KR102412901B1 - Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus - Google Patents

Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus Download PDF

Info

Publication number
KR102412901B1
KR102412901B1 KR1020200175685A KR20200175685A KR102412901B1 KR 102412901 B1 KR102412901 B1 KR 102412901B1 KR 1020200175685 A KR1020200175685 A KR 1020200175685A KR 20200175685 A KR20200175685 A KR 20200175685A KR 102412901 B1 KR102412901 B1 KR 102412901B1
Authority
KR
South Korea
Prior art keywords
bellflower
flower color
color
flower
primer set
Prior art date
Application number
KR1020200175685A
Other languages
Korean (ko)
Other versions
KR20220085535A (en
Inventor
김창국
강상호
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020200175685A priority Critical patent/KR102412901B1/en
Publication of KR20220085535A publication Critical patent/KR20220085535A/en
Application granted granted Critical
Publication of KR102412901B1 publication Critical patent/KR102412901B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

도라지 꽃색을 판별할 수 있는 프라이머 세트가 개시된다. 본 발명은 도라지 꽃색 판별용 프라이머 세트, 이를 포함하는 키트 및 조성물 그리고 도라지 꽃색 판별방법에 관한 것이다.A primer set capable of discriminating the flower color of bellflower is disclosed. The present invention relates to a primer set for determining the color of a bellflower, a kit and a composition comprising the same, and a method for determining the color of a bellflower.

Description

도라지 꽃색 판별용 프라이머 세트 및 이를 이용한 판별방법{Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus}Primer set for discriminating flower color of bellflower and discriminating method using same {Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus}

본 발명은 도라지 꽃색 판별용 프라이머 세트, 이를 포함하는 키트, 그리고 도라지 꽃색 판별방법에 관한 것이다.The present invention relates to a primer set for determining the color of a bellflower, a kit comprising the same, and a method for determining the color of a bellflower.

초롱꽃과(Campanulaceae family)의 도라지(Platycodon grandiflorus)는 식용과 약용뿐만 아니라 화훼용(관상용)으로도 널리 재배되고 있다. 주로 꽃색이 보라색과 분홍색인 도라지가 화훼용으로 재배되고 있다. 화색을 조기에 판별하는 것은 화훼 소비자의 취향을 다양한 측면에서 충족시킬 수 있고, 원하는 화색의 도라지를 선별하여 재배할 수 있으므로 화훼농가의 노동력 감소에 도움이 될 것이다. 그러나, 도라지는 꽃색을 제외한 다른 표현형은 동일하므로, 개화전까지는 실제 꽃색을 판별할 수 없는 문제가 있다.Bellflower ( Platycodon grandiflorus ) of the Campanulaceae family is widely cultivated not only for food and medicine, but also for floriculture (for ornamental purposes). Bellflower, which has mainly purple and pink flowers, is cultivated for floriculture. Early identification of flower colors can satisfy flower consumers' tastes in various aspects, and it will help reduce the labor force of flower farms because it is possible to select and cultivate bellflowers of the desired color. However, since bellflower has the same phenotype except for the flower color, there is a problem that the actual flower color cannot be determined before flowering.

따라서 도라지 꽃의 색을 종자 및 생육 초기에 판별할 수 있는 분자표지의 개발이 필요하다.Therefore, it is necessary to develop a molecular marker that can discriminate the color of bellflower flowers in the early stages of seed and growth.

대한민국 등록특허 10-1912192호Republic of Korea Patent Registration No. 10-1912192

본 발명이 해결하고자 하는 과제는, 도라지 꽃색을 판별할 수 있는 프라이머 세트, 상기 프라이머 세트를 포함하는 키트 또는 조성물을 제공하는 것이다.The problem to be solved by the present invention is to provide a primer set capable of discriminating the color of a bellflower flower, and a kit or composition including the primer set.

본 발명이 해결하고자 하는 다른 과제는, 도라지 꽃색 판별방법을 제공하는 것이다.Another problem to be solved by the present invention is to provide a method for determining the color of a bellflower flower.

본 발명의 일실시예는 서열번호 1 및 2로 표시되는 도라지 꽃색 판별용 프라이머 세트이다.One embodiment of the present invention is a primer set for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2.

상기 도라지 꽃색 판별은 분홍색 꽃색을, 흰색 꽃색 또는 보라색 꽃색과 구분하는 것일 수 있다.The identification of the flower color of bellflower may be to distinguish a pink flower color from a white flower color or a purple flower color.

