KR102264299B1 - Novel genetic markers for selection of watermelon with lobed leaf trait and use thereof - Google Patents

Abstract

The present invention relates to selecting individuals having a lobed leaf trait from a watermelon, and more particularly, a single nucleotide polymorphism (SNP) marker composition, primer set and kit for discriminating a watermelon individual having a leaf lobed trait. and a method for discriminating watermelon individuals with leaf-cut traits using the same. By providing the leaf erosion gene marker according to the present invention, it is possible to quickly and conveniently check the presence or absence of foliar erosion by extracting DNA from young plants or seeds when developing a variety having foliar erosion trait, thereby efficiently discriminating and nurturing watermelon cultivars exhibiting foliar erosion. As this becomes possible, it is predicted that it will be very useful in reducing the time, cost, and effort required for breeding, and the watermelon having the leaf cutout trait selected in this way exhibits high resistance to high temperature and thus productivity is expected to be greatly improved. .

Description

Novel genetic markers for selection of watermelon with lobed leaf trait and use thereof}

The present invention relates to the selection of individuals having a lobed leaf trait from a watermelon, and more particularly, a single nucleotide polymorphism (SNP) marker composition, primer set and kit for discriminating a watermelon individual having a leaf lobed trait. and a method for discriminating watermelon individuals with leaf-cut traits using the same.

Watermelon is produced worldwide in Asia (82.4%), Europe (5.8%), Oceania (0.1%), Africa (5.3%), and America (6.3%). Among Asia, China (about 50 million tons) It produces the most watermelons in the country. In Korea, watermelon is a fruit and vegetable consumed not only in summer but throughout the year. However, there is a need for varieties that can withstand high temperatures well as the temperature of the cultivation area rises due to the abnormal climate phenomenon and increase in facility cultivation and house cultivation due to global warming and excessively humid climatic conditions are created.

On the other hand, with the recent development of next-generation sequencing methods, the cost of sequencing has been reduced, and sequencing of plants is also progressing rapidly. In the case of gourd plants, cucumber (2009), melon (2012), watermelon (2013) ) of the full-length nucleotide sequence was published. In the case of watermelon, a genome sequence-based high-density genetic map has recently been created through genome sequencing, and based on this, a large amount of SNP (single nucleotide polymorphism) information has resulted in a variety of plant lineages and varieties. In addition to classification, utilization as a molecular marker is increasing. In the past traditional breeding, the genomic region of the desired trait was transduced through cross breeding, but there was a problem that it took a lot of labor and a long time to observe the phenotype in order to confirm this. In order to solve this problem, molecular markers related to desired traits are being developed, and further research and development are being conducted to reduce labor, increase breeding efficiency and shorten breeding period by selecting individuals at the seedling stage with the developed markers.

Sufficient moisture and smooth gas exchange are essential for plants to survive at high temperatures. The leaf of a plant is an organ responsible for photosynthesis, and depending on its shape and size, its water use and gas exchange ability vary, and it is known that various environmental factors influence the shape of the leaf. Accordingly, the leaf shape of a watermelon is treated as an important external factor in the survival of an individual. Through previous studies, it is known that the leaf engraving trait of watermelon is a dominant trait, and the trait of no engraving is inherited according to Mendel's laws. However, there are few studies on the genetic factors that determine the leaf shape of watermelon, including leaf cuts.

US 10-1923647 B1

The present invention has been devised to solve the above problems, and an object of the present invention is to provide a SNP marker composition for discriminating a watermelon individual having a lobed leaf trait.

Another object of the present invention is to provide a primer set for discriminating a watermelon individual having a leaf-cut trait.

Another object of the present invention is to provide a kit for discriminating a watermelon individual having a leaf-cut trait.

Another object of the present invention is to provide a method for discriminating a watermelon individual having a leaf-cut trait.

However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned can be clearly understood by those of ordinary skill in the art to which the present invention belongs from the following description. will be.

In order to achieve the object of the present invention as described above, the present invention is a polynucleotide consisting of 8 to 100 consecutive bases including SNP (single nucleotide polymorphism) located at the 501st base in the nucleotide sequence of SEQ ID NO: 1 sequence or its complementary polynucleotide sequence; A polynucleotide sequence consisting of 8 to 100 consecutive bases including a single nucleotide polymorphism (SNP) located at the 501st base in the nucleotide sequence of SEQ ID NO: 2 or a complementary polynucleotide sequence thereof; And at least one polynucleotide sequence selected from the group consisting of a polynucleotide sequence consisting of 8 to 100 consecutive bases including the SNP located at the 501st base in the base sequence of SEQ ID NO: 3, or a polynucleotide sequence complementary thereto Or, it provides a SNP marker composition for discriminating a watermelon individual having a lobed leaf trait, comprising a polynucleotide sequence complementary thereto.

In one embodiment of the present invention, the composition can be applied to watermelon genetic marker backcross (Marker-assisted backcross, MABC), but is not limited thereto.

In addition, the present invention provides a polynucleotide having 8 to 100 consecutive nucleotide sequences including the 501st nucleotide of SEQ ID NO: 1, the 501st nucleotide of SEQ ID NO: 2, or the 501st nucleotide of SEQ ID NO: 3 or a complementary nucleotide sequence thereof Provided is a primer set for discriminating watermelon individuals having a leaf-cut trait, which binds specifically to .

In one embodiment of the present invention, the primer set comprises: a primer set consisting of SEQ ID NOs: 4 and 5; a primer set consisting of SEQ ID NOs: 6 and 7; and one or more primer sets selected from the group consisting of primer sets consisting of SEQ ID NOs: 8 and 9, but is not limited thereto.

In another embodiment of the present invention, the primer set according to the present invention may be a primer set for high-resolution melting (HRM) analysis, but is not limited thereto.

In addition, the present invention provides a kit for identifying a watermelon individual having a leaf slit trait, comprising the primer set according to the present invention.

In addition, the present invention comprises the steps of (a) isolating the genomic DNA from the watermelon to be discriminated; (b) detecting the type of the 501st base of SEQ ID NO: 1, the 501st base of SEQ ID NO: 2, or the 501st base type of SEQ ID NO: 3 in the isolated genomic DNA; and (c) discriminating a watermelon individual having a leaf cut trait from the detected base type.

