KR102412899B1 - Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus - Google Patents

Abstract

A primer set capable of discriminating the flower color of bellflower is disclosed. The present invention relates to a primer set for determining the color of a bellflower, a kit and a composition comprising the same, and a method for determining the color of a bellflower.

Description

Primer set for discriminating flower color of bellflower and discriminating method using same {Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus}

The present invention relates to a primer set for determining the color of a bellflower, a kit comprising the same, and a method for determining the color of a bellflower.

Bellflower ( Platycodon grandiflorus ) of the Campanulaceae family is widely cultivated not only for food and medicine, but also for floriculture (for ornamental purposes). Bellflower, which has mainly purple and pink flowers, is cultivated for floriculture. Early identification of flower colors can satisfy flower consumers' tastes in various aspects, and it will help reduce the labor force of flower farms because it is possible to select and cultivate bellflowers of the desired color. However, since bellflower has the same phenotype except for the flower color, there is a problem that the actual flower color cannot be determined before flowering.

Therefore, it is necessary to develop a molecular marker that can discriminate the color of bellflower flowers in the early stages of seed and growth.

Republic of Korea Patent Registration No. 10-1912192

The problem to be solved by the present invention is to provide a primer set capable of discriminating the color of a bellflower flower, and a kit or composition including the primer set.

Another problem to be solved by the present invention is to provide a method for determining the color of a bellflower flower.

One embodiment of the present invention is a primer set for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2.

The identification of the flower color of bellflower may be to distinguish a pink flower color from a white flower color or a purple flower color.

Another embodiment of the present invention is a kit for color discrimination of bellflower including a primer set for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2.

Another embodiment of the present invention is a composition for discriminating a bellflower color comprising a primer set for discriminating the flower color of bellflower represented by SEQ ID NOs: 1 and 2.

Another embodiment of the present invention provides an amplification reaction using (a) isolating genomic DNA from a bellflower sample, (b) using the isolated genomic DNA as a template, and using the primer sets shown in SEQ ID NOs: 1 and 2 performing, and (c) detecting the amplified product of step (b).

The bellflower sample may be at least one tissue selected from the group consisting of seeds, roots, leaves, stems, and flowers of bellflower.

By using the primer set of the present invention, it can be used for breeding new varieties of bellflower by discriminating the flower color of bellflower before the flower blooms or at the early stage of growth.

1 is a PCR product electrophoresis result of molecular marker MK2 according to the present invention;
2 is a result of electrophoresis after treatment with a restriction enzyme PCR product of molecular marker MK2 according to the present invention.

Hereinafter, specific embodiments of the present invention will be described in detail so that those of ordinary skill in the art can easily carry out the present invention. However, the present invention may be embodied in several different forms and is not limited to the embodiments described herein.

One embodiment of the present invention is a primer set for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2.

As used herein, the term "primer" is a short nucleic acid sequence having a free 3' hydroxyl group at the free 3' end and can form a complementary template and base pair and , refers to a nucleic acid sequence serving as a starting point for copying a template. The primer can initiate DNA synthesis at an appropriate temperature in the presence of an appropriate buffer, a reagent for the polymerization reaction, four different nucleotide triphosphates and a DNA polymerase or reverse transcriptase.

In the present invention, an oligonucleotide may be used as the primer included in the primer set, and a nucleotide analogue, for example, phosphorothioate, alkyl phosphorothioate, or peptide nucleic acid ) or may contain an intercalating agent.

In the present invention, the flower color of the bellflower may be white, purple or pink. Specifically, it is to distinguish pink flower color from white flower color or purple flower color.

Another embodiment of the present invention is a kit for color discrimination of bellflower including the primer set.

In the kit of the present invention, in addition to the primer set, reagents for performing the amplification reaction may be included, and specifically, DNA polymerase, dNTPs, buffers, and the like may be included. In addition, the kit of the present invention may further include a user's guide describing optimal conditions for performing the reaction. A handbook is a printout explaining how to use the kit, eg, how to prepare a PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

In addition, another embodiment of the present invention is a composition for color discrimination of bellflower including the primer set.

Another embodiment of the present invention comprises the steps of (a) isolating genomic DNA from a bellflower sample, (b) using the isolated genomic DNA as a template, and PCR amplification reaction using the primer sets represented by SEQ ID NOs: 1 and 2 It is a method for discriminating the color of a bellflower comprising the step of performing, and (c) detecting the amplified product of step (b).