본 발명의 다른 실시예는 서열번호 1 및 2로 표시되는 도라지 꽃색 판별용 프라이머 세트를 포함하는 도라지 꽃색 판별용 키트이다.Another embodiment of the present invention is a kit for color discrimination of bellflower including a primer set for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2.

본 발명의 또 다른 실시예는 서열번호 1 및 2로 표시되는 도라지 꽃색 판별용 프라이머 세트를 포함하는 도라지 꽃색 판별용 조성물이다.Another embodiment of the present invention is a composition for discriminating a bellflower color comprising a primer set for discriminating the flower color of bellflower represented by SEQ ID NOs: 1 and 2.

본 발명의 또 다른 실시예는 (a) 도라지 시료에서 게놈 DNA를 분리하는 단계, (b) 상기 분리된 게놈 DNA를 주형으로 하고, 서열번호 1 및 2로 표시되는 프라이머 세트를 이용하여 증폭 반응을 수행하는 단계, 그리고 (c) 상기 (b) 단계의 증폭된 산물을 검출하는 단계를 포함하는 도라지 꽃색 판별 방법이다.Another embodiment of the present invention provides an amplification reaction using (a) isolating genomic DNA from a bellflower sample, (b) using the isolated genomic DNA as a template, and using the primer sets shown in SEQ ID NOs: 1 and 2 performing, and (c) detecting the amplified product of step (b).

상기 도라지 시료는 도라지의 종자, 뿌리, 잎, 줄기 및 꽃으로 이루어진 군에서 선택된 1종 이상의 조직일 수 있다.The bellflower sample may be at least one tissue selected from the group consisting of seeds, roots, leaves, stems, and flowers of bellflower.

본 발명의 프라이머 세트를 이용하여 꽃이 피기 전인 종자 또는 생육 초기에 도라지 꽃색을 판별하여 도라지 신품종 육종에 활용할 수 있다.By using the primer set of the present invention, it can be used for breeding new varieties of bellflower by discriminating the flower color of bellflower before the flower blooms or at the early stage of growth.

도 1은 본 발명에 따른 분자표지 MK3의 PCR 산물 전기영동 결과이고,
도 2는 본 발명에 따른 분자표지 MK3의 PCR 산물을 제한효소로 처리하고 전기영동한 결과이다.
1 is a PCR product electrophoresis result of molecular marker MK3 according to the present invention;
2 is a result of electrophoresis after treatment with a restriction enzyme PCR product of molecular marker MK3 according to the present invention.

이하, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 본 발명의 구체적인 실시예를 통하여 보다 상세하게 설명한다. 그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시예에 한정되지 않는다.Hereinafter, specific embodiments of the present invention will be described in detail so that those of ordinary skill in the art can easily carry out the present invention. However, the present invention may be embodied in several different forms and is not limited to the embodiments described herein.

본 발명의 일실시예는 서열번호 1 및 2로 표시되는 도라지 꽃색 판별용 프라이머 세트이다.One embodiment of the present invention is a primer set for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2.

본 명세서에 사용된 용어, "프라이머(primer)"는 자유 3' 말단에 수산화기(free 3' hydroxyl group)를 갖는 짧은 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고, 주형의 복사를 위한 시작 지점으로 기능하는 핵산 서열을 의미한다. 프라이머는 적절한 완충용액, 중합반응을 위한 시약, 상이한 4가지 뉴클레오티드 트리포스페이트(nucleotide triphosphate) 및 DNA 중합효소 또는 역전사효소의 존재 하에 적절한 온도에서 DNA 합성을 개시할 수 있다.As used herein, the term "primer" is a short nucleic acid sequence having a free 3' hydroxyl group at the free 3' end and can form a complementary template and base pair and , refers to a nucleic acid sequence serving as a starting point for copying a template. The primer can initiate DNA synthesis at an appropriate temperature in the presence of an appropriate buffer, a reagent for the polymerization reaction, four different nucleotide triphosphates and a DNA polymerase or reverse transcriptase.

본 발명에서 상기 프라이머 세트에 포함되는 프라이머는 올리고뉴클레오티드가 이용될 수 있고, 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질(intercalating agent)를 포함할 수 있다.In the present invention, an oligonucleotide may be used as the primer included in the primer set, and a nucleotide analogue, for example, phosphorothioate, alkyl phosphorothioate, or peptide nucleic acid ) or may contain an intercalating agent.

