KR101745071B1 - SNP marker for discriminating resistance to leaf mold and use thereof - Google Patents

Abstract

The present invention relates to a composition for determining a leaf mold resistance resistant tomato comprising a single nucleotide polymorphism (SNP) marker for leaf mold resistance and an agent capable of detecting or amplifying the SNP marker, (A) amplifying the SNP marker region of the polynucleotide consisting of SEQ ID NO: 1 from the DNA of the sample isolated from the individual; And (b) determining the base of the amplified SNP marker region of step (a).
The novel SNP marker and the HRM analysis method using the novel SNP marker of the present invention can be used as a means for judging leaf fungus resistance resistant tomatoes and thus can be used as a means for objectively evaluating leaf fungus resistance resistant tomatoes not visually distinguished, We will be able to distinguish resistant tomatoes against leaf mold, and will be able to evaluate the breeding and resistance to the improved varieties. It is also possible to distinguish Cf-9 resistant and susceptible varieties against tomato foliar fungi, as well as Cf-4, a resistance gene that is quite similar to Cf-9.

Description

SNP markers and their uses SNP markers for leaf mold resistance,

The present invention relates to a composition for determining a leaf mold resistance resistant tomato comprising a single nucleotide polymorphism (SNP) marker for leaf mold resistance and an agent capable of detecting or amplifying the SNP marker, (A) amplifying the SNP marker region of the polynucleotide consisting of SEQ ID NO: 1 from the DNA of the sample isolated from the individual; And (b) determining the base of the amplified SNP marker region of step (a).

Cladosporium Fulvum is a pathogenic fungus that causes tomato foliar disease. It is infected mainly through leaves and shows yellow spots on leaf surface. As the pathogens multiply in the plant cells, the pores of the leaves become blocked by the pathogens. In the end, the pores become clogged and the function does not work properly.

Various methods for controlling leaf mold have been attempted, but no method has been developed to accurately determine the leaf mold resistance type. However, Japanese Patent Publication No. 1999-504521 only discloses Cf-4 or Cf-9 as a plant pathogen resistance gene.

In addition, some of the species that are resistant to leaf mold disease in tomato wild-type are known, and the resistance gene to leaf fungus is Cf gene. Among them, the Cf-9 resistance gene is Solanum pimpinellifolium , and Cf-4 was derived from another wild species, Solanum habrochaites . Since the Cf-9 resistance gene and the Cf-4 resistance gene have substantially similar nucleotide sequences, there is a limit to distinguish between Cf-9 and Cf-4, and the susceptibility allele as a previously developed gene-based marker. The need for the development of SNP markers to see the limitations of these existing markers and low cost and high efficiency has emerged.

Under these circumstances, the present inventors have made intensive researches to develop a method for judging tomatoes resistant to fungal diseases. As a result, when SNPs contained in the Cf-9 gene involved in fungal resistance to foliage were used, It is possible to judge the variety of tomato which is resistant to the completely determined leaf mold disease, and the present invention has been completed.

One object of the present invention is to provide SNP markers for determining foliar resistance to tomato.

Another object of the present invention is to provide a composition for judging foliar resistance of a leaf mold comprising a preparation capable of detecting or amplifying the SNP marker.

It is still another object of the present invention to provide a kit for determining resistance to leaf mold against tomatoes comprising the composition.

It is still another object of the present invention to provide a method for determining a leaf mold susceptibility tomato tolerance, comprising the step of determining a base at the SNP marker site.

In order to accomplish the above object, the present invention provides, in one embodiment, a single nucleotide polymorphism (SNP) marker, which is a single nucleotide polymorphism for tomato fungus resistance resistance tomato judgment.

In the present invention, a SNP primer specific for Cf-9 resistance gene was designed. Using SNP primers for high resolution melting (HRM) analysis using 41 commercially available tomato F1 varieties, Cf -9 resistant and susceptible varieties as well as varieties with Cf-4 resistance genes that are quite similar to Cf-9. Thus, the present inventors completed the present invention by confirming that HRM analysis can be used to discriminate leaf-fungus-resistant varieties at a faster and lower cost using Cf-9-specific markers.

