations in the changing DNA sequence were identified. In the case of the mutation at the 1230bp position, a mutation in the nucleotide sequence was confirmed, but it was confirmed that a synonymous substitution did not occur in the amino acid sequence (serine to serine). On the other hand, it was confirmed that the sequence mutation occurred at the 1420bp position was a non-synonymous substitution in which the amino acid sequence was changed from glutamine to lysine.

In summary, the present inventors selected candidate genes through HRM analysis, and developed a gene marker that perfectly matches the phenotype. And the result of real-time PCR of the candidate gene and the result of integrated analysis through BLASTx and MEGA6 software, it was confirmed that Cla015405 is an ortholog with GA2ox, and this gene is overexpressed in dwarf plants to induce dwarf traits. Accordingly, mutations in the exact nucleotide sequence of the genetic marker were confirmed through Sanger sequencing.

Based on the above results, the present inventors finally selected the SNPs in the 1,866,655 region (SEQ ID NO: 1) and 1,872,994 region (SEQ ID NO: 2) on chromosome 9 of watermelon, and the novel genetic marker for determining the watermelon dwarf trait individual The development was completed.

The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the art to which the present invention pertains can understand that it is possible to easily transform it into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not limiting.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Novel genetic markers for selection of watermelon dwarf entities and use thereof <130> MP19-195 <160> 42 <170> KoPatentIn 3.0 <210> 1 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 1 ttacgtctta aaagttgaaa aaaggattgt ggagttaatt accatgagtg catcgccagc 60 catgaacatg aaggagcaat ggggtgaggg gtgaatatca atccattgat cattaggtga 120 tagaacttga agaccagaaa tgagatgctg atgaattatt gaaaagaaag tgagatctgt 180 atggcaatgc aatcccacat ccgtttcatc tttctcagga actctgtatt tcaagaatcg 240 aagaaggtag tttgtggact ccatgtttga ttcactcaca cccttcgata ctccatagct 300 ttccaatacc atttttgtta ccatcttctc caatttcacc aacaacgttg aaaaacgttg 360 aacagtttca ctgtcaatca ttatttagtt tcatgtaaca tgataatcaa aattaaacca 420 acacctcatt tttctaactc aacttttgtt ttttttcaaa taactaaagg gtaagagaga 480 tatctcaact cagttgacac aactccaaat acaaaagtga tacattcaca tagattcaag 540 gaactaatgg gcattaaatt aaaagtcttt agggtaataa ttttatcaat aactaattag 600 gcatgaacac aacatatata agctaaaatg tcaagatcct taaaagtata aaaattgtca 660 tttttttaat gattttttta aaaaatatat ggattaaatt gttacaaatt tggaagtaaa 720 aggaataaat cattacaagt tacaaatcaa agtttaggga ttaaattgtt attttcatcc 780 tatgtttagg ccaaaagtgt ttttgaacta attaaattga atatctaata gattggttat 840 tttttaaaaa tttaaaaaat ggcaattgat cgatctatat gggaaaaaaa attgaagttg 900 agagacatat tagacattaa tttcaagaac caaatagaca caaatcctaa aaaaaaaaat 960 atatattaag aaatataatt tttcatgtta taaactcaat t 1001 <210> 2 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 2 tacaagacct tattctatcg ttgctccatg cctacaccca tcaataatac atacaacata 60 tggttagatt acaagtttag tctctacatt ttaagttgac atccataaat ttatagccgg 120 atgaaattta attaactaga catttattaa ttatcttgta tctagtagat tagtaaagtt 180 cattttcatt ctatatattt taaggtattt ggctactcta tatattgagg ttgcaaccat 240 tttttgtagt caaaatttgt ggcctcccat