본 발명에서 상기 도라지 꽃색은 흰색, 보라색 또는 분홍색일 수 있다. 구체적으로는 분홍색 꽃색을, 흰색 꽃색 또는 보라색 꽃색과 구분하는 것이다.In the present invention, the flower color of the bellflower may be white, purple or pink. Specifically, it is to distinguish pink flower color from white flower color or purple flower color.

본 발명의 다른 실시예는 상기 프라이머 세트를 포함하는 도라지 꽃색 판별용 키트이다.Another embodiment of the present invention is a kit for color discrimination of bellflower including the primer set.

본 발명의 키트에서, 상기 프라이머 세트 이외에 상기 증폭반응을 수행하기 위한 시약을 포함할 수 있으며, 구체적으로 DNA 폴리머라제, dNTPs, 버퍼 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.In the kit of the present invention, in addition to the primer set, reagents for performing the amplification reaction may be included, and specifically, DNA polymerase, dNTPs, buffers, and the like may be included. In addition, the kit of the present invention may further include a user's guide describing optimal conditions for performing the reaction. A handbook is a printout explaining how to use the kit, eg, how to prepare a PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

또한 본 발명의 또 다른 실시예는 상기 프라이머 세트를 포함하는 도라지 꽃색 판별용 조성물이다.In addition, another embodiment of the present invention is a composition for color discrimination of bellflower including the primer set.

본 발명의 또 다른 실시예는 (a) 도라지 시료에서 게놈 DNA를 분리하는 단계, (b) 상기 분리된 게놈 DNA를 주형으로 하고, 서열번호 1 및 2로 표시되는 프라이머 세트를 이용하여 PCR 증폭 반응을 수행하는 단계, 그리고 (c) 상기 (b) 단계의 증폭된 산물을 검출하는 단계를 포함하는 도라지 꽃색 판별방법이다.Another embodiment of the present invention comprises the steps of (a) isolating genomic DNA from a bellflower sample, (b) using the isolated genomic DNA as a template, and PCR amplification reaction using the primer sets represented by SEQ ID NOs: 1 and 2 It is a method for discriminating the color of a bellflower comprising the step of performing, and (c) detecting the amplified product of step (b).

본 발명에서 상기 도라지 시료는 도라지의 종자, 뿌리, 잎, 줄기 및 꽃으로 이루어진 군에서 선택된 1종 이상의 조직일 수 있다.In the present invention, the bellflower sample may be one or more types of tissue selected from the group consisting of seeds, roots, leaves, stems and flowers of bellflower.

본 발명에서, 상기 단계 (a)는 도라지 시료에서 게놈 DNA를 분리하는 단계로 사용될 수 있는 시료의 예는 상기에서 설명한 바와 같으며, 이에 제한되는 것은 아니다. 도라지 시료에서 게놈 DNA를 분리하는 방법은 DNA 추출 키트를 사용할 수 있으며, 당업계에 공지된 방법을 당업자에 의해 용이하게 변형시켜 사용할 수 있다.In the present invention, examples of samples that can be used in step (a) of isolating genomic DNA from a bellflower sample are the same as described above, but are not limited thereto. A method of isolating genomic DNA from a bellflower sample may use a DNA extraction kit, and methods known in the art may be easily modified by those skilled in the art.

본 발명에서, 상기 단계 (b)는 분리된 DNA를 주형으로, 서열번호 1 및 2로 이루어진 프라이머 세트를 이용하여 표적서열을 증폭 시키는 것이다.In the present invention, the step (b) is to amplify the target sequence using the isolated DNA as a template and a primer set consisting of SEQ ID NOs: 1 and 2.

본 발명에서 표적서열을 증폭하는 방법은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chainreaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Q 복제효소(Q replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법을 사용할 수 있고, 당업계에 공지된 방법을 당업자에 의해 적절하게 변형하여 사용할 수 있다. 본 발명의 일실시예에서는 서열번호 1 및 2로 이루어진 프라이머 세트를 이용하여 중합효소연쇄반응을 통해 표적 서열을 증폭시켰다.Methods for amplifying the target sequence in the present invention include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. ), strand displacement amplification or amplification via Q replicase, or any other suitable method for amplifying nucleic acid molecules known in the art, and methods known in the art may be used. It can be appropriately modified and used by In an embodiment of the present invention, a target sequence was amplified through a polymerase chain reaction using a primer set consisting of SEQ ID NOs: 1 and 2.