The marker may preferably be all or some of the polynucleotides comprising the SNP region of the Cf-9 gene, more preferably all or some polynucleotides of the polynucleotide consisting of SEQ ID NO: 1, The 806th base is C, the 847th base is A, the 5'-300 nucleotides including the 806th nucleotide and the 847th nucleotide, preferably, the 806th nucleotide is A at the translation start position of the polynucleotide of SEQ ID NO: 1, A leaf mold resistant tomato determining SNP comprising a polynucleotide consisting of 80 to 250, more preferably 140 to 190, most preferably 166 consecutive bases, or a complementary polynucleotide thereof, (single nucleotide polymorphism) marker.

The term "Cf-9 gene" of the present invention means Cladosporium It is one of the genes resistant to fulvum and has a total of 2,592 nucleotide sequences. The nucleotide sequence of the Cf-9 gene can be obtained from a known database such as GeneBank of NCBI. U15936, preferably a polynucleotide of SEQ ID NO: 1.

The term "SNP marker" of the present invention means a single base polymorphism allele base pair on the DNA sequence used to identify an individual or species. Because SNPs are relatively frequent and stable and distributed throughout the genome, and because of the genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity among individuals. SNP markers generally involve phenotypic changes associated with single nucleotide polymorphisms but may or may not be. In the case of the SNP marker of the present invention, there may be a difference in the phenotype of an individual such as a mutation in an amino acid sequence or resistance to a leaf mold disease.

The term "polymorphism " of the present invention refers to a case where two or more alleles exist in one locus. Of the polymorphic sites, only a single base is different depending on the individual, Polymorphism. Preferred polymorphic markers have two or more alleles with a frequency of occurrence of 1% or more, more preferably 5% or 10% or more in the selected population.

The term "allele " of the present invention refers to various types of a gene existing on the same locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

According to one embodiment of the present invention, by analyzing the nucleotide sequence of the Cf-9 gene region amplified in commercially available leaf mold resistant and susceptible varieties, it is possible to accurately identify the resistant and susceptible variety groups of leaf mold diseases Two SNPs that can be distinguished were identified, and it was confirmed that the 806th nucleotide, C, in the transcription start position of the Cf-9 gene was changed to the nucleotide A in the susceptible variety and the A nucleotide in the 847th nucleotide 2). In addition, HRM analysis confirmed that the Cf-9 resistant and susceptible varieties were distinctly distinguished, and that Cf-9 and Cf-4 resistance genes with similar genetic sequences were also distinguishable 3).

Therefore, when the genotype of the SNP marker of the present invention is amplified and analyzed by HRM, and the genotype of the SNP marker is read, it is expected that it will be possible to judge a leaf mold disease resistant tomato, and the SNP markers It was first identified.

According to another aspect of the present invention, there is provided a composition for judging foliar resistance of a leaf mold disease comprising an agent capable of detecting or amplifying the SNP marker.

The term "agent capable of detecting or amplifying an SNP marker" of the present invention means a composition capable of judging a leaf mold-resistant tomato by confirming the polymorphic site of the above-mentioned gene through amplification, Means a primer capable of specifically amplifying the polynucleotide of the SNP marker.

The primers used for the SNP marker amplification can be amplified using appropriate conditions in suitable buffers (for example, four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) and template-directed DNA Stranded oligonucleotide which can serve as a starting point of synthesis. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the SNP marker but should be sufficiently complementary to hybridise with the SNP marker and preferably comprise a polynucleotide sequence consisting of SEQ ID NOS: 2 and 3, But is not limited to.

The term "primer" of the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i.e., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. At this time, the PCR conditions, the lengths of the sense and antisense primers can be modified based on those known in the art.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

Another aspect of the present invention is to provide a kit for judging leaf mold resistance resistance tomato comprising the above composition. The kit may be an HRM assay kit.