cacaaggtgc cacgagacta tcttataatt 300 cttttatttt ctttgtcttt tcttaaagtt tattttcttg gtgcagctgt gctatactat 360 tctgattaca agttaaaagt taaattacta aatttcatta cgaaaaaaaa ataacaataa 420 ggttggtgtg gttaccatga gtgcatcacc ggccatgacg atgaaggagc aatgacctga 480 gggctgaaca tcgatccatt gatcatcaag taattgaatt tgaagaccag aaatgagatg 540 ttgatgaatt agggaaaaga aagtgagatc tgtatgggaa tgcaaaccca cgtccgtttc 600 atctttctga ggcactctgt atttgaagaa tcgaagaagg tagtttgtgg attccatgtt 660 tgattcactc acaaacttcg gtactccata gctttccaat accattcttg tcaccatctt 720 ctccaatttc gccaccaaca ttgagaaacg ttcaacagtt tcactgccaa tcattattct 780 tcagtttcat agaagatcat caaaaccaaa caaaccccat tttttcaact attagaaact 840 taaaactcat gccttgccca attcagctat gaaaaagttc atgaaagtaa taattatttt 900 gtctctaaac tttagtttgt aacaatttag tctttgaact tacgtatgta gatacaattt 960 agtccttata acgatttagt ccctattgtg aaaattattg t 1001 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Cla-655-F Primer <400> 3 ccaacacctc atttttctaa ctca 24 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Cla-655-R Primer <400> 4 tgtgaatgta tcacttttgt atttgg 26 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-994-F Primer <400> 5 acgatgaagg agcaatgacc 20 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Cla-994-R Primer <400> 6 tcatcaacat ctcatttctg gtct 24 <210> 7 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 7 atttatagct tatacaaaaa ttgttccttg cctactcact tttaaattat tactttctta 60 gacatgttta atttctaaaa aaaatgtaga acactattat atgtatatat taatctataa 120 tatcgacatc ttgccgatcc ttgcatctcc actctactag tttaggcact ctaaaaggtt 180 tgaagttcaa atctccaact ctatatgttg aactaacaaa tagcgaatag cgaataagcc 240 tttcttctaa agattccctg ctagatgtac ttgatctttt cctgaagtca ataattaaac 300 aaaacttttt ttttcttttt ctttcttgct catcttaata ctaagatata aattgtgatt 360 taggatgggg caacacactg aagttttcct ggaatctccc tttctttgtc atgcaaacga 420 tttgtgtttc catcctaaca tggctttgaa aggtgcttac aatagtggac atgacatccc 480 tacattttct atatatattt gcaaaagttt cagcatatgg tagacatgat ataaggtaat 540 tttcctaatt aaatgtaact aataacttgt ttgatatata tctataccaa gtgtataaaa 600 aatattcaaa ataaactact tgtttagaga caggagtaat attttagatg agaggttaaa 660 tatataattt tacctttaat tcttgtcctt tttttttcct cttaaaattt ttaatttttt 720 ttctttgtat gttaattttg tcttttgatc gatttcttat ttttgataaa tgtaaaagaa 780 tgatgtttaa gaacattctt tatagagtat cccattgata tctcagttgt atatttctcc 840 ctgattttct aataggtgaa attacaagtt gtgtgacaaa taggttttta aattttaagg 900 tgtttaaaaa atctctaaat ttttaatttt gcgttaagta gattattgaa cattaaattc 960 tttttttaat aaatcttaga tttttgattt tgtctaataa g 1001 <210> 8 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 8 gattaggggg cttagggata acccgagagg acgtggagtg ggccgggcct gatggggatt 60 tcaagactag tcatgtagca attcagttca actcctaccc ggtttgcccg gacccggatc 120 gagccatggg tctcggggcc cacaccgaca ccagcctctt aaccattgtg taccaaaaca 180 acacaagtgg gttacaactt ttgcgggaag ggaaccggtg ggtgacagtg gagccggtac 240 ccggtgcact tgtggttcaa gtgggagact tgttccacat tctcgcaaac gggttgtacc 300 ctagttcgtt acatcaggcc tttgtgaacc ggacccgaaa gcgcctctcg atggcttact 360 tttttggacc gccggaaacc gctcaaattt caccgcttaa gaaacttgtg ggcccaactc 420 aaccaccact ttaccgcacc gtaacttgga ctgagtacct ccgtaaaaaa gcggaacttt 480 ttaacgacac actctcatct atccgtctct acactcctct cactggactg ttagatgtca 540 acgatcatag ccaggtgaaa gtaggctaat aacctccacc tcttcccaca actctagact 600 tcttcctttt cttgtccaac gtttcaaatc ttctccattt