본 발명에서 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있다. 증폭 산물을 검출하는 방법 중의 하나로서, 모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABi Sequencer를 이용할 수 있다. 또한, 겔 전기영동을 수행할 수 있으며, 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 가장 바람직하게는, 6% 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5, Cy-3 또는 6-FAM을 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행 시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.In the present invention, the detection of the amplification product may be performed through a DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement. As one of the methods for detecting the amplification product, capillary electrophoresis may be performed. Capillary electrophoresis may use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used for gel electrophoresis depending on the size of the amplification product. Most preferably, 6% acrylamide gel electrophoresis can be used. In addition, in the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the primer with Cy-5, Cy-3 or 6-FAM, the target sequence is labeled with a detectable fluorescent labeling material. can be measured using In addition, the radioactive measurement method includes adding a radioactive isotope such as 32 P or 35 S to the PCR reaction solution when performing PCR to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

이하, 본 발명에 따른 구체적인 실시예를 들어 설명한다.Hereinafter, specific examples according to the present invention will be described.

실시예 1 : 도라지의 꽃색 관련 변이지역 탐색Example 1: Exploration of flower color-related mutation regions of bellflower

흰색, 보라색, 분홍색의 꽃색을 가지는 도라지 식물체들의 전사체를 차세대염기서열분석(Next-generation sequencing, NGS) 기술을 이용하여 분석하였고, 이로부터 생산된 sequencing data를 장백 도라지 품종의 유전체 서열(포스트게놈 다부처유전체사업단 생산)에 mapping하였다. 이를 이용하여 꽃색 간의 변이를 탐색하였으며, 그 결과를 하기 표 1에 나타내었다.Transcripts of bellflower plants with white, purple, and pink flower colors were analyzed using next-generation sequencing (NGS) technology, and the sequencing data produced therefrom was analyzed with the genome sequence (post-genome) of the bellflower variety. Multi-ministerial Genome Project Group) was mapped. This was used to search for variations between flower colors, and the results are shown in Table 1 below.

마커정보
(Marker information)
Marker information
(Marker information)
변이주석
(Variant annotation)
mutation annotation
(Variant annotation)
SNPSNP 기능적 주석
(Functional annotation)
functional annotation
(Functional annotation)
SNPIDSNPID 변이 타입
(variant-
type)
mutation type
(variant-
type)
변이 효과
(Variant
effect)
mutation effect
(Variant
effect)
치환
(substitution)
substitution
(substitution)
지역
(region)
region
(region)
Num. SNP Num. SNP 상징
(symbol)
symbol
(symbol)
설명
(description)
Explanation
(description)
Scaffold144:153991Scaffold144:153991 missense_variantmissense_variant MODERATEMODERATE c.1127G>Ac.1127G>A PGJG021990.1PGJG021990.1 22 -- Uncharacterized proteinUncharacterized protein Scaffold180:177095Scaffold180:177095 synonymous_variantsynonymous_variant LOWLOW c.1101T>Ac.1101T>A PGJG026810.1PGJG026810.1 99 CDC48CCDC48C Cell division control protein 48 homolog CCell division control protein 48 homolog C Scaffold1316:87539Scaffold1316:87539 upstream_gene_variantupstream_gene_variant MODIFIERMODIFIER c.-211T>Ac.-211T>A PGJG150790.1PGJG150790.1 1313 DIVARICATADIVARICATA Transcription factor DIVARICATATranscription factor DIVARICATA Scaffold4328:246345Scaffold4328:246345 downstream_gene_variantdownstream_gene_variant MODIFIERMODIFIER c.*82G>Ac.*82G>A PGJG297010.1PGJG297010.1 1One CS1CS1 Chorismate synthase 1, chloroplasticChorismate synthase 1, chloroplastic Scaffold46:86514Scaffold46:86514 downstream_gene_variantdownstream_gene_variant MODIFIERMODIFIER c.*3107T>Ac.*3107T>A PGJG007890.1PGJG007890.1 22 -- -- Scaffold4733:14225Scaffold4733:14225 synonymous_variantsynonymous_variant LOWLOW c.1989G>Ac.1989G>A PGJG376590.2PGJG376590.2 2626 TRAPPC8TRAPPC8 Trafficking protein particle complex subunit 8Trafficking protein particle complex subunit 8 Scaffold765:76395Scaffold765:76395 synonymous_variantsynonymous_variant LOWLOW c.852A>Gc.852A>G PGJG097920.1PGJG097920.1 66 SWI3BSWI3B SWI/SNF complex subunit SWI3BSWI/SNF complex subunit SWI3B Scaffold765:78413Scaffold765:78413 missense_variantmissense_variant MODERATEMODERATE c.95A>Tc.95A>T PGJG097920.1PGJG097920.1 66 SWI3BSWI3B SWI/SNF complex subunit SWI3BSWI/SNF complex subunit SWI3B Scaffold1078:54988Scaffold1078:54988 synonymous_variantsynonymous_variant LOWLOW c.1539C>Tc.1539C>T PGJG129730.1PGJG129730.1 3939 BXL6BXL6 Probable beta-D-xylosidase 6Probable beta-D-xylosidase 6