In one embodiment of the present invention, step (b) may be to perform PCR (polymerase chain reaction) using the primer set according to the present invention, but is not limited thereto.

In another embodiment of the present invention, the step (c) is at least one selected from the group consisting of high-resolution melting, capillary electrophoresis, DNA chip, gel-electrophoresis, sequencing, radiometric measurement, fluorescence measurement, and phosphorescence measurement. method, but is not limited thereto.

By providing the genetic marker for the selection of watermelon leaf severing traits according to the present invention, by extracting the DNA of young plants or seeds when developing cultivar of the leaf cutting line and immediately checking the presence or absence of leaf cutting, watermelon varieties exhibiting the leaf cutting trait can be efficiently selected Since it can be identified and nurtured, the time, cost, and effort required for breeding can be reduced. In addition, it is possible to save time and effort to increase the purity of F1 in the seeding process for seed production. Furthermore, since the leaf-shaped watermelon selected according to the present invention exhibits high resistance to high temperature, it is expected to contribute to an increase in the yield of watermelon.

1a and 1b show the phenotypes of the parental PS137 and the parental SIT463ST used in the present invention. FIG. 1a shows the shape of fruit and flowers, and FIG. 1b shows the shape of the ninth main leaf. (yellow arrow: depression)
FIG. 2 is a diagram showing the 9th to 10th true lobes in a representative individual serving as a standard for phenotypic scores of 0, 1, and 2 points in _{the F 2} isolated generation cultivated from the SIT463ST × PS137 isolated generation.
Figures 3a and 3b are the results of DNA electrophoresis of each individual, Figure 3a is a DNA pool (LL) of the indentation trait, Figure 3b is a band obtained by electrophoresis of the DNA used in the DNA pool (non-LL) of the indentation trait. is a diagram showing
4 is a diagram illustrating a sequencing workflow using a next-generation sequencing platform.
5 is a diagram showing ΔSNP-index values for each chromosome. (red line, confidence level 95%; blue line, confidence level 99%)
6 is a diagram illustrating QTL distribution according to the significance of G' values for each chromosome. (red arrow, highest peak)
7A to 7G are diagrams showing candidate loci selected in a region between 21.2 Mbp and 21.5 Mbp of watermelon chromosome 4 according to an embodiment of the present invention (the location of the SNP is indicated by red letters and yellow background): (FIG. 7a) the nucleotide sequence of SEQ ID NO: 10 and the position of the SNP in the nucleotide sequence (regions 21,239,403); (FIG. 7b) the nucleotide sequence of SEQ ID NO: 1 and the position of the SNP in the nucleotide sequence (regions 21,262,238); (Fig. 7c) the nucleotide sequence of SEQ ID NO: 2 and the position of the SNP in the nucleotide sequence (21,285,956 region), (Fig. 7d) the nucleotide sequence of SEQ ID NO: 3 and the position of the SNP in the nucleotide sequence (21,287,252 region); (FIG. 7e) the nucleotide sequence of SEQ ID NO: 11 and the position of the SNP in the nucleotide sequence (21,306,879 regions); (FIG. 7f) the nucleotide sequence of SEQ ID NO: 12 and the position of the SNP in the nucleotide sequence (regions 21,324,868); (FIG. 7G) The nucleotide sequence of SEQ ID NO: 13 and the position of the SNP in the nucleotide sequence (21,439,325 regions).
8 is a view showing a melting curve obtained as a result of performing HRM analysis using a primer capable of amplifying a 21.28Mbp region (21,285,956bp) SNP of chromosome 4;

As a result of intensive research to develop genetic markers related to watermelon leaf cutout trait that can increase the yield of watermelon by selecting varieties that can tolerate high temperatures well, the present inventors found that the 21,262,238th base, 21,285,956th base and the 21,285,956th base on chromosome 4 of the watermelon and It was confirmed that the 21,287,252 bases are related to the leaf cutout trait of watermelon. Accordingly, we developed a primer set that can confirm the SNP (single nucleotide polymorphism) of the corresponding base, and as _{a result of testing in the F 2} segregation group, experimentally confirming that the leaf dentation of the watermelon can be accurately determined in all individuals. completed.

In one embodiment of the present invention, in order to quantify the leaf engraving trait of watermelon, the leaf engraving phenotype of each individual is scored by scoring 0 to 2 points, and F ₂ engraving in the individual phenotype test of the separated generation: no engraving by observing that the separation ratio of 3 : 1 was observed, it was confirmed that the lobed angular trait was single-dominantly inherited according to Mendel's law of inheritance (see Example 1).

In another embodiment of the present invention, DNA is extracted from the leaves of watermelon and a gene pool is created for each phenotype score, and then the gene locus associated with the leaf-deletion trait is determined using next-generation sequencing and bulked segregant analysis (BSA) techniques. Candidates were selected, and a region between 21.2 Mbp and 21.5 Mbp of watermelon chromosome 4 was selected as a candidate locus through ΔSNP-index analysis (see Examples 2 and 3).

In another embodiment of the present invention, LL-4-238, LL-4-956 and LL corresponding to region 21,262,238, region 21,285,956 and region 21,287,252 of chromosome 4 of watermelon through high-resolution melt analysis It was confirmed that the -4-252 HRM primer was 100% identical to the phenotype and genotype in all 188 individuals of the _{F 2 isolate (see Example 4).}

Therefore, the SNP marker involved in the watermelon leaf cut trait identified in the above example and the primer for detecting the same can be used to discriminate the watermelon individual having the leaf cut trait.

That is, a polynucleotide sequence consisting of 8 to 100 consecutive bases including a single nucleotide polymorphism (SNP) located at the 501st base in the base sequence of SEQ ID NO: 1 according to the present invention, or a complementary polynucleotide sequence thereof; A polynucleotide sequence consisting of 8 to 100 consecutive bases including a single nucleotide polymorphism (SNP) located at the 501st base in the nucleotide sequence of SEQ ID NO: 2 or a complementary polynucleotide sequence thereof; And at least one polynucleotide sequence selected from the group consisting of a polynucleotide sequence consisting of 8 to 100 consecutive bases including the SNP located at the 501st base in the base sequence of SEQ ID NO: 3, or a polynucleotide sequence complementary thereto Alternatively, by using a novel SNP marker composition comprising a polynucleotide sequence complementary thereto, watermelon individuals having the leaf cut trait can be identified faster and more accurately than conventional methods.