tggctaacta tataataaat 660 attaatgtaa ctaaagccaa tttggattta agtgcttttc atttttaatc aaagggaggt 720 ttgtgcttgg tgggtgtaag tgagaaatat gtatctaatc cacggtgtgt ttgtgtaagt 780 ttggattata taggtgtgtg gaaagtaaat gtaaatgaaa tatgatttga agaaaattaa 840 aaaaagaaaa aaaaatgttt atgttttggc ctatgtagga cacataatca tgagttatat 900 cttcatatct atgaaaatgt atgtttgtgt tgtgtattta ataaatggac ctaatctcga 960 gattattctt ctctcccaat tcccaaccaa atcacgcaca t 1001 <210> 9 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 9 aaaataaccg aagtcttcaa atcccacccg gtccacatcc ccgcccacaa aaacctcgac 60 tttgactctc ttcatgaact ccctgattcc tatgattgga ttcaacccga ttctttccct 120 tcttccctca atattaataa taataatctc atctctctct ccgactcctt ccctctcatt 180 gacctttctc tccctaacgc ccctcatctc attggcaatg ccttccgtac ttggggggct 240 ttccaagtca ttaaccacgg tgtccccatt tccctccttc actccattga atccgccgcc 300 aattccctct tctcccttcc ccctccccac aaactcaaag ccgctcgtcc ccccgatggc 360 atctccggct acggcctcgt tcgtatctcc tccttcttcc ctaaacgtat gtggtccgaa 420 ggcttcacca tcgttggctc ccctctcgaa cactttcaga aactctggcc tcacgactac 480 gttcaatact ggtagtgtga caatcacatt gaataattta cttttttttt tttaattatt 540 tttttaatat aaaggcacat tggcttctta tattaaacta gttaattaac attattatat 600 tattaaattt ttagtgatat tatggaggaa tatgaccgag agatgaagag tctatgtgga 660 aggctgatgt ggcttgcgtt gggggaatta ggcataacac gagaggatgt gaattgggct 720 gggccgaatg gggatttcaa gacaagtaat gcagcgaccc aattgaactc ttacccggtt 780 tgcccggacc cggaccgggc catgggactt ggggctcata ccgacaccag cctcttaacc 840 attgtatacc aaaacaacac gagagggtta caagttttga gagaagggaa ccggtgggtg 900 acggtggagc cggtacccgg tgcactggtg gttcaagttg gagacttgct acatattctt 960 acaaacgggt tgtacccgag tcccgttcat caagccgttg t 1001 <210> 10 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 10 cattaaaaca attagaaaaa atgctatttg tgaaagatag aaacttaagt gtcatttcta 60 acaatttcct acaaaaatat ctagatctaa attttacgga aatgtggatg aaacattgat 120 gtcatggata tttttaaagg aaattagaaa acaaaatcca aataaactgt ttaattgaat 180 agatataaat attttaggta atacaaaatt tgcgtattat tcttgtatca caagatttga 240 gtattcaggt atcacactaa gaattcacat ttaattttat gagaaaaaaa gaattaagga 300 ctattgtcga tgttggctgt caataggtaa gctatttcct agtgccatat gttttgcgtt 360 gggagttgtc caaattcccg acaccatgtt attagcccat cgggagatgc tctcttccga 420 caatcaccca aggatatttt ttacatcaac aaaagaattt gcaacatgtt ttgaggtaac 480 accatcgatg gttctagaca tgggagattg tatttttctt gttgttaaac acaatttaac 540 tattatttat aatacatttc cattagtgac attttgttaa ttatttttta tgttttatag 600 attattttta tgatatcata gaaatgattc acccctcaat taaacgtcga atccatggaa 660 attatggaat tatgaatgaa gatctcgacg gaaatttaat atcataagct taggtcgata 720 tattgttaag ttcgtaattg tttttattta catccactat taagtttttt attttttatt 780 ttttattttt ttgaaaatca agtatataaa atataagatt gacatatatt ctcatgtatg 840 aatttctctt tttgtgttat ttactacttc cctataattt cttttcaatt taatataaat 900 tttgagaaat taaggtttat ttgatagttg tttgattttt tttttttagt atttaaatat 960 aaggtgtttc ttttattaaa aaaatgagga aattatagta c 1001 <210> 11 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 11 tggggtgttt ctgatctgaa actctttctc attgctctct aagacttgcg gtttagtggt 60 ctgaggcttg ttcagtgctg cataagaaat gcaaagaata agcaattgtt ctttaaagtt 120 ctgaattggg cagaaaacgc aagttactta cggttaagat aagtgagggc taagacatag 180 ccaaagttaa atagaagaat gaatccaacc attgcaccca ctccaatcca ataccaataa 240 tcagatggga agaagccatg aaccttcaag accaaaactc ctagagtttc ccctgtaaaa 300 gggataacct