The kit of the present invention can determine the leaf mold resistance resistant tomato by amplifying and reading the genotype of the SNP marker which is a marker for resistance to leaf mold disease resistance or by detecting a small difference in the PCR dissociation curve. Preferably, the leaf mold resistance resistance tomato determination kit provided in the present invention may be an HRM assay kit including essential elements necessary for performing HRM analysis. The above "high resolution melting (HRM) analysis" technique is a relatively new post-PCR analysis method used to identify mutations in nucleic acid sequences, and this method is based on detecting small differences in the PCR dissociation curve do. This is made possible by the improved double-stranded DNA (dsDNA) with the dye used in conjunction with the PCR instrument. Data can be analyzed and processed using specially designed software for the HRM analysis of differences in the degree of dissociation of dsDNA with temperature. In the present invention, HRM analysis was used to select tomato resistant to leaf mold.

The HRM assay kit comprises a pair of primers specific for the polynucleotide comprising the SNP marker, DNA polymerase, deoxynucleotides (dNTPs), RNAase, DEPC-water, test tubes and appropriate containers . ≪ / RTI >

(A) amplifying the SNP marker region of the polynucleotide consisting of SEQ ID NO: 1 from DNA of a sample isolated from an individual; And (b) determining the base of the amplified SNP marker region of step (a). At this time, when the allele of the 806th base of the Cf-9 gene, which is a polynucleotide consisting of SEQ ID NO: 1, is C and the allele of the 847th base is A, resistance to the leaf mold is higher than that of the normal tomato .

The term "individual" of the present invention means tomato which is a target to be tested for resistance to foliar fungi. By analyzing the genotype of the SNP marker using the sample obtained from the tomato, can do. The specimen may be a leaf, a root, a stem, a flower, a fruit, a separated tissue, or a sample such as a separated cell, but is not particularly limited thereto.

The step of amplifying the polynucleotide from the DNA sample of step (a) may be any method known to those skilled in the art. For example, the target nucleic acid can be obtained by PCR amplification and purification thereof. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sequence amplification based on nucleic acids (NASBA) can be used as well as self-sustaining sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)).

Methods for determining the base of the amplified SNP marker region in step (b) of the above method include sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele hybridization PCR-SSCP, PCR-RFLP analysis, HRM analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (eg, Sequenom's MassARRAY system), mini-sequencing (e.g. Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium analysis ), But the present invention is not particularly limited thereto. One or more alleles in the SNP marker can be identified by the methods described above or other methods available to those skilled in the art to which the invention pertains.

The "HRM analysis" technique is as described above.

The sequencing analysis can be performed using a conventional method for nucleotide sequencing, and can be performed using an automated gene analyzer. In addition, allele-specific PCR means a PCR method in which a DNA fragment in which the mutation is located is amplified with a primer set including a primer designed with the base at the 3 'end at which the mutation site is located. The principle of the above method is that, for example, when a specific base is substituted by A to G, an opposite primer capable of amplifying a primer containing the A as a 3 'terminal base and a DNA fragment of an appropriate size is designed, When the base at the mutation position is A, the amplification reaction is normally performed and a band at a desired position is observed. When the base is substituted with G, the primer can be complementarily bound to the template DNA, And the amplification reaction is not performed properly due to the inability of complementary binding at the terminal. DASH can be performed by a conventional method, preferably by a method such as Prince et al.

The TaqMan method comprises the steps of (1) designing and preparing a primer and a TaqMan probe to amplify a desired DNA fragment; (2) labeling probes of different alleles with FAM dyes and VIC dyes (Applied Biosystems); (3) performing PCR using the DNA as a template and using the primer and the probe; (4) after completion of the PCR reaction, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; And (5) determining the genotype of the polynucleotides of step (1) from the analysis results.