In the SNP marker according to the present invention, the nucleotide located at the 501st nucleotide in the nucleotide sequence of SEQ ID NO: 1 is (G→A), or the 501st nucleotide in the nucleotide sequence of SEQ ID NO: 2 is (T→C), Alternatively, if the 501st base in the nucleotide sequence of SEQ ID NO: 3 is (C→T), it can be determined that the leaf has a leaf cut trait, and a primer set capable of amplifying the SNP marker is used as a genetic marker to develop a variety The presence or absence of leaf slit traits can be immediately confirmed by extracting the DNA of young plants or seeds.

The nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 according to the present invention may be a nucleotide sequence present on chromosome 4 of watermelon, and may preferably be a region of 21.26Mbp to 21.28Mbp, but is not limited thereto. .

As used herein, the term “watermelon ( Citrullus lanatus , watermelon)” refers to a watermelon cultivated in the Korean Peninsula or bred for the purpose of breeding, but is not limited thereto.

As used herein, the term “polymorphism” refers to a case in which two or more alleles exist at a single locus, and the term “polymorphic site” refers to a locus in which the allele exists. . Among polymorphic sites, a single nucleotide that differs from one individual to another is called 'single nucleotide polymorphism', that is, SNP (single nucleotide polymorphism).

As used herein, the term “marker” refers to a single base polymorphic allele base pair on a DNA sequence used to identify an individual or species. Since SNPs are relatively high in frequency and stable and distributed throughout the genome, thereby generating genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity between individuals. SNP markers usually include phenotypic changes that accompany single nucleotide polymorphisms, but in some cases this may not. In the case of the SNP marker of the present invention, it may indicate a difference in the phenotype of an individual, such as a mutation in an amino acid sequence or a lobed leaf.

As used herein, the term “marker” refers to a nucleotide sequence used as a reference point when identifying a genetically unspecifically related locus. The term also applies to nucleic acid sequences complementary to marker sequences, such as nucleic acids used as primer sets capable of amplifying the marker sequence. The location on the genetic map of a genetic marker is called a genetic locus.

As used herein, the term “gene marker” may be used interchangeably with terms such as a DNA marker, a biomarker, and a molecular marker. The marker can be usefully used because it can quickly distinguish traits without being affected by the cultivation environment or growth period of crops. Genetic markers are a method of indicating polymorphism between individuals by targeting differences in the nucleotide sequence of DNA, which is the essence of genetic phenomena. A marker or RFLP using a microsatellite mainly consisting of a repeating simple nucleotide sequence or a gene nucleotide sequence (Restriction Fragment Length Polymorphism) probes or SCAR (Sequence Characterized Amplified Region) markers are being used.

In the present invention, the SNP marker composition can be applied to Marker-assisted backcross (MABC) using genetic markers of watermelon.

As used herein, the term “Marker-assisted backcross (MABC)” refers to the use of genetic markers to identify the overall chromosomal composition of the backcross offspring at the seedling stage, so that the backcross offspring possesses superior traits of the recovered parent. It refers to a breeding technique that can shorten the time it takes to recover to the genome composition. In the case of conventional backcross breeding, it takes more than 6 to 7 generations, but backcross selection (MABC) breeding using genetic markers can select individuals from the second generation of backcrossing if it is early. By reducing costs, the size and efficiency of breeding can be increased. SNPs are mainly used to produce markers for MABC, which is one of the structural mutations that occur more frequently in the genome than mutations such as simple sequence repeat or insertion/deletion (indel). This is because the entire process can be automated. However, since excessively many SNPs consume a lot of time and money in experiments, it is important to select SNPs with high accuracy and utility.

In another aspect of the present invention, the present invention provides a sequence of 8 to 100 consecutive bases comprising the 501st base of SEQ ID NO: 1, the 501st base of SEQ ID NO: 2, or the 501st base of SEQ ID NO: 3 or a complementary base thereof Provided is a primer set for discriminating a watermelon individual having a leaf-cut trait, which specifically binds to a polynucleotide having a sequence.

In the present invention, the primer set is a primer set consisting of SEQ ID NOs: 4 and 5; a primer set consisting of SEQ ID NOs: 6 and 7; And it may be at least one selected from the group consisting of a primer set consisting of SEQ ID NOs: 8 and 9, but is not limited thereto as long as it is a primer for detecting the SNP marker disclosed herein.

As used herein, the term “nucleotide” or “polynucleotide” refers to deoxyribonucleotides or ribonucleotides that exist in single-stranded or double-stranded form, and unless otherwise specified, includes analogs of natural (poly)nucleotides. .

As used herein, the term “primer” refers to a single-stranded oligonucleotide, under suitable conditions (the presence of four different nucleoside triphosphates and a polymerase such as DNA or RNA polymerase), at a suitable temperature, and in a suitable buffer. It is meant to serve as an initiation point that can initiate template-directed DNA synthesis. The suitable length of the primer is determined by the characteristics of the primer to be used, but is usually used in a length of 15 bp to 30 bp. The primer need not be exactly complementary to the sequence of the template, but must be complementary enough to form a hybrid-complex with the template.

In the present invention, the primer set may be a primer set for high-resolution melting (HRM) analysis, but is not limited thereto as long as it is for amplifying a gene including a SNP according to the present invention.

As used herein, the term “high-resolution melting (HRM)” refers to an amplification product DNA bound to a fluorescent reagent from about 60° C. to 95° C., depending on the SNP on the DNA present in the region amplified by PCR. It refers to a method of measuring the change in fluorescence intensity when denatured into single-stranded DNA by changing the temperature.

As another aspect of the present invention, the present invention provides a kit for discriminating a watermelon individual having a leaf cut trait, comprising the primer set according to the present invention.

In the present invention, the kit can be applied to watermelon genetic marker backcross (Marker-assisted backcross, MABC), but is not limited thereto.

In addition, the kit may include conventional components included in the PCR kit in addition to the primer set according to the present invention. Typical components included in the kit may be reaction buffers, polymerases, dNTPs (dATP, dCTP, dGTP and dTTP), and cofactors such as ^{Mg 2+ .} Various DNA polymerases can be used in the amplification step of the present invention, including Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species. Most of the polymerases can be isolated from the bacteria themselves or can be purchased commercially.