tgacaagaaa gtaacaattc tgagataaac atttgaagac tcagacaaaa 360 tgcgtacatt tttaaggttg ttcaagttct agaaactact tgatcccaac tatttcctcc 420 aaattcgtta actgccaatg aattctgccc gtacatcata ggtgacaccc agtaagccca 480 tttccaccac tttttcatgt tatctgtgga tttcaaaaag gaattgttac gcatgttttt 540 actgaagaat gtcaaccaaa agcaaacaaa tggccatcag ttatcacata cgtcttgaga 600 gaatataacc atcatttcca tagagtatca acagaacaaa tgaaccaaat gtgcttgaaa 660 ctactaagct tctagaaacg gcagcaatta atcggaataa tgcagaagcc aattggctag 720 caagaactag tgcaaggtac tgcttaaaaa acctgcaaac agttacaatg catcagcaac 780 aactgtgact caaacatgat ctctgatgga acttagtgca gtcaggaggt gtagaaaatt 840 tcaacctttt gacacttgga tcgtagccag taacataata agagataaaa acccaaaggg 900 caacttccac aaaggaggca gggattttta ggatggtagc tggaagagca tatgcccatg 960 ctgggaagaa aaggaggtcc ctttgcttgt agaaaacagg a 1001 <210> 12 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 12 ccattaacaa taacccacta acactaacag acttcttagt ttgatgggca ggatcaatgt 60 cagtaaccca aaaggaaact aatttcaaag ggatctcaac atttgtggag tcctttccat 120 gatacacatg gtaccttttt tctgaaaaca catgagttac atttttaaaa ggcattaaag 180 gatactttcc cccatcttgc caccaatctc cattctcaaa ttgtagctgt tccttcattt 240 tgataaacct aacagtatca gagcttaatt cagctgcaga agatagaaca aatttgcaat 300 gtttctccac ctcatcatat ctttcataac tgaaagttgg ggtttcatta ggaactacat 360 ctatgctgtc ttcaacaaac ccaatgtcta cggattctga ttgagcaaat gaaaacctca 420 attctccaaa cagttgcagc ccccaaacaa agaaaaacag aaagacaaga cttttcatgg 480 ctttatatac taattccagt gttcatcagt cacagaaatg aaaacccaga tggcccttca 540 aaagaatctc acctataagc tcgcaaatgc tgcaactttc gttgaaacag gaccatgaga 600 accaacaaaa ttgagttttt aaggactact aacctcaatg tctgttgtga tcgatcccct 660 gtctctgttc tatcgtggaa ctcttaatct tcagcactaa aaaaggggga aaacggtgga 720 ggagcaatcg atcaactctg tgaaagacag agagagatgg gcttgactaa agtttggatc 780 ttggagctga agtttactcc aaactttcta gtcgttctaa gtcttgacag gtggttgcga 840 actattatgt ttttcatttt ttttccccac tccttctcat agcgcgtgaa gaccatactg 900 acaaagtgag actcgattag gggatgtttg accaactcca caagtttatg gttcagacta 960 cttaaaagaa attaatttga tgatttatta acttacttta a 1001 <210> 13 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 13 gaaaaaaaaa agtttaagat gaacaaagga aaaagaaaac tatcaaatac acatccctca 60 gctctaaata gccagtaaaa gcttgatata aaactaccta actgatttca aactatttat 120 cagattgtaa ctaattacaa gcttatctgt tacacttaat acgtgtattt tgattggcta 180 taaaaacttt gaagtcttgt atttgaaaag attgagatca ttgttatcag ttactttttt 240 attaaaaaaa aacagcacaa ggacaagaaa aatagaaagc catccttgag tgtgaagttg 300 attggtgatg ttgagtttgc ttgaatatag aagaaatata tggatgcagc tgaactgttt 360 tgaatctttg atttggtata ttttcaaaat tttcatgctg gatcttctcg gtcttttgtt 420 tgtgatactg cctcatataa ttttcggaag aatatttctc tgagtcattc acttgtgttg 480 acagtgaagg cctattgcac gaagcccttg tcttctgaga cttaaagatg gtgaagagga 540 gcaaaagtaa gtgggttcta tttataatat tggaagccaa aagtctcgct ctctctctgc 600 agcatgtaga cacacttggt tttcttctaa atgttttgtt tcttgtagag agtaaaagca 660 agagggttag tttaaagaaa aagtacaaga tcattagaaa ggtgaaggag catcacaaga 720 agaaggcgaa ggaagccaag aagctaagct tcaaggggaa gagcaaagtt gagaaggacc 780 cgggtattcc caatgattgg cccttcaagg aacaggagct caaggcactt gaagctcgcc 840 gtgcccgtgc tcttgatgag atggaacaaa agaaagcagc tcggaaggag agggtattat 900 aattttagac tttttgtcat ggacattttt agatttttaa tgtatgtata tacttatgag 960 cctgtgaatg gtgtatgtat tttggtatgc catgtatatt a 1001 <210> 14 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 