In the present invention, the bellflower sample may be one or more types of tissue selected from the group consisting of seeds, roots, leaves, stems and flowers of bellflower.

In the present invention, examples of samples that can be used in step (a) of isolating genomic DNA from a bellflower sample are the same as described above, but are not limited thereto. A method of isolating genomic DNA from a bellflower sample may use a DNA extraction kit, and methods known in the art may be easily modified by those skilled in the art.

In the present invention, the step (b) is to amplify the target sequence using the isolated DNA as a template and a primer set consisting of SEQ ID NOs: 1 and 2.

Methods for amplifying the target sequence in the present invention include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. ), strand displacement amplification or amplification via Q replicase, or any other suitable method for amplifying nucleic acid molecules known in the art, and methods known in the art may be used. It can be appropriately modified and used by In an embodiment of the present invention, a target sequence was amplified through a polymerase chain reaction using a primer set consisting of SEQ ID NOs: 1 and 2.

In the present invention, the detection of the amplification product may be performed through a DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement. As one of the methods for detecting the amplification product, capillary electrophoresis may be performed. Capillary electrophoresis may use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used for gel electrophoresis depending on the size of the amplification product. Most preferably, 6% acrylamide gel electrophoresis can be used. In addition, in the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the primer with Cy-5, Cy-3 or 6-FAM, the target sequence is labeled with a detectable fluorescent labeling material. can be measured using In addition, the radioactive measurement method includes adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution when performing PCR to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, specific examples according to the present invention will be described.

Example 1: Exploration of flower color-related mutation regions of bellflower

Transcripts of bellflower plants with white, purple, and pink flower colors were analyzed using next-generation sequencing (NGS) technology, and the sequencing data produced therefrom was analyzed with the genome sequence (post-genome) of the bellflower variety. It was mapped to the multi-ministerial genomics project group). This was used to search for variations between flower colors, and the results are shown in Table 1 below.

Marker information
(Marker information) mutation annotation
(Variant annotation) SNP functional annotation
(Functional annotation) SNPID mutation type
(variant-
type) mutation effect
(Variant
effect) substitution
(substitution) region
(region) Num. SNP symbol
(symbol) Explanation
(description) Scaffold144:153991 missense_variant MODERATE c.1127G>A PGJG021990.1 2 - Uncharacterized protein Scaffold180:177095 synonymous_variant LOW c.1101T>A PGJG026810.1 9 CDC48C Cell division control protein 48 homolog C Scaffold1316:87539 upstream_gene_variant MODIFIER c.-211T>A PGJG150790.1 13 DIVARICATA Transcription factor DIVARICATA Scaffold4328:246345 downstream_gene_variant MODIFIER c.*82G>A PGJG297010.1 One CS1 Chorismate synthase 1, chloroplastic Scaffold46:86514 downstream_gene_variant MODIFIER c.*3107T>A PGJG007890.1 2 - - Scaffold4733:14225 synonymous_variant LOW c.1989G>A PGJG376590.2 26 TRAPPC8 Trafficking protein particle complex subunit 8 Scaffold765:76395 synonymous_variant LOW c.852A>G PGJG097920.1 6 SWI3B SWI/SNF complex subunit SWI3B Scaffold765:78413 missense_variant MODERATE c.95A>T PGJG097920.1 6 SWI3B SWI/SNF complex subunit SWI3B Scaffold1078:54988 synonymous_variant LOW c.1539C>T PGJG129730.1 39 BXL6 Probable beta-D-xylosidase 6

Referring to Table 1 above, 9 single nucleotide polymorphism (SNP) candidates that show a difference between the flower colors of three types of bellflower can be identified.

Example 2: Molecular label design for color discrimination of bellflower

The sequence of 500bp before and after the 9 mutation regions in Table 1 was extracted from the genome sequence of the Changbaek bellflower variety, and based on this, a primer set for genomic DNA PCR was designed. PCR was performed using this primer set and standard plant genomic DNA of bellflower in white, purple, and pink color, and then ABI Sanger sequencing was performed and comparative analysis of the amplified PCR product was performed to obtain a molecular marker for identifying the color of bellflower in the candidate mutation region. possibility was confirmed. Thereafter, molecular markers (CAPS, dCAPS) were designed for mutation regions with potential as molecular markers, and these were verified through PCR using genomic DNA of three types of bellflower flower color standard plants.