On the other hand, in the PCR extension analysis, first, a DNA fragment containing a base in which a single nucleotide polymorphism is located is amplified with a pair of primers, and all the nucleotides added to the reaction are deactivated by dephosphorylation, and a specific extension primer, dNTP And then performing a primer extension reaction by adding a mixture, a digoxinucleotide, a reaction buffer and a DNA polymerase. At this time, the extension primer has the 3 'end immediately adjacent to the 5' direction of the base where the mutation site is located, and the nucleic acid having the same base as the didyoxynucleotide is excluded in the dNTP mixture, and the didyoxynucleotide has a mutation ≪ / RTI > For example, when dGTP, dCTP and TTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer is extended by the DNA polymerase in the base in which the substitution has occurred, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the kind of base showing the mutation by comparing the length of the extended primer.

At this time, as a detection method, when the extension primer or the didyxin nucleotide is fluorescently labeled, the mutation is detected by detecting fluorescence using a gene analyzer (for example, Model 3700 manufactured by ABI Co., Ltd.) used for general nucleotide sequence determination And when the unlabeled extension primer and the dideoxy nucleotide are used, the mutation can be detected by measuring the molecular weight using a MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

The novel SNP marker and HRM analysis method using the novel SNP marker of the present invention can be used as a means for judging leaf fungus resistance resistant tomatoes and thus can be used as a means for objectively evaluating leaf fungus resistant tomatoes not discriminated by the naked eye, We will be able to distinguish resistant tomatoes against leaf mold, and will be able to evaluate the breeding and resistance to the improved varieties.

It was also confirmed that not only Cf-9-resistant and susceptible varieties of tomato foliar fungi can be distinguished, but also Cf-4, a resistance gene which is quite similar to Cf-9, can be distinguished.

FIG. 1 is a diagram showing positions where the primer sets composed of the nucleotide sequences of SEQ ID NOS: 2 and 3, when the PCR product is amplified, together with the domain positions of the Cf-9 gene and two Cp-9 specific SNP positions.
Figure 2 is S with S. pimpinellifolium (S.pim), S. habrochaites (S.hab) and Cf-4 Cf-9 resistance gene with resistance genes using the nucleotide sequence information of (National Center for Biotechnology Information) NCBI . lycopersicum (S.lyc) and S. habrochaites (S.hab), S. peruvianum (S.per), S. parviflorum (S.par), S. chmielewskii (S.chm), S. chilense (S. chi) wild type and the susceptible breed gene cf-9. The two baselines underlined in a single line represent single nucleotide polymorphic loci with only the Cf-9 resistance gene or only the cf-9 susceptibility allele and the Cf-4 resistance gene. The underlined portions in the two lines indicate positions where the primers of SEQ ID NO: 2 and SEQ ID NO: 3 bind.
FIG. 3 is a graph showing the results of analysis of Cf-9 and Cf-4, which are resistant to tomato leaf mold, and the susceptibility genotype Cf-9, using the HRM method using a primer set consisting of the nucleotide sequences of SEQ ID NOS: 2 and 3.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  One: Cf -9 Resistance genotype specific SNP  analysis

S. pimpinellifolium , S. habrochaites, and S. lycopersicum and S. habrochaites , which have the Cf-4 resistance gene, with the Cf-9 resistance gene using the nucleotide sequence information of NCBI (National Center for Biotechnology Information) . peruvianum, S. parviflorum, S. chmielewskii, S. chilense the wild and breed susceptibility genes cf-9 nucleotide sequence using ClustalW2 program compares nucleotide sequences were listed, Cf-9 specific non- just have genotype We found two synonymous substitution SNPs. Two SNPs are located at positions 806-bp and 847-bp from the translation start position of the Cf-9 resistance allele, as shown in Fig. In case of 806-bp position, C is changed to A, and in case of 847-bp position, A is changed to G. A primer for HRM was constructed centering on two SNPs. Primer base sequences are shown in Table 1, and primer positions are shown in FIG. 1 and FIG.