14 ttcaagaact aaattgttgc tttcatgaaa gtttagggac caaaagtatt ttttaaccaa 60 gatctacaac agactatcta gaattcttct taaccttcca aataagtagg cttagtttca 120 gagaagaatc aagaccaaaa tcttgggaag tcgaagttgt ttgtctttgt gaataatagc 180 aggagtagct caaatggttt tctgaagcta gtcactagag gcgagtatga atgatacgac 240 tatatagatc ttgcgaatgt ggaaattcta actgattgga ttattctaat agattatatc 300 ttggcccgaa gctccctttt ttatcccccc caaaataagc ataaaacttg aacgataatt 360 aaatcttgga gctcatagct attgtccact tcctgtatta taatttaaaa cttaaaacga 420 tgaattcttt ttagctatga aaatcacaag gtgtcaagca aaagcaacaa ttgacatgat 480 gaaaatataa agctgtgacg cctcacagtc tcaggtaggt tgtagataag cacagaactc 540 agaacagttg ccaaagcaaa gatcctgcac acgcatcaaa acggaaggtg gttaaaggga 600 ataaacaaca agtattacca cctaaaactg actcacaaat tcagattacc gatcatcata 660 tacatttgac tttccaacac tttcaaaacc ctctgtatca aggtaaaaaa cagaagtttt 720 gactccatca atcatcaact ccaaaggagt accccatacc cagatccctg tgcaaaagaa 780 attgacaaac tgcataaata cccaacgagt aaatataaca cattcacaac caccacatca 840 ttgcaactgc atttaccttt tgttttggtg tcacgcaggt gtcctacacc aaaccctgaa 900 acacaaaata tttgatttat acaataaatg atatatatac aggatcatta atttttaaac 960 aagagaaatg gtacaaattc ataggagtta acgcaccttc a 1001 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-434-F Primer <400> 15 catggctttg aaaggtgctt 20 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Cla-434-R Primer <400> 16 tgtctaccat atgctgaaac ttttg 25 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cla-186-F Primer <400> 17 gcggaacttt ttaacgacac a 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cla-186-R Primer <400> 18 tgggaagagg tggaggttat t 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cla-359-F Primer <400> 19 ctttcagaaa ctctggcctc a 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-359-R Primer <400> 20 aagaagccaa tgtgccttta 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-167-F Primer <400> 21 gctctcttcc gacaatcacc 20 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Cla-167-R Primer <400> 22 ttaacaacaa gaaaaataca atctcc 26 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-997-F Primer <400> 23 cccatttcca ccactttttc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-997-R Primer <400> 24 gccatttgtt tgcttttggt 20 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Cla-481-F Primer <400> 25 cagcccccaa acaaagaa 18 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-481-R Primer <400> 26 gccatctggg ttttcatttc 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-222-F Primer <400> 27 tgacagtgaa ggcctattgc 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-222-R Primer <400> 28 cgagactttt ggcttccaat 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-850-F Primer <400> 29 caaggtgtca agcaaaagca 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-850-R Primer <400> 30 ttgctttggc aactgttctg 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-405-1-F Primer <400> 31 ctgctcgacc aaacaatcac 20 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cla-405-1-R Primer <400> 32 tcggtactcc atagcctcc a 21 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-405-2-F Primer <400> 33 tcaatggatc gatgttcagc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-405-2-R Primer <400> 34 ccggtgccta caagacctta 20 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cla-406-1-F Primer <400> 35 tggattgata