As another aspect of the present invention, the present invention provides a watermelon individual having a leaf cut trait comprising the step of detecting the type of the 501st base of SEQ ID NO: 1, the 501st base of SEQ ID NO: 2, or the 501st base type of SEQ ID NO:3 provides a way to determine

In the present invention, the method comprises the steps of (a) isolating genomic DNA from the watermelon to be discriminated; (b) detecting the type of the 501st base of SEQ ID NO: 1, the 501st base of SEQ ID NO: 2, or the 501st base type of SEQ ID NO: 3 in the isolated genomic DNA; and (c) discriminating a watermelon individual having a leaf-cut trait from the detected base type.

In addition, in the present invention, the detecting step of step (b) may be to perform PCR (polymerase chain reaction) using the primer set according to the present invention, but is limited thereto if it is to achieve substantially the same purpose it is not

In addition, in the present invention, the step of determining the watermelon individual having the leaf cutout trait in step (c) includes high-resolution thawing, capillary electrophoresis, DNA chip, gel-electrophoresis, sequencing, radiation measurement, fluorescence measurement, and phosphorescence. It may be performed through an experimental technique such as measurement, but is not limited thereto as long as the SNP marker or primer set according to the present invention is used.

The terms or words used in the present specification and claims should not be construed as being limited to their ordinary or dictionary meanings, and the inventor may properly define the concept of the term in order to best describe his invention. It should be interpreted as meaning and concept consistent with the technical idea of the present invention based on the principle that there is.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1: Watermelon leaf cutting angle index setting and phenotype test

1.1. Watermelon leaf cutting index development

Since it is possible to determine the presence or absence of clear cuts from the 6th or more true leaf of watermelon, the present inventors further proceeded with the growth stage to determine the presence or absence of leaf cuts in the 9th or 10th true leaf. In 'SIT463ST' representing the lobed engraving phenotype used as the parent, 4 pairs of depressions were confirmed centered on the main vein, and in 'PS137', representing the incised phenotype used as the parent, deep depressions appearing in the 'SIT463ST' were not observed. (See FIGS. 1A and 1B). In order to quantify the leaf engraving characteristics of watermelon, it is divided into 0 points, 1 point, and 2 points, when there is no engraving (0 point), when there is engraving but it is less severe than when there is an intermediate trait (1 point), when there is severe engraving ( 2 points) (see FIG. 2). Detailed criteria are described in Table 1 below.

phenotype
score classification criteria 0 No indentations, with symmetrical protrusions. One There are 3 depressions on each side centering on the main vein, the depth of the depression is not deep. 2 There are 4 depressions on each side centering on the main vein, the depth of the depression is deep.

1.2. SIT463ST × PS137 :F ₂ Separation phenotype test

Based on the criteria according to Table 1 above _{, the degree of indentation in the F 2} separate generation of SIT463ST × PS137 was evaluated and classified as 0, 1, or 2 points. A total of 15 SIT463ST specimens, 12 PS137 specimens, F ₁ 13 specimens, and F ₂ 287 specimens were subjected to phenotypic testing. Scores of 1 and 2 were judged to have a defect trait, and a score of 0 was judged to be a non-cleavage trait. .

As is shown below, the results in Table 2, it was confirmed that the SIT463ST In all of the transformants of the two points, the PS137 all of the transformants of 10 points, F1 both showing a phenotype of a point intermediate transfection, F ₂ in the separate generation Mendel was established, and the separation ratio of indentation : incisal angle was 3 : 1, and this was verified through the chi-square test. Table 3 shows the phenotype test results for each individual of the F _{2 separate generation.}

Generation The phenotype of the 9th to 10th main lobe total population expected ratio degrees of freedom X ² value P-value with absenteeism no cuts SIT463ST 15 0 15 - - - - PS137 0 12 12 - - - - F _One 13 0 13 - - - - F ₂ 228 59 287 3:1 One 0.048339 0.826

Example 2: Watermelon leaf sampling and DNA extraction

_{SIT463ST, PS137, SIT463ST × PS137: 30 F 1} and F ₂ individuals evaluated as positive scores of 0 and 2 in the phenotypic test result of Example 1 were randomly selected and weighed 80-85 mg. Sampling was carried out.

More specifically, the GeneAll® Exgene™ Plant SV mini kit was used for DNA extraction. A sample of 80-85 mg of plant leaves was placed in a 2ml tube (Eppendorf, Germany), frozen using liquid nitrogen, and then ground using an automill (Automill; Tokken, Japan). After grinding the plant, 400 μl of DNA extraction buffer PL and 5 μl of Proteinase K included in the kit were added, and reacted at 65° C. in a constant temperature water bath for 15 minutes. After completion of the reaction, 140 μl of PD buffer contained in the kit was added, mixed, and left on ice for 5 minutes, followed by centrifugation at 13,000 rpm at 4°C. After filtering the supernatant through the EzSep™ filter (blue) built into the kit, 1.5 volume of the filtered supernatant was added with the buffer BD built into the kit and mixed. The mixed solution was used to obtain DNA using the GeneAll® SV column (green) built into the kit. After that, washing is performed for 1 minute using the built-in buffer CW, and 100 μl of the built-in buffer AE is added to dissolve and recover the DNA. The quality of the extracted DNA was confirmed using an electrophoresis and spectrophotometer (DS-11, 28 DeNovix, USA), and the quantification was ^{measured using a fluorescence photometer (Flourometer; Qubit ®} 2.0, Invitrogen, USA).

SIT463ST × PS137 showing a phenotype with severe defects (phenotype score: 2) by extracting high-purity DNA from the sample: F ₂ DNA pool of 30 individuals and no cleavage (phenotype score: 0) SIT463ST × PS137: The DNA pool of 30 F2 individuals was made equal in volume, and the incomplete DNA pool was named 'LL' and the incomplete DNA pool was named 'Non-LL'. The results of confirming the DNA of the individuals used in each DNA pool are shown in FIGS. 3a (LL) and 3b (non-LL).

Example 3: Confirmation of genetic mutations through BSA (Bulk Segregant Analysis) and sequence alignment of watermelon leaf cut trait

3.1. Derivation of sequence through NGS (Next-Generation Sequencing)

Base sequences were derived by performing NGS of the parent groups SIT463ST and PS137 and the LL and Non-LL DNA pools prepared in Example 2 above. After confirming that the DNA was NGS grade, paired-end sequencing was performed based on a read length of 101 bp using the NovaSeq-6000 system (Illumina, USA). A sequencing workflow using the system is shown in FIG. 4 , and detailed sequencing conditions are described in Table 4 below.