SEQ ID NO: designation Base sequence SEQ ID NO: 2 Cf9_2-SNP_F AATCCCCAGCTCACGGTTAGG SEQ ID NO: 3 Cf9_2-SNP-R GCCCTGACAGATTACAACGA

Example  2: In leaf mold mold Cf -9 gene and susceptible varieties tomatoes DNA  extraction

Tomato F1 commercial varieties were harvested for 4 weeks after sowing in a greenhouse. The leaves were cooled and then DNA was extracted by CTAB (Cetyl trimethyl ammonium bromide) method. The commercial varieties of tomatoes F1 used in the analysis are shown in Table 2. More specifically, the instantly cooled young tomato leaves were pulverized and 300 μl of CTAB buffer was added to dissolve in the plant tissues and mixed well with the pulverized tissue using a vortex. Thereafter, it was treated in a water bath at 65 ° C for 30 minutes. 150 Ch of Chloroform was added and mixed well. The mixture was centrifuged at 13,000 rpm and 4 ° C for 1 minute, and 200 μl of 100% isopropanol was added to the supernatant. After centrifugation at 13,000 rpm at 4 ° C for 1 min, 700 μl of 70% ethanol stored at room temperature in DNA pellet was added and mixed well. Centrifuged for 1 minute at 13,000 rpm and 4 ° C, 70% ethanol was removed, and then dried. 100 of sterilized water was added and the mixture was treated in a water bath at 42 캜 for 3 minutes. The concentration of the DNA thus extracted was measured using nano-drop, and the final concentration was diluted to 10 ng / μl.

number Breed name Seed company number Breed name Seed company One TY Sense Q Conifer seedling 21 tiara Conifer seedling 2 Mini maru 22 Deer Ross Syngenta
Korea 3 Red Fang 23 Rhapsody 4 Titi 24 Mamirio 5 Kewpie 25 Madison 6 Minnie 26 TP-7 Plus 7 Gold mining 27 Lycopene 9 8 TY Alto 28 Daphne 9 Pink Top 29 Dune 10 Bettany 30 Gaya Plus 11 Prime Alexander 31 Mini black water Asia
Nursery 12 Alexander Deluxe 32 Cadillac 13 TY Tiny 33 Shinku number 14 13T510 34 TY250 15 10T329 35 COTTAN and TY Winner DaKei Korea 16 Savera 36 Oyama Sakata Korea 17 Cerato 37 Hawaii7996 18 Omnia 38 Hawaii7998 19 Ajitesh 39 Moneymaker 20 10T346 40 M82

Example  3: SNP primer  Using a set HRM ( High Resolution Melting ) analysis

PCR amplification was performed using the Cf9_2-SNP_F / R (SEQ ID NOS: 2 and 3) primer set shown in Table 1 for HRM analysis. 2 μl of 2 × Real-Time PCR Smart Mix, 2 μl of primer (10 pmole / μl), 5 μl of DNA (10 ng / μl) and 1 μl of Evagreen dye PCR was performed. The PCR conditions were 95 ° C for 15 minutes, 95 ° C for 20 seconds, 55 ° C for 40 seconds, and 72 ° C for 30 seconds. After PCR amplification, the degree of fluorescence of the sample was measured by increasing the temperature from 65 ° C to 95 ° C by 0.2 ° C with the dissociation rate. The results are shown in FIG.

In the HRM analysis, when the SNP is present in a specific nucleotide sequence, the melting curve of the nucleotide sequence undergoes a subtle change in physico-chemical properties due to the nucleotide sequence. In the course of detecting fluorescence, If there is a corresponding C or A instead of C, and there is A corresponding to another SNP, or if there is a G instead of A, distinguishing between resistance and susceptibility through differences in melting curve Respectively.

FIG. 3 shows the result of HRM analysis of SNP markers for HRM confirmation based on the SNPs found in the present experiment. Melting curves of these varieties were confirmed in the known resistance cultivars and susceptible varieties which were used in this experiment. As a result, it was confirmed that the melting curves were separated into three fractions at 79 ~ 84 ℃. And that the known Cf-9 resistance, Cf-9 susceptible varieties and Cf-4 resistant varieties were separated into corresponding melting curves, respectively. Therefore, as shown in Fig. 3, it is possible to clearly distinguish the Cf-9-resistant and the susceptible varieties against the tomato leaf mold disease using the Cf-9_2-SNP_F / R primer set of the present invention Respectively. In addition, it was confirmed that Cf-4, which is a resistance gene which is quite similar to Cf-9, can be distinguished.