ttcacccctc a 21 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cla-406-1-R Primer <400> 36 cactcggtgc ctacaagacc 20 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cla-406-2-F Primer <400> 37 tggagtatcg aagggtgtga g 21 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cla-406-2-R Primer <400> 38 tccgtttcat ctttctcagg a 21 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA-F Primer <400> 39 ggcggatgtt gctttaagga 20 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA-R Primer <400> 40 gtggtgccct tccgtcaat 19 <210> 41 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Cla405san-F Primer <400> 41 attggatcca agccatgata gccatcaaat 30 <210> 42 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Cla405san-R Primer <400> 42 attgaattct gttgattcaa aggccacaa 29

Claims (9)

A polynucleotide sequence consisting of 8 to 100 consecutive bases including a single nucleotide polymorphism (SNP) located at the 501st base in the nucleotide sequence of SEQ ID NO: 1 or a polynucleotide sequence complementary thereto; And
One or more polynucleotide sequences selected from the group consisting of a polynucleotide sequence consisting of 8 to 100 consecutive bases including an SNP located at the 501st base in the nucleotide sequence of SEQ ID NO: 2 or a complementary polynucleotide sequence thereof, or SNP marker composition for discriminating a watermelon dwarf (dwarf) individual comprising its complementary polynucleotide sequence.
The SNP marker composition according to claim 1, wherein the SNP marker composition is applied to a marker-assisted backcross (MABC) using a genetic marker of watermelon.
Identifying a watermelon dwarf individual that specifically binds to a polynucleotide containing 8 to 100 consecutive nucleotide sequences including the 501st base of SEQ ID NO: 1, or the 501st base of SEQ ID NO: 2 or a complementary nucleotide sequence thereof Primer set to do.
The method of claim 3,
The primer set, a primer set consisting of SEQ ID NOs: 3 and 4; And
A primer set for discriminating a watermelon dwarf individual comprising at least one primer set selected from the group consisting of a primer set consisting of SEQ ID NOs: 5 and 6.
[5] The primer set according to claim 3 or 4, wherein the primer set is a primer set for high-resolution melting (HRM) analysis.
A kit for discriminating a watermelon dwarf individual comprising the primer set of claim 3 or 4.
A method of determining a watermelon dwarf entity comprising the following steps:
(a) separating genomic DNA from watermelon to be identified;
(b) detecting the 501st base type of SEQ ID NO: 1 or the 501st base type of SEQ ID NO: 2 in the isolated genomic DNA; And
(c) discriminating a watermelon dwarf individual from the detected base type.
The method of claim 7,
The step (b) is characterized in that PCR (polymerase chain reaction) is performed using the primer set of claim 3, wherein the method of determining a watermelon dwarf individual.
The method of claim 7,
The step (c) is characterized in that it is performed by one or more methods selected from the group consisting of high-resolution fusion, capillary electrophoresis, DNA chip, gel-electrophoresis, sequencing, radiation measurement, fluorescence measurement, and phosphorescence measurement, How to identify a watermelon dwarf entity.

Images