Read Type paired-end Read Length 101 library kit TruSeq DNA PCR-Free kit library protocol ruSeq DNA PCR-Free Sample Preparation Guide, Part # 15036187 Rev. D sequencer type Illumina platform

3.2. Confirmation of sequence variation through sequence alignment

The Bowtie2 program was used to align the sequences obtained through the sequencing of Example 3.1, and the BAM file of the sequence derived through the Genome Analysis Toolkit (GATK) and the reference sequence of watermelon 97103 was created and produced. After mapping the reads to the BAM file, a VCF (Variant Call Format) file was obtained. A ΔSNP-index was obtained from the VCF file obtained by performing BSA-NGS with LL and Non-LL, which are the DNA pools obtained in Example 2 above.

After calculating the ΔSNP-index value using the sliding window technique, the locus involved in the watermelon leaf cut trait was analyzed by giving the statistical options of the confidence interval and significance level in the R script, and then expressed as ggplot2 for visualization of the R program.

As a result of the plotting results shown in FIG. 5 , peaks were identified in chromosomes 2, 4 and 5, among which the deltaSNP value was the most significant peak in chromosome 4 based on the significance level of 99% (blue line). (peak) was confirmed. Candidate loci showing single nucleotide polymorphisms (SNPs) between SIT463ST and PS137 were discovered on the corresponding chromosome.

In addition, candidate loci were identified with G' values derived using regression analysis to show the correlation between SNPs and phenotypes in the genome. The QTL distribution according to the significance of the G' value for each chromosome is shown in FIG. 6, and the G' values of chromosomes 2, 4, and 5 that exceed the threshold are shown in Table 5 below.

By combining the GATK and VCF files obtained above, candidate regions for SNPs were selected, and SNPs with a distance of 1 kb or more were selected for each region using the Tablet 1.19 program, and primers for HRM (High Resolution Melting) analysis were applied. produced. The SNPs candidate regions include regions 21,239,403 (Fig. 7a), region 21,262,238 region (Fig. 7b), region 21,285,956 (Fig. 7c), region 21,287,252 region (Fig. 7d), region 21,306,879 region (Fig. 7e), region 21,324,868 region (Fig. 7f) on chromosome 4 ) and 21,439,325 regions (Fig. 7g) were selected.

Example 4: Development of gene markers associated with lobe notch traits through high-resolution melting (HRM) analysis

The present inventors selected seven candidate loci through Example 3, and conducted an experiment by producing a high-resolution melting (HRM) primer for the production of a linkage marker based on a single nucleotide sequence mutation associated with a leaf cut of watermelon.

HRM analysis was analyzed through LightCycler96® software 1.1 (Roche, Switzerland), and regions with a high concordance rate were searched for by comparing the phenotype of _{the F 2 isolated generation with the expected genotype.} As a reference for HRM analysis, SIT463ST and PS137 as the parent group and SIT463ST × PS137:F ₁ in the separated generation group were used. Experiments were performed using Roche's LightCycler®480 kit according to the manufacturer's instructions. First, a master mix was prepared for each DNA sample as described in Table 7 below in a clean bench, and 8 μl was dispensed in a 96-well plate.

Reagents for Mastermix volume LightCycler®480 ResoLight Mix (Roche) 5 μl LightCycler®480 ResoLight Dye (Roche) 0.5 μl 25mM MgCl₂ Solution (NEB) 1.2 μl Primer 5 pmol 1 μl Ultra Pure Water (iNtRON) 0.3 μl Total 8 μl

A DNA sample of 1ng/μl was put into each of 2 μl according to the order of the 96-well plate, and the plate was covered with a sealer, followed by a short spin at 5000 rmp. Then, HRM analysis was performed using a LightCycler96® instrument. PS137, SIT463S, and SIT463ST × PS137:F ₁ used as references showed their own curves, respectively, and grouping was confirmed, and then the SIT463ST × PS137:F ₂ group was analyzed.

As a result, as shown in FIG. 8 and Table 7, results showing 100% concordance with the phenotype in the region of 21.26Mbp to 21.28Mbp on chromosome 4 were obtained. In Figure 8, the blue curve is SIT463ST (P1) with indentation in group 1 (phenotype score: 2), the red curve is PS137 (P2) without indentation in group 2 (phenotype score: 0), and the orange curve is group 3 (Phenotype score: 1) represents SIT463ST × PS137 :F ₁ . In addition, based on the phenotypic data in Table 7 below, it was confirmed that group 1 is a dominant homotype LL, group 2 is a recessive homotype ll, and group 3 is a heterotype Ll. _{F 2} subjects showing discrepancies with the phenotype are indicated in bold red.

* Group1=LL (phenotype score: 2), Group2=ll (phenotype score: 0), Group3=Ll (phenotype score: 1)

The respective primer sequences and SNPs regions used in the HRM analysis are shown in Table 8 below.

primer area SNP sequence (5'->3') Length LL-4-403-F
(SEQ ID NO: 14) 21,239,403
(SEQ ID NO: 10) C→T TCGGCCAAGTAGCTCAATTC 20 LL-4-403-R
(SEQ ID NO: 15) GCGGGTGAATTTGGACTAGA 20 LL-4-238-F
(SEQ ID NO: 4) 21,262,238
(SEQ ID NO: 1) G→A TCAAAATTTGCATGTTTTGGATT 22 LL-4-238-R
(SEQ ID NO: 5) AAGTAGACATGTATTTGGTGGACAA 25 LL-4-956-F
(SEQ ID NO: 6) 21,285,956
(SEQ ID NO: 2) T→C GGCCAAGTTCAACAAAAGGA 20 LL-4-956-R
(SEQ ID NO: 7) CGGTTTCCATGACGTTTAAT 20 LL-4-252-F
(SEQ ID NO: 8) 21,287,252
(SEQ ID NO: 3) C→T GAAATCCACCGAGTCCCATA 20 LL-4-252-R
(SEQ ID NO: 9) TCCAAAAACAAAGCTCCTGAA 21 LL-4-879-F
(SEQ ID NO: 16) 21,306,879
(SEQ ID NO: 11) G→A CCACTGCCACCATCTTTTCT 20 LL-4-879-R
(SEQ ID NO: 17) TTTGTTGTCTCAAAAACATTCAAAA 25 LL-4-868-F
(SEQ ID NO: 18) 21,324,868
(SEQ ID NO: 12) G→A TTGACATTTTTCCTTGGTTAAGTT 24 LL-4-868-R
(SEQ ID NO: 19) TTGAATTGCTCGACGTTTCT 20 LL-4-325-F
(SEQ ID NO: 20) 21,439,325
(SEQ ID NO: 13) A→G TCCTAACCAACCCAAATGTTTA 22 LL-4-325-R
(SEQ ID NO: 21) GGAGCAATTTTTAAACTCAATCCA 24