상기 표 1을 살펴보면, 세 종류의 도라지 꽃색 간에 차이를 보이는 9개 변이 지역(single nucleotide polymorphism, SNP) 후보를 확인할 수 있다.Referring to Table 1 above, 9 single nucleotide polymorphism (SNP) candidates that show a difference between the flower colors of three types of bellflower can be identified.

실시예 2 : 도라지의 꽃색 판별용 분자표지 설계Example 2: Molecular label design for color discrimination of bellflower

상기 표 1의 9개 변이 지역의 앞뒤 500bp의 서열을 장백 도라지 품종의 유전체 서열로부터 추출하였고, 이를 기반으로 genomic DNA PCR용 프라이머 세트를 설계하였다. 이 프라이머 세트와 흰색, 보라색, 분홍색 꽃색의 도라지 표준 식물체 genomic DNA를 이용하여 PCR을 수행하였고 이후 증폭된 PCR 산물을 ABI Sanger sequencing을 수행하고 비교 분석함으로써 후보 변이 지역의 도라지 꽃색 구분용 분자표지로의 가능성을 확인하였다. 이후, 분자표지로써 가능성이 있는 변이지역을 대상으로 분자표지(CAPS, dCAPS)를 설계하였고, 이를 세 종류의 도라지 꽃색 표준 식물체 genomic DNA를 이용한 PCR를 통하여 검증하였다. The sequences of 500 bp before and after the 9 mutation regions in Table 1 were extracted from the genome sequence of the Changbaek bellflower variety, and based on this, a primer set for genomic DNA PCR was designed. PCR was performed using this primer set and standard plant genomic DNA of bellflower in white, purple, and pink color, and then ABI Sanger sequencing was performed and comparative analysis of the amplified PCR product was performed to obtain a molecular marker for identifying the color of bellflower in the candidate mutation region. possibility was confirmed. Thereafter, molecular markers (CAPS, dCAPS) were designed for mutation regions with potential as molecular markers, and these were verified through PCR using genomic DNA of three types of bellflower flower color standard plants.

이중, Derived Cleaved Amplified Polymorphic Sequence (dCAPS) 프라이머로 설계된 분자표지인 변이효과 MODIFIER 인 SNP ID (Scaffold1316:87539)에 기반한 분자표지(Marker ID MK3)를 선택하였다. 이 분자표지는 해당 변이지역에 특이적으로 존재하는 제한효소 자리를 이용하여 도라지 꽃색을 판별할 수 있도록 설계된 분자표지이며, 이를 하기 표 2에 나타내었다.Among them, a molecular marker (Marker ID MK3) based on SNP ID (Scaffold 1316:87539), which is a mutation effect MODIFIER, a molecular marker designed with Derived Cleaved Amplified Polymorphic Sequence (dCAPS) primers was selected. This molecular marker is a molecular marker designed to discriminate the color of a bellflower using the restriction enzyme site that is specifically present in the mutation region, and is shown in Table 2 below.