Among them, a molecular marker (Marker ID MK2) based on SNP ID (Scaffold180:177095) with a mutation effect LOW, a molecular marker designed with a Cleaved Amplified Polymorphic Sequence (CAPS) primer was selected. This molecular marker is a molecular marker designed to discriminate the color of bellflower using restriction enzyme sites that are specifically present in the mutation region, and is shown in Table 2 below.

MMarker ID forward primer
(Forward primer) reverse primer
(Reverse primer) restriction enzyme
(Restriction enzyme) type
(Type) MMK2 GGTGCATCAGAAGAGAACATTCG GCTAAGTCAGCTCCAACAAATCC HpyCH4V or ApoI CAPS

Example 3: PCR amplification

Genomic DNA was extracted from the leaves of each of three standard bellflower plants with white, purple, and pink flower colors, and genomic DNA PCR was performed using the molecular marker MK2 primer set. Specifically, each 20ng of bellflower genomic DNA was used as a template, and the amplification reaction was carried out using 1x PCR buffer, 0.2 mM dNTP, 1.25 units Taq DNA polymerase, 0.4 pmole forward primer, and 0.4 pmole reverse primer, and PCR conditions were as follows. Table 3 shows.

step temperature and time compare early metamorphosis 95℃, 5 minutes denaturalization 95℃, 20 seconds 30 reps hybridization 60℃, 20 seconds polymerization 72℃, 25 seconds polymerization 72℃, 7 minutes

Example 4: molecular label verification

The PCR product amplified in Example 3 was electrophoresed on a 2.5% agarose gel at 100 volt for 40 minutes, stained with a safety gel stain reagent (Inclone), and observed under a UV illuminator to confirm the PCR amplification result. The results are shown in FIG. 1 .

Referring to FIG. 1 , it can be confirmed that the molecular marker MK2 produced a specific single-sized amplification product (PCR product) in PCR analysis using genomic DNA of a bellflower standard plant having white, purple and pink flower colors.

Example 5: Molecular label verification after restriction enzyme treatment

The molecularly labeled MK2 PCR product of Example 3 was treated with restriction enzymes (~5 units) matching the SNP-derived restriction enzyme site for about 3 hours, electrophoresed in 2.5% agarose gel at 100 volt for 40 minutes, and safety gel stain The difference in the size of the cut band was confirmed by staining with a reagent (Inclone) and observing under a UV illuminator, and the results are shown in FIG. 2 .

Referring to FIG. 2 , since DNA fragments of different sizes are generated between flower colors, it can be confirmed that a pink flower color can be distinguished from other flower colors (white, purple).

As described above, by using the primer set for color discrimination of bellflower, including the primer pair consisting of SEQ ID NOs: 1 and 2 of the present invention, it is possible to determine the color of bellflower before the flower of bellflower blooms.

The preferred embodiment of the present invention has been described in detail above. The description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains will understand that other specific forms can be easily modified without changing the technical spirit or essential features of the present invention.

Therefore, the scope of the present invention is indicated by the claims to be described later rather than the detailed description, and all changes or modifications derived from the meaning, scope, and equivalent concept of the claims are interpreted as being included in the scope of the present invention. should be

<110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus <130> DP20200343 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MK2 forward primer <400> 1 ggtgcatcag aagagaacat tcg 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MK2 reverse primer <400> 2 gctaagtcag ctccaacaaa tcc 23

Claims (6)

delete delete A primer set for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2; and HpyCH4V or ApoI restriction enzyme;
The flower color discrimination kit for bellflower flower color is characterized in that the pink flower color is distinguished from a white flower color or a purple flower color.
A primer set for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2; and HpyCH4V or ApoI restriction enzyme;
The bellflower flower color discrimination composition for color discrimination of bellflower, characterized in that the pink flower color is distinguished from a white flower color or a purple flower color.
(a) isolating genomic DNA from the bellflower sample;
(b) using the isolated genomic DNA as a template, performing a PCR amplification reaction using the primer sets shown in SEQ ID NOs: 1 and 2, and cutting the product of the amplification reaction with HpyCH4V or ApoI restriction enzyme; and
(c) detecting the cleavage product of step (b);
The bellflower flower color discrimination method, characterized in that the pink flower color is distinguished from the white flower color or the purple flower color.
6. The method of claim 5,
The bellflower sample is a bellflower flower color discrimination method, characterized in that at least one tissue selected from the group consisting of seeds, roots, leaves, stems and flowers of bellflower.

Images