In addition, the cultivars determined by HRM analysis for the validity of the SNP markers used in the present invention are shown in Table 3. The Cf-9 resistant cultivars are S, the Cf-9 susceptible cultivars are S, and the Cf-4 resistant cultivars are S (Cf-4).

number Breed name Seed company SNP marker
Test result number Breed name Seed company SNP marker
Test result One TY Sense Q Conifer seedling R 21 tiara Conifer seedling R 2 Mini maru R 22 Deer Ross Syngenta
Korea R 3 Red Fang R 23 Rhapsody R 4 Titi R 24 Mamirio S 5 Kewpie S (Cf-4) 25 Madison S 6 Minnie R 26 TP-7 Plus S 7 Gold mining R 27 Lycopene 9 R 8 TY Alto R 28 Daphne S 9 Pink Top S (Cf-4) 29 Dune S 10 Bettany R 30 Gaya Plus S 11 Prime Alexander R 31 Mini black water Asia
Nursery S 12 Alexander Deluxe R 32 Cadillac S 13 TY Tiny R 33 Shinku number S 14 13T510 R 34 TY250 S 15 10T329 R 35 COTTAN and TY Winner DaKei Korea R 16 Savera S 36 Oyama Sakata Korea R 17 Cerato S 37 Hawaii7996 S 18 Omnia S 38 Hawaii7998 S 19 Ajitesh S 39 Moneymaker S 20 10T346 R 40 M82 S

<110> University-Industry Cooperation Group of Kyung Hee University <120> SNP markers for discriminating resistance to leaf mold and use          the <130> KPA150118 / KR <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 2592 <212> DNA <213> Solanum pimpinellifolium <220> <221> gene &Lt; 222 > (1) .. (2592) <223> Cf-9 <400> 1 atggattgtg taaaacttgt attccttatg ctatatacct ttctctgtca acttgcttta 60 tcctcatcct tgcctcattt gtgccccgaa gatcaagctc tttctcttct acaattcaag 120 aacatgttta ccattaatcc taatgcttct gattattgtt acgacataag aacatacgta 180 gacattcagt catatccaag aactctttct tggaacaaaa gcacaagttg ctgctcatgg 240 gatggcgttc attgtgacga gacgacagga caagtgattg cgcttgacct ccgttgcagc 300 caacttcaag gcaagtttca ttccaatagt agcctctttc aactctccaa tctcaaaagg 360 cttgatttgt cttttaataa tttcactgga tcactcattt caccaaaatt tggtgagttt 420 tcaaatttga cgcatctcga tttgtcgcat tctagtttta caggtctaat tccttctgaa 480 atctgtcacc tttctaaact acacgttctt cgtatatgtg atcaatatgg gcttagtctt 540 gtaccttaca attttgaact gctccttaag aacttgaccc aattaagaga gctcaacctt 600 gaatctgtaa acatctcttc cactattcct tcaaatttct cttctcattt aacaactcta 660 caactttcag gcacagagtt acatgggata ttgcccgaaa gagtttttca cctttccaac 720 ttacaatccc ttcatttatc agtcaatccc cagctcacgg ttaggtttcc cacaaccaaa 780 tggaatagca gtgcatcact catgacgtta tacgtcgata gtgtgaatat tgctgatagg 840 cctcat ctgtcagggc ctattcctaa acctctatgg aatctcacca acatagtgtt tttgcacctt 960 ggtgataacc atcttgaagg accaatttcc catttcacga tatttgaaaa gctcaagagg 1020 ttatcacttg taaataacaa ctttgatggc ggacttgagt tcttatcctt taacacccaa 1080 cattgaacggc tagatttatc atccaattcc ctaactggtc caattccatc caacataagc 1140 ggacttcaaa acctagaatg tctctacttg tcatcaaacc acttgaatgg gagtatacct 1200 tcctggatat tctcccttcc ttcactggtt gagttagact tgagcaataa cactttcagt 1260 ggaaaaattc aagagttcaa gtccaaaaca ttaagtgccg ttactctaaa acaaaataag 1320 ctgaaaggtc gtattccgaa ttcactccta aaccagaaga acctacaatt acttctcctt 1380 tcacacaata atatcagtgg acatatttct tcagctatct gcaatctgaa aacattgata 1440 ttgttagact tgggaagtaa taatttggag ggaacaatcc cacaatgcgt ggttgagagg 1500 aacgaatacc tttcgcattt ggatttgagc aaaaacagac ttagtgggac aatcaataca 1560 acttttagtg ttggaaacat tttaagggtc attagcttgc acgggaataa gctaacgggg 1620 aaagtcccac gatctatgat caattgcaag tatttgacac tacttgatct aggtaacaat 1680 atgttgaatg acacatttcc aaactggttg ggatacctat ttcaattgaa gattttaagc 1740 ttgagatcaa ataagttgca tggtcccatc aaatcttcag ggaatacaaa cttgtttatg 1800 ggtcttcaaa ttcttgatct atcatctaat ggatttagtg ggaatttacc cgaaagaatt 1860 ttggggaatt tgcaaaccat gaaggaaatt gatgagagta caggattccc agagtatatt 1920 tctgatccat atgatattta ttacaattat ttgacgacaa tttctacaaa gggacaagat 1980 tatgattctg ttcgaatttt ggattctaac atgattatca atctctcaaa gaacagattt 2040 gaaggtcata ttccaagcat tattggagat cttgttggac ttcgtacgtt gaacttgtct 2100 cacaatgtct tggaaggtca tataccggca tcatttcaaa atttatcagt actcgaatct 2160 ttggatctct catctaataa aatcagcgga gaaattccgc agcagcttgc atccctcaca 2220 ttccttgaag tcttaaatct ctctcacaat catcttgttg gatgcatccc caaaggaaaa 2280 caatttgatt cgttcgggaa cacttcgtac caagggaatg atgggttacg cggatttcca 2340 ctctcaaaac tttgtggtgg tgaagatcaa gtgacaactc cagctgagct agatcaagaa 2400 gaggaggaag aagattcacc aatgatcagt tggcaggggg ttctcgtggg ttacggttgt 2460 ggacttgtta ttggactgtc cgtaatatac ataatgtggt caactcaata tccagcatgg 2520 ttttcgagga tggatttaaa gttggaacac ataattacta cgaaaatgaa aaagcacaag 2580 aaaagatatt ag 2592 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cf9_2-SNP_F <400> 2 aatccccagc tcacggttag g 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cf9_2-SNP_R <400> 3 gccctgacag attacaacga 20

Claims (7)

delete A polynucleotide consisting of 5 to 300 consecutive bases, wherein the 806th base of the Cf-9 gene represented by SEQ ID NO: 1 is C, the 847th base is A, the 806th base and the 847th base, A composition for determining a leaf mold resistance resistant tomato comprising a complementary polynucleotide, which agent is capable of detecting or amplifying a single nucleotide polymorphism (SNP) marker for leaf mold resistance.
3. The method of claim 2,
Wherein the agent is a primer represented by the polynucleotide consisting of SEQ ID NOS: 2 and 3.
A foliar-resistant tomato-resistant kit comprising the composition of claim 2 or 3.
5. The method of claim 4,
Wherein said kit is an HRM assay kit.
delete (a) amplifying the SNP marker region of the polynucleotide consisting of SEQ ID NO: 1 from the DNA of the sample separated from the individual; And
(b) determining the base of the amplified SNP marker region of step (a)
Wherein the allele of the 806th base is C and the allele of the 847th base is A in the polynucleotide of SEQ ID NO: 1, the leaf mold resistance resistance is higher than that of normal tomato.

Images