Marker IDMarker ID 정방향 프라이머
(Forward primer)
forward primer
(Forward primer)
역방향 프라이머
(Reverse primer)
reverse primer
(Reverse primer)
제한효소
(Restriction enzyme)
restriction enzyme
(Restriction enzyme)
타입
(Type)
type
(Type)
MK3MK3 TCACTCTATGGCCAACCAACCTCCATCACTCTATGGCCAACCAACCTCCA CCCAACTCCAGCTTCTTTCCTACCCAACTCCAGCTTCTTTCCTA NcoINcoI dCAPSdCAPS

실시예 3 : PCR 증폭Example 3: PCR amplification

흰색, 보라색, 분홍색의 꽃색을 가지는 도라지 표준 식물체 각 3개체의 잎으로부터 genomic DNA를 추출하고 분자표지 MK3의 프라이머 세트를 이용하여 genomic DNA PCR을 수행하였다. 구체적으로 도라지 genomic DNA를 주형으로 각 20ng씩 사용하였고, 1x PCR 버퍼, 0.2 mM dNTP, 1.25 units Taq DNA polymerase, 0.4 pmole 정방향 프라이머, 0.4 pmole 역방향 프라이머를 이용하여 증폭반응을 실시하였으며, PCR 조건은 하기 표 3에 기재하였다.Genomic DNA was extracted from the leaves of each three standard bellflower plants with white, purple, and pink flower colors, and genomic DNA PCR was performed using the molecular marker MK3 primer set. Specifically, each 20ng of bellflower genomic DNA was used as a template, and the amplification reaction was carried out using 1x PCR buffer, 0.2 mM dNTP, 1.25 units Taq DNA polymerase, 0.4 pmole forward primer, and 0.4 pmole reverse primer, and PCR conditions were as follows. Table 3 shows.

단계step 온도 및 시간temperature and time 비교compare 초기변성early metamorphosis 95℃, 5 분95℃, 5 minutes 변성denaturalization 95℃, 20 초95℃, 20 seconds 30회 반복30 reps 혼성화hybridization 60℃, 20 초60℃, 20 seconds 중합polymerization 72℃, 25 초72℃, 25 seconds 중합polymerization 72℃, 7 분72℃, 7 minutes

실시예 4 : 분자표지 검증Example 4: molecular label verification

실시예 3에서 증폭한 PCR 산물을 2.5% 아가로스겔(agarose gel)에서 100 volt 40분간 전기영동하고 safety gel stain 시약 (Inclone)으로 염색하고 UV illuminator 하에서 관찰함으써 PCR 증폭 결과를 확인하였으며, 이에 대한 결과를 도 1에 나타내었다.The PCR product amplified in Example 3 was electrophoresed on a 2.5% agarose gel at 100 volt for 40 minutes, stained with a safety gel stain reagent (Inclone), and observed under a UV illuminator to confirm the PCR amplification result. The results are shown in FIG. 1 .

도 1을 참조하면, 분자표지 MK3은 흰색, 보라색 및 분홍색의 꽃색을 가지는 도라지 표준 식물체 genomic DNA를 이용한 PCR 분석에서 모두 특이적인 단일 크기의 증폭산물(PCR product)을 생성한 것을 확인할 수 있다.Referring to FIG. 1 , it can be confirmed that the molecular marker MK3 produced a specific single-size amplification product (PCR product) in PCR analysis using genomic DNA of a bellflower standard plant having white, purple and pink flower colors.

실시예 5 : 제한효소 처리 후 분자표지 검증Example 5: Molecular label verification after restriction enzyme treatment

실시예 3의 분자표지 MK3 PCR 산물을 SNP 유래 제한효소 자리에 맞는 제한효소(~5 units)를 3시간 정도 처리하고 2.5% 아가로스겔(agarose gel)에서 100 volt 40분간 전기영동하고 safety gel stain 시약 (Inclone)으로 염색하고 UV illuminator 하에서 관찰함으로써 절단된 밴드(band) 크기 차이를 확인하였으며, 이에 대한 결과를 도 2에 나타내었다.The molecularly labeled MK3 PCR product of Example 3 was treated with a restriction enzyme (~5 units) matching the SNP-derived restriction enzyme site for about 3 hours, electrophoresed in 2.5% agarose gel at 100 volt for 40 minutes, and safety gel stain The difference in the size of the cut band was confirmed by staining with a reagent (Inclone) and observing under a UV illuminator, and the results are shown in FIG. 2 .