Using the seven sets of primers (LL-4-403, LL-4-238, LL-4-956, LL-4-252, LL-4-879, LL-4-868 and LL-4-325) As a result of HRM analysis, LL-4-238, LL-4-956 and LL-4-252 HRM primers corresponding to regions 21,262,238, 21,285,956, and 21,287,252 on chromosome 4 were 100% identical to the phenotype of all 188 _{F 2 isolates.} showed the results (Table 7). Therefore, it is considered that the use of the SNP marker has technical significance in that it is possible to discriminate a watermelon individual having a leaf-cut trait with perfect accuracy. To exist in the three genes Cla018362, Cla018363 and Cla018364 between the gene region, which is a gene coding for a gene Cla018357 and Homeobox-leucine zipper-like protein coding for Serine / threonine protein kinase, known as conventional open incision transfected genes Cla018360 It is a completely different gene from pyruvate kinase, which encodes a pyruvate kinase, 3-deoxy-D-manno-octulosonic acid transferase (KDTA)-like protein, and phosphoprotein phosphatase, respectively.

Based on the above results, the present inventors used SNPs of the 21,262,238 region (SEQ ID NO: 1), 21,285,956 region (SEQ ID NO: 2) and 21,287,252 region (SEQ ID NO: 3) on chromosome 4 of watermelon to select the leaf-cutting trait of watermelon. It was finally selected as a new genetic marker for the purpose of completing the development of a new genetic marker to discriminate the watermelon leaf-cut trait.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Novel genetic markers for selection of watermelon with lobed leaf trait and use it <130> MP19-294 <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 1 catatatgtg ttttgtagca tattcagaaa ttggatttta atttaaacaa ttgtttaaaa 60 tgtatgttga tactatatag ttataaatca ttaaaactaa ttatagttac tcactaatat 120 ttagttgaca ataagttatt attaatttgt ttatgagtat gatttaggtt aaaaaaaaaa 180 gttttatata attattatta attaatatta tataatttat aatacattac ataatacata 240 tgacataggg ttattttcaa atataggaaa atggacacaa atatttacaa atatagcaaa 300 aatttactat agactactat ctaagtcaga ggcagataat ggtctattgt gatctatcgc 360 ggtccatcgc aaataactgt gatattttgt tattatttgt aaatattttc aacaattttc 420 atttaaaatt caaaatttgg atacaatgga aacataaaaa tgttattttc aaaatttgca 480 tgtttggatt acaaaattcg gaaacagttt tcagaaacaa aatttgaatt gtccaccaaa 540 tacatgtcta cttaagtcaa taaatctgaa aacatgaaat agaatctgat ttttttaccc 600 aaatgtctca aatgtaacct aaacatccgc cattaagatt tcaacacttt gctctacaca 660 aattccttgc tccacctttg accatccaat ggactcaaaa atatttttct tttctaaaat 720 ttggatgtaa gtgtttagaa acaacttttc tcacactcaa tttttaataa ttttttttca 780 attcaatatg aaattgttag tcagaaagca aaaatagtgt tgagagtggt aactttagaa 840 aagttagtca gaaagcaaaa atagtgttga aaacagaaag ataaatgacc aaattagaca 900 ttaattccaac catttctata ttgatattta atataatttt ttaatttgga tatttaataa 960 caaatcaatt ataagataat tatttaaaag aatcgtatgc t 1001 <210> 2 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 2 aaagagaaag tacgacaaca actaagatca ttcatggaaa tgattaggtg tagccttggt 60 tatatatatc tccctacaac caagaaagtt tcttgtatta ataaaaaatt ttctatacta 120 ctttcatttt ttgtcacaaa agaatttaag aattatgtag aattcaaaaa aataaataaa 180 caataaatta ttataacata aatgacaggt caaataatga acaatggtag catgtactaa 240 tgtactacta gatttttcaa ccctacaacc ccttcattta catggcaaga gaataataat 300 ttgacttctt aaaaaatgtc tactaggttg tttttaattg aactacaatt aagctagaaa 360 aagatagata tagtctaagt aacacctaaa tatttttttt taaattgaag tctcagacac 420 ataaccatgg tatcgtacaa atcccaattt ccatttaaac ttccaaggcc aagttcaaca 480 aaaggagagg gagttgttac ttaccctctt tatttgaggc aattgaatat acaattaaac 540 gtcatggaaa ccgtataatt tttctgaact aggtttgttt caactcaatt tctttaagtc 600 tacgttgatc caagatgtga ggtaaagtct aggtttcaaa atttaagtaa tagaaatttg 660 gatgaaacaa gtgacaaaat tcaaggatag tttagttgaa atcttacagg gttcaagaga 720 gctttgtaag gctcattgtc aattaacaat gtattggatg aagaaaattg tgttggaagc 780 cttaaaagcc caacatcagt tccttcccat actttcttca actccttaat aaaaatgggt 840 ttgtccttat tcttcaagtc aaagaaacag gtcctagtgc actctgtctg gtcctgtaaa 900 aatccatgca ttgtaaaagc ccaaaaaaat attcttgaaa tgccaccaat ttcacgaccc 960 aaaatatcat tattgataac ataaataccc atgcaaacac a 1001 <210> 3 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 3 tgttatttac taaatattta aattttcaaa aacaaaaaat aaaatatgat ccctcaaatt 60 gtaactgttt ggttaaattt ctaaaacaaa ttttttttaa aaaaattact tttttttttt 120 tttaattttt agttttaaca taatttttaa aagtattgat aaaaaactaa taacaaaaca 180 aataatttta gaaatgaaat aaatgtttat aggtttaatt ttcaaaattt aaaagctaaa 240 aaccacaggt gttgggttaa atggtgaact atttgggcca aaatcactac gaatgaggct 300 taagaaaatt gggaaggcat ttgcagacca tggaaactgc cataggaagc atcagggcgg 360 cgatgttttg ggatcttgga gctgccttta cggcgacaga ctctgtgaca cagaaatcca 420 ccgagtccca taatcagaag cttctttttt gggacaagat tcagcttttc cagtgacaat 480 cccaactcat ttccatcttc ctcttcttca ggagctttgt ttttggatga tggttctgcc 540 atttttagta atgacgtttg gtttgatgat ttgatgagat gaaatgggaa tggttcgctg 600 attatatata ttgattggaa ttttcgactt ttgaacttct ctatacaatt gcaatcaaat 660 cgttgggttt tcccgatgaa tccgtatttg gagttggtct gtttagcttc tctatgccga 720 tttcatcaat gtttttcatc aataccgagc aaataaattt taggtttaaa gtattatttt 780 tttgtctcgg tttcattttg gtgcttttac ttgcatttaa aaatagttct ggactgttta 840 attaaaataa aaaattgaga tagatggca aaaaaaaatt aaaaaatggg tgaaaaaata 900 gattatatta taaatattaa aaaatatgta taatttagat gtttatattt agtatccaaa 960 tatccttgtg tcttataatc acatatacac tatgtactta c 1001 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LL-4-238-F Primer <400> 4 tcaaaatttg catgtttgga tt 22 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> LL-4-238-R Primer <400> 5 aagtagacat gtatttggtg gacaa 25 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL-4-956-F Primer <400> 6 ggccaagttc aacaaaagga 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL-4-956-R Primer <400> 7 cggtttccat gacgtttaat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL-4-252-F Primer <400> 8 gaaatccacc gagtcccata 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LL-4-252-R Primer <400> 9 tccaaaaaca aagctcctga a 21 <210> 10 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 10 aatgttttac gagcatttat aaaatatttt gaagatttca atggatctct aatatcaaag 60 ttgttgatgc caaaatctag ataaggaaaa atgcacctaa ccttcacgtg acagcgataa 120 atttgtaatt tggggaagaa tgtgatctgc aagctgggaa aatttgcaca caagtgtgat 180 gcttgccaaa caggctctga tgctttactt agaaagtgca attgtgtaac aagtatagag 240 cttgattatt agaatggaat ttcttcttta gtcataatga tagatttata ataaaattct 300 gacctagggc gttcatcaaa tttggaggct cagcctcacc tcatccttga ttgtggttga 360 ggccgaagag gttggtttga acttttgact caaactatat cttcttccta agaccggaat 420 aggtcgaagc atgctccatt catcaaattg ggaggatcgg cctcggccaa gtagctcaat 480 tcatgcttaa tcgaatagta cgggaactca ataaaatcaa ctatatcctc tagtccaaat 540 tcacccgcaa tcaatatcga actcttcgat ttatggatat atcgacatat taacgcatat 600 ttaaattctt acaaataggt taagtatatg tccttaacaa agtggtcaaa atacttgaat 660 ccttccctct aacttgaact aattagatag ttttttatat tcaagtgaaa gacaacatct 720 ttattgttga gaaacctttt gggagcaata gaaatttaac tcaaaagttc aggcaataca 780 acatttttgt aggagatacc cctcaacaaa acatacaatt ttctaaaatg taaaaggtta 840 tgatttgaat ggaagtagag aagggaacaa cacaacaaca attgaagaat taataattac 900 acaagatcaa aagtgcatgg atatatactt tatgcaattt gtctcctata atagaataaa 960 gataaaaata gatccaacag tctctagaaa cataagctat a 1001 <210> 11 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 11 tagatacata ttttttaatg aaaattatta ctataaaact aatttcgaaa ataaaattat 60 ttaaaattta ttaaaagtat attaatcaaa attaaatatt agaaaatata aaaattaaaa 120 ttgaacaaat acaaagtata tagattaaaa taatatttta agaaaaaaaa aataaataaa 180 taaataaaaa atcaaaggtg ggctagtttc tatagtatcc cttgaatttt ccactttatt 240 ataatttgct tggccacatc tggactttcg ttttcttttt cttgttcttt ttcaatgttc 300 tttgttttca gactacgaaa attgactttt tatttaataa tttgttattt actaagaaaa 360 acagtgaagc tttttggttc ccactcctcc ataatgattc tggcggaaaa gttcctttct 420 tgccaaaagg tccactgcca ccatcttttc tttttcttcc tataatgccc tttactctcc 480 tcttagtcct tgattagacc gcatgatttc aatttattat tttgaatgtt tttgagacaa 540 caaaatataa aaatccaaat gtttcataaa tataaaattt ggataaatta ggcatgaata 600 cgataggatt gttaaataag aaaaatattt aggtatatct ctcaaattgc tatttattta 660 tttttatttt atttttattt ttttcattcc actaaattgt cccatcacaa tttgtttgtg 720 gaatgactaa ttcttctaac atctttttaa aatattttat tattattgtt tatacatctt 780 aaataagagg tagaatttat gttggacaag tccttatgac aactatgaga gtaaatatat 840 tgggtgagaa aagtttggtg aaacggagta aatgagttct taaatttctt aataaaagga 900 atgtacaaca tgacacctgt ggaaaacatc tctattggaa aatggatttt atttttatca 960 actacttttc acaaaaatgg taaaccttgc attacaagct t 1001 <210> 12 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 12 attgggttga tcataaatct tataatgtgt aatgtttatt tagctaatga aattttgtct 60 tcaagacatt caaattgttg gaacttaata tgagaaatga gattataaca tatatttgga 120 tacttatttt gcaaaataat aataataata ataaataaaa taattattta gtgttagaat 180 aacaatatat ttgacaaata aaaaaaatga gcttatagaa tatatttgga tacttatttt 240 gcaaaaaaca ttacatacat acatgaaat cttgtcaaga attaaataac ttgtcaatta 300 tttagtgtca ggataacaat atttttcaca aatagaaaat gtcaagagtg actacacatg 360 atacataatt aatgtaaaaa attagtacac ttgacacata acccttgtca attttgtgac 420 tatttttgac acaaaaagta taacttgaca tttttccttg gttaagttat acattattct 480 tgatgctttt aaaagcgtca ggattattgg atgcttgaca ttgtagaaac gtcgagcaat 540 tcaatttctg taagagtgca ccttcatcct tcaaacaaaa aacttaaatt agagaaaggt 600 tacgaactca cgtcattgtt ttattttcca agatagattt ttttaaggct tcaagatgga 660 tacgtaatca taggtggtac tttttaaaaa taagcttata ttcaaagttt aaaatggtca 720 acgaaaatat cgaaatatta attttacgaa aatgttgata caatatcatc gtgtcactaa 780 atatttctag aaaaattata aaagcaaaag atcaaaaaat aaattgaaat gagtaaataa 840 tactttatgg tttttaaaca agtttaacat gtctattatt tatattacat ttatattagt 900 gatatttcgt tattttttca gatttttcta cgatataata aaaatatcac gaaaaagacc 960 gatatggatg aaaatttaat ctaaatgttt acccttttgt t 1001 <210> 13 <211> 1001 <212> DNA <213> Citrullus lanatus <400> 13 gaagtgatag aagtcgatcg cagtctatca ccgatagaca gtgaaatttt tctatatttg 60 taattagttt gaaatttttc tatttataat attttttttt gtttttttat gataccgtat 120 gcttaattta tttttttaaa gattttttgg attatttatt ttctaaccat tctttaaaat 180 aatttttagc actttgaaac aattttttca taatataaat tgaaaattga gtgattaatc 240 ttagatcaat atatgaaaat aagtaagtgt tctttttaaa tataggataa taaatcaaaa 300 tgacagatag acacaaatag tagtctatcg cggtctattg tatatagatt atgatttgta 360 aatattttca gcagttttgt catttaaaat aatttttcaa taattaaata aaaaaattac 420 atattaatat tttacttatt tttcaaacaa acattaaaat aaataattcg agttatccta 480 accaacccaa atgtttaatg attaggttgg attgtgttca ttgtttaatt ctaattattt 540 ggatgaaaaa aagttataat tagaacaatt ggattgagtt taaaaattgc tccaacctaa 600 ctcaaccatg aatattgata atagaaatca tattcctaag ttacaagttg tgtttgtgtg 660 tgtgtgtaag agagaggtta agttgatatc aaaacttaat ttgcttagtt gttgccgtgt 720 tttaggggtt tgtctcaatc ttattacaga gtttatttgt tgctattata tttcaattta 780 ggaccactta tgtatgtata tgtcacgtta cgatcaatac gagaaactca tgtgaccaaa 840 attacaattt tggacactgt tttctcattt ctatcttttg tagttctatt tctttttcat 900 atatatatat tatattcttt tcttcttttg ggtataagaa tttcaacata ccataatgac 960 ctttatttag agataagatt tgtgtcatgt ggtatataat c 1001 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL-4-403-F Primer <400> 14 tcggccaagt agctcaattc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL-4-403-R Primer <400> 15 gcgggtgaat ttggactaga 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL-4-879-F Primer <400> 16 ccactgccac catcttttct 20 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> LL-4-879-R Primer <400> 17 tttgttgtct caaaaacatt caaaa 25 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> LL-4-868-F Primer <400> 18 ttgacatttt tccttggtta agtt 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL-4-868-R Primer <400> 19 ttgaattgct cgacgtttct 20 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LL-4-325-F Primer <400> 20 tcctaaccaa cccaaatgtt ta 22 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> LL-4-325-R Primer <400> 21 ggagcaattt ttaaactcaa tcca 24

Claims (12)

In the nucleotide sequence of SEQ ID NO: 3, comprising a polynucleotide sequence consisting of 8 to 100 consecutive bases including SNP (single nucleotide polymorphism) located at the 501st base or a complementary polynucleotide sequence thereof, leaf cut ( lobed leaf) SNP marker composition for discriminating watermelon individuals having traits.
According to claim 1,
The composition comprises a polynucleotide sequence consisting of 8 to 100 consecutive bases including a single nucleotide polymorphism (SNP) located at the 501st base in the base sequence of SEQ ID NO: 1 or a complementary polynucleotide sequence thereof; and
One or more polynucleotide sequences selected from the group consisting of a polynucleotide sequence consisting of 8 to 100 consecutive bases including the SNP located at the 501st base in the nucleotide sequence of SEQ ID NO: 2 or a complementary polynucleotide sequence thereof, or A composition, characterized in that it further comprises a complementary polynucleotide sequence thereof.
3. The method of claim 1 or 2,
The composition is characterized in that it is applied to the genetic marker backcross (Marker-assisted backcross, MABC) of watermelon, the composition.
A primer set for discriminating a watermelon individual having a leaf-cut trait, capable of amplifying a polynucleotide sequence or a complementary polynucleotide sequence thereof included in the composition of claim 1 or 2 .
5. The method of claim 4,
The primer set, comprising a primer set consisting of SEQ ID NOs: 8 and 9, a primer set.
6. The method of claim 5,
The primer set includes: a primer set consisting of SEQ ID NOs: 4 and 5; and one or more primer sets selected from the group consisting of primer sets consisting of SEQ ID NOs: 6 and 7.
The primer set according to claim 4, wherein the primer set is a primer set for high-resolution melting (HRM) analysis.
A kit for identifying a watermelon individual having a leaf slit trait, comprising the primer set of claim 4 .
A method for discriminating a watermelon individual having a leaf-cut trait, comprising the steps of:
(a) separating the genomic DNA from the watermelon to be discriminated;
(b) detecting the 501st base type of SEQ ID NO: 3 in the isolated genomic DNA; and
(c) discriminating a watermelon individual having a leaf-cut trait from the detected base type.
10. The method of claim 9,
The (b) step further comprises the step of detecting the 501st base type of SEQ ID NO: 1 or the 501st base type of SEQ ID NO: 2 in the isolated genomic DNA.
10. The method of claim 9,
The (b) step is characterized in that the PCR (polymerase chain reaction) is performed using the primer set of claim 4.
10. The method of claim 9,
The step (c) is characterized in that it is performed by one or more methods selected from the group consisting of high-resolution fusion, capillary electrophoresis, DNA chip, gel-electrophoresis, sequencing, radiometric measurement, fluorescence measurement, and phosphorescence measurement, Way.

Images