도 2를 참조하면, 꽃색간에 서로 다른 크기의 DNA 단편을 생성하므로, 분홍색 꽃색을 다른 꽃색(흰색, 보라색)과 구분할 수 있음을 확인할 수 있다.Referring to FIG. 2 , since DNA fragments of different sizes are generated between flower colors, it can be confirmed that a pink flower color can be distinguished from other flower colors (white, purple).

이와 같이 본 발명인 서열번호 1 및 2로 이루어진 프라이머 쌍을 포함하는, 도라지 꽃색 판별용 프라이머 세트를 사용하면 도라지의 꽃이 피기 전에 도라지 꽃의 색을 판별할 수 있다.As described above, by using the primer set for color discrimination of bellflower, including the primer pair consisting of SEQ ID NOs: 1 and 2 of the present invention, it is possible to determine the color of bellflower before the flower of bellflower blooms.

이상으로 본 발명의 바람직한 실시예를 상세하게 설명하였다. 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다.The preferred embodiment of the present invention has been described in detail above. The description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains will understand that other specific forms can be easily modified without changing the technical spirit or essential features of the present invention.

따라서, 본 발명의 범위는 상세한 설명보다는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미, 범위 및 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.Therefore, the scope of the present invention is indicated by the claims to be described later rather than the detailed description, and all changes or modifications derived from the meaning, scope, and equivalent concept of the claims are interpreted as being included in the scope of the present invention. should be

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus <130> DP20200344 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MK3 forward primer <400> 1 tcactctatg gccaaccaac ctcca 25 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MK3 reverse primer <400> 2 cccaactcca gcttctttcc ta 22 <110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus <130> DP20200344 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MK3 forward primer <400> 1 tcactctatg gccaaccaac ctcca 25 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MK3 reverse primer <400> 2 cccaactcca gcttctttcc ta 22

Claims (6)

삭제delete 삭제delete 서열번호 1 및 2로 표시되는 도라지 꽃색 판별용 프라이머 세트 및 NcoI 제한효소를 포함하고,
상기 도라지 꽃색 판별은 분홍색 꽃색을 흰색 꽃색 또는 보라색 꽃색과 구분하는 것을 특징으로 하는 도라지 꽃색 판별용 키트.
Includes a primer set and NcoI restriction enzyme for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2,
The flower color discrimination kit for bellflower flower color is characterized in that the pink flower color is distinguished from a white flower color or a purple flower color.
서열번호 1 및 2로 표시되는 도라지 꽃색 판별용 프라이머 세트 및 NcoI 제한효소를 포함하고,
상기 도라지 꽃색 판별은 분홍색 꽃색을 흰색 꽃색 또는 보라색 꽃색과 구분하는 것을 특징으로 하는 도라지 꽃색 판별용 조성물.
Includes a primer set and NcoI restriction enzyme for color discrimination of bellflower represented by SEQ ID NOs: 1 and 2,
The bellflower flower color discrimination composition for color discrimination of bellflower, characterized in that the pink flower color is distinguished from a white flower color or a purple flower color.
(a) 도라지 시료에서 게놈 DNA를 분리하는 단계;
(b) 상기 분리된 게놈 DNA를 주형으로 하고, 서열번호 1 및 2로 표시되는 프라이머 세트를 이용하여 PCR 증폭 반응을 수행하고, 상기 증폭 반응의 산물을 NcoI 제한효소로 절단하는 단계; 및
(c) 상기 (b) 단계의 절단산물을 검출하는 단계;를 포함하는 도라지 꽃색 판별방법로서,
상기 도라지 꽃색 판별은 분홍색 꽃색을 흰색 꽃색 또는 보라색 꽃색과 구분하는 것을 특징으로 하는, 도라지 꽃색 판별방법.
(a) isolating genomic DNA from the bellflower sample;
(b) using the isolated genomic DNA as a template, performing a PCR amplification reaction using the primer sets shown in SEQ ID NOs: 1 and 2, and cleaving the product of the amplification reaction with an NcoI restriction enzyme; and
(c) detecting the cleavage product of step (b);
The bellflower flower color discrimination method, characterized in that the pink flower color is distinguished from the white flower color or the purple flower color.
제5항에 있어서,
상기 도라지 시료는 도라지의 종자, 뿌리, 잎, 줄기 및 꽃으로 이루어진 군에서 선택된 1종 이상의 조직인 것을 특징으로 하는 도라지 꽃색 판별방법.
6. The method of claim 5,
The bellflower sample is a bellflower flower color discrimination method, characterized in that at least one tissue selected from the group consisting of seeds, roots, leaves, stems and flowers of bellflower.
KR1020200175685A 2020-12-15 2020-12-15 Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus KR102412901B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200175685A KR102412901B1 (en) 2020-12-15 2020-12-15 Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200175685A KR102412901B1 (en) 2020-12-15 2020-12-15 Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus

Publications (2)

Publication Number Publication Date
KR20220085535A KR20220085535A (en) 2022-06-22
KR102412901B1 true KR102412901B1 (en) 2022-06-28

Family

ID=82216224

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200175685A KR102412901B1 (en) 2020-12-15 2020-12-15 Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus

Country Status (1)

Country Link
KR (1) KR102412901B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102320249B1 (en) 2020-06-17 2021-11-02 대한민국 Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150106125A (en) * 2014-03-11 2015-09-21 안동대학교 산학협력단 Primer set for classifing balloon flower using the difference of actin gene at the genomic DNA level, Classification method for balloon flower using the same, and Classification kit for balloon flower using the same
KR101912192B1 (en) 2017-10-13 2018-10-26 충북대학교 산학협력단 Molecular marker and primer set for discriminating Platycodon grandiflorum cultivar and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102320249B1 (en) 2020-06-17 2021-11-02 대한민국 Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Chun Geon Park et al., Korean J. Medicinal Crop. Sci., 15(1), p.1-5, 2007.
Yurry Um et al., Korean J. Medicinal Crop. Sci., 24(1), p.55-61, 2016.

Also Published As

Publication number Publication date
KR20220085535A (en) 2022-06-22

Similar Documents

Publication Publication Date Title
KR102320249B1 (en) Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus
KR101912192B1 (en) Molecular marker and primer set for discriminating Platycodon grandiflorum cultivar and uses thereof
KR20140039866A (en) Ssr primer sets for discrimination of oriental melon line or cultivar and uses thereof
KR102009712B1 (en) Primer set for discriminating Zizyphus jujuba &#39;Bokjo&#39; cultivar and uses thereof
KR102010279B1 (en) Molecular marker for discriminating Codonopsis lanceolata among genus Codonopsis and uses thereof
KR101912933B1 (en) Molecular marker and primer set for discriminating Codonopsis lanceolata and Adenophora triphylla and uses thereof
KR102412901B1 (en) Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus
KR102412898B1 (en) Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus
KR102412903B1 (en) Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus
KR102412899B1 (en) Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus
KR102332689B1 (en) Molecular marker based on mitochondrial genome sequence for discriminating Panax ginseng &#39;GeumJin&#39; and &#39;SeonHyang&#39; cultivar and uses thereof
KR102332688B1 (en) Molecular marker based on nuclear genome sequence for discriminating Panax ginseng &#39;SeonHyang&#39; cultivar and uses thereof
KR102654961B1 (en) Marker composition for identification of cucurbita spp. and identification method using the same
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
KR102335806B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba &#39;SanJo&#39; cultivar and uses thereof
KR102207825B1 (en) Composition for discrimination of Cynanchum wilfordii and Cynanchum auriculatum and method for use thereof
KR102296889B1 (en) Molecular marker for selecting Gray leaf spot resistant or susceptible tomato cultivar and selection method using the same molecular marker
KR101745071B1 (en) SNP marker for discriminating resistance to leaf mold and use thereof
KR102174274B1 (en) Molecular marker for discriminating Zizyphus jujuba &#39;Boeun&#39; and &#39;Chuseok&#39; cultivar and uses thereof
KR102174019B1 (en) Molecular marker based on chloroplast sequence for discriminating Codonopsis lanceolata and Codonopsis pilosula and uses thereof
KR102586234B1 (en) Primer set for ripening peaches and classification method using the same
KR102429948B1 (en) Method for identification of Acer tegmentosum genotypes using microsatellite markers
KR102185435B1 (en) Composition for discrimination of Cynanchum wilfordii and Cynanchum auriculatum and method for use thereof
KR102309663B1 (en) Fluidigm based SNP chip for genotype-identifying and classifying Panax ginseng cultivar or resource and uses thereof
KR102613521B1 (en) Molecular marker for discriminating Sinano Gold apple and its bud mutation cultivar and use thereof

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant