KR102586234B1 - Primer set for ripening peaches and classification method using the same - Google Patents

Primer set for ripening peaches and classification method using the same Download PDF

Info

Publication number
KR102586234B1
KR102586234B1 KR1020210077342A KR20210077342A KR102586234B1 KR 102586234 B1 KR102586234 B1 KR 102586234B1 KR 1020210077342 A KR1020210077342 A KR 1020210077342A KR 20210077342 A KR20210077342 A KR 20210077342A KR 102586234 B1 KR102586234 B1 KR 102586234B1
Authority
KR
South Korea
Prior art keywords
primer set
ripeness
ripening
peach
distinguishing
Prior art date
Application number
KR1020210077342A
Other languages
Korean (ko)
Other versions
KR20220167954A (en
Inventor
김정선
구윤숙
원소윤
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020210077342A priority Critical patent/KR102586234B1/en
Publication of KR20220167954A publication Critical patent/KR20220167954A/en
Application granted granted Critical
Publication of KR102586234B1 publication Critical patent/KR102586234B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

만숙종과 조숙종 복숭아를 구분할 수 있는 프라이머 세트가 개시된다. 본 발명은 복숭아 숙기 구분용 프라이머 세트, 이를 포함하는 키트 및 조성물 그리고 복숭아 숙기 구분방법에 관한 것이다.A primer set that can distinguish between late-ripening and early-ripening peaches is disclosed. The present invention relates to a primer set for distinguishing ripeness of peaches, a kit and composition containing the same, and a method for distinguishing ripeness of peaches.

Description

복숭아 숙기 구분용 프라이머 세트 및 이를 이용한 구분방법{Primer set for ripening peaches and classification method using the same}Primer set for ripening peaches and classification method using the same {Primer set for ripening peaches and classification method using the same}

본 발명은 복숭아 숙기 구분용 프라이머 세트, 이를 포함하는 키트, 조성물 및 복숭아 숙기 구분방법에 관한 것이다.The present invention relates to a primer set for distinguishing ripeness of peaches, a kit containing the same, a composition, and a method for distinguishing ripeness of peaches.

복숭아(Prunus Persica)는 장미과(Rosaceae) 자두속(Prunus) 복숭아아속(Amygdalus)에 속하는 온대 낙엽성 과수로서 사과나무나 배나무보다 유전적 변이가 적고 조기 결실 및 자가 수정이 가능하여 많은 유전 양식이 보고 되었다.Peach ( Prunus Persica ) is a temperate deciduous fruit tree belonging to the Prunus subgenus ( Amygdalus ) of the Rosaceae family. It has less genetic variation than apple or pear trees and is capable of early fruiting and self-fertilization, so many genetic patterns have been reported. It has been done.

복숭아는 과일의 익은 정도인 숙기에 따라 다양한 출하 시기를 가지는데 조숙종들은 대부분 너무 쉽게 물러져서 부가가치는 높으나 유통기간이 매우 짧고, 과수는 육성 소요 시간이 매우 긴 문제점이 있다. Peaches have various shipping times depending on the ripeness of the fruit, but most early-ripening varieties become brittle too easily, so although their added value is high, the distribution period is very short, and fruit trees have the problem of having a very long cultivation time.

따라서, 육성 초기에 복숭아 숙기를 구분할 수 있는 분자 표지의 개발이 필요한 실정이다Therefore, there is a need to develop molecular markers that can distinguish peach ripeness in the early stages of cultivation.

대한민국 등록특허 10-2192666호Republic of Korea Patent No. 10-2192666

본 발명이 해결하고자 하는 과제는, 복숭아 숙기를 구분할 수 있는 프라이머 세트, 상기 프라이머 세트를 포함하는 키트 또는 조성물을 제공하는 것이다.The problem to be solved by the present invention is to provide a primer set that can distinguish the ripeness of peaches, and a kit or composition containing the primer set.

본 발명이 해결하고자 하는 다른 과제는, 복숭아 숙기를 구분방법을 제공하는 것이다.Another problem that the present invention seeks to solve is to provide a method for distinguishing the ripeness of peaches.

본 발명의 일 실시예는 서열번호 1 및 2로 표시되는 제1 프라이머 세트;서열번호 3 및 4로 표시되는 제2 프라이머 세트; 및 서열번호 5 및 6으로 표시되는 제3 프라이머 세트;로 이루어진 군에서 선택된, 복숭아 숙기 구분용 프라이머 세트이다.One embodiment of the present invention includes: a first primer set represented by SEQ ID NOs: 1 and 2; a second primer set represented by SEQ ID NOs: 3 and 4; And a third primer set represented by SEQ ID NOs: 5 and 6; It is a primer set for distinguishing ripeness of peach, selected from the group consisting of.

상기 프라이머 세트는 단순 반복 염기 서열(Simple sequence repeat; SSR) 마커 증폭용 프라이머 세트일 수 있다.The primer set may be a primer set for amplifying a simple sequence repeat (SSR) marker.

상기 복숭아 숙기 구분은 만숙종과 조숙종을 구분할 수 있다.The ripeness of peaches can be divided into late-ripening and early-ripening varieties.

상기 만숙종은 120일 내지 130일의 복숭아일 수 있고, 상기 조숙종은 110일 이전의 복숭아일 수 있다.The late-ripening species may be peaches aged 120 to 130 days, and the early-ripening species may be peaches aged before 110 days.

상기 만숙종은 유명 또는 수미 품종이고, 상기 조숙종은 미홍, 유미, 찌요마루 및 미스홍 품종으로 이루어진 군에서 선택되는 1종 이상일 수 있다.The late-ripening species may be famous or Sumi varieties, and the early-ripening species may be one or more species selected from the group consisting of Mihong, Yumi, Chiyomaru, and Mishong varieties.

본 발명의 다른 실시예는 상기 프라이머 세트를 포함하는 복숭아 숙기 구분용 키트이다.Another embodiment of the present invention is a kit for distinguishing ripeness of peaches including the above primer set.

본 발명의 또 다른 실시예는 상기 프라이머 세트를 포함하는 복숭아 숙기 구분용 조성물이다.Another embodiment of the present invention is a composition for distinguishing ripeness of peaches including the primer set.

본 발명의 또 다른 실시예는 (a) 복숭아 시료에서 게놈 DNA를 분리하는 단계; (b) 상기 분리된 게놈 DNA를 주형으로 하고, 서열번호 1 및 2로 표시되는 제1 프라이머 세트; 서열번호 3 및 4로 표시되는 제2 프라이머 세트; 및 서열번호 5 및 6으로 표시되는 제3 프라이머 세트;로 이루어진 군에서 선택된 프라이머 세트를 이용하여 PCR 증폭 반응을 수행하는 단계; 및 (c) 상기 (b) 단계의 증폭된 산물을 검출하는 단계를 포함하는 복숭아 숙기 구분방법이다.Another embodiment of the present invention includes the steps of (a) isolating genomic DNA from a peach sample; (b) a first primer set using the isolated genomic DNA as a template and represented by SEQ ID NOs: 1 and 2; a second primer set represented by SEQ ID NOs: 3 and 4; and a third primer set represented by SEQ ID NOs: 5 and 6; performing a PCR amplification reaction using a primer set selected from the group consisting of; and (c) detecting the amplified product of step (b).

상기 PCR 증폭 반응을 수행하는 단계는 단순 반복 염기 서열(Simple sequence repeat; SSR) 마커를 증폭하기 위한 것일 수 있다.The step of performing the PCR amplification reaction may be to amplify a simple sequence repeat (SSR) marker.

본 발명의 프라이머 세트를 이용하여 과수 품종 초기에 숙기를 구분하여 복숭아 품종 형질들을 다양하게 선발할 수 있다.Using the primer set of the present invention, it is possible to select a variety of peach variety traits by distinguishing the ripeness stage at the beginning of the fruit tree variety.

도 1은 본 발명에 따른 분자표지 #150, #228 및 #246의 PCR 산물 전기영동 결과이다.Figure 1 shows the electrophoresis results of PCR products of molecular markers #150, #228, and #246 according to the present invention.

이하, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 본 발명의 구체적인 실시예를 통하여 보다 상세하게 설명한다. 그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시예에 한정되지 않는다.Hereinafter, the present invention will be described in more detail through specific embodiments so that those skilled in the art can easily implement it. However, the present invention may be implemented in many different forms and is not limited to the embodiments described herein.

본 발명의 일 실시예는 서열번호 1 및 2로 표시되는 제1 프라이머 세트; 서열번호 3 및 4로 표시되는 제2 프라이머 세트; 및 서열번호 5 및 6으로 표시되는 제3 프라이머 세트;로 이루어진 군에서 선택된 프라이머 세트인, 복숭아 숙기 구분용 프라이머 세트이다. One embodiment of the present invention includes a first primer set represented by SEQ ID NOs: 1 and 2; a second primer set represented by SEQ ID NOs: 3 and 4; And a third primer set represented by SEQ ID NOs: 5 and 6; It is a primer set for distinguishing peach ripeness, which is a primer set selected from the group consisting of.

본 명세서에 사용된 용어, "프라이머(primer)"는 자유 3' 말단에 수산화기(free 3' hydroxyl group)를 갖는 짧은 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고, 주형의 복사를 위한 시작 지점으로 기능하는 핵산 서열을 의미한다. 프라이머는 적절한 완충용액, 중합반응을 위한 시약, 상이한 4가지 뉴클레오티드 트리포스페이트(nucleotide triphosphate) 및 DNA 중합효소 또는 역전사효소의 존재 하에 적절한 온도에서 DNA 합성을 개시할 수 있다.As used herein, the term "primer" refers to a short nucleic acid sequence having a free 3' hydroxyl group at the free 3' end, which can form a base pair with a complementary template. , refers to a nucleic acid sequence that serves as a starting point for copying a template. Primers can initiate DNA synthesis at an appropriate temperature in the presence of an appropriate buffer solution, reagents for polymerization reaction, four different nucleotide triphosphates, and DNA polymerase or reverse transcriptase.

본 발명에서 상기 프라이머 세트에 포함되는 프라이머는 올리고뉴클레오티드가 이용될 수 있고, 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질(intercalating agent)를 포함할 수 있다.In the present invention, the primer included in the primer set may be an oligonucleotide, and may also be a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid. ) or may include an intercalating agent.

본 발명에서 상기 프라이머 세트는 단순 반복 염기 서열(Simple sequence repeat; SSR) 마커 증폭용 프라이머 세트일 수 있다.In the present invention, the primer set may be a primer set for amplifying a simple sequence repeat (SSR) marker.

본 명세서에 사용된 용어 “마커(marker)”는 유전적으로 불특정 연관된 유전자좌를 동정할 때 참고점으로 사용되는 염기서열을 말한다. 상기 작물의 재배 환경이나 성장 시기에 영향을 받지 않고 신속하게 품종을 구별할 수 있으므로 유용하게 사용될 수 있다. 분자 마커는 유전현상의 본질인 DNA의 염기서열 차이를 대상으로 개체간 다형성(polymorphism)을 나타내는 방법으로, 주로 단순 반복 염기 서열(Simple sequence repeat; SSR)이나 유전자 염기 서열을 이용한 마커 또는 RFLP(Restriction Fragment Length Polymorphism) 프로브나 SCAR(Sequence Characterised Amplified Region) 마커가 이용되고 있다. PCR 기반 DNA 마커들 중 하나인 microsatellites는 SSR (Simple Sequence Repeat), STR (Short Tandem Repeat) 등으로 표현되기도 한다. microsatellites는 유전체 상에서 1-6 bp의 짧은 배열이 반복되어 나타나는 염기서열로, 유전체 상에 광범위하게 산재하여 다수의 유전자좌 분석에 활용할 수 있다.As used herein, the term “marker” refers to a base sequence used as a reference point when identifying genetically unspecified related loci. It can be useful because it can quickly distinguish between varieties without being affected by the cultivation environment or growth period of the crop. Molecular markers are a method of indicating polymorphism between individuals by targeting differences in the base sequence of DNA, which is the essence of genetic phenomena. They are mainly markers using simple sequence repeats (SSR) or genetic base sequences, or RFLP (Restriction Markers). Fragment Length Polymorphism (Fragment Length Polymorphism) probes and SCAR (Sequence Characterized Amplified Region) markers are used. Microsatellites, one of the PCR-based DNA markers, are also expressed as SSR (Simple Sequence Repeat), STR (Short Tandem Repeat), etc. Microsatellites are short sequences of 1-6 bp that appear repeatedly on the genome. They are widely scattered across the genome and can be used for analysis of multiple loci.

본 발명에서 복숭아 숙기 구분은 만숙종과 조숙종을 구분하는 것이며, 구체적으로, 상기 만숙종은 120일 내지 130일의 복숭아일 수 있고, 상기 조숙종은 110일 이전의 복숭아일 수 있다. In the present invention, peach ripeness is distinguished between late-ripening and early-ripening species. Specifically, the late-ripening species may be peaches that are 120 to 130 days old, and the early-ripening species may be peaches that are older than 110 days.

본 발명에서 상기 만숙종은 유명 또는 수미 품종이고, 상기 조숙종은 미홍, 유미, 찌요마루 및 미스홍 품종으로 이루어진 군에서 선택되는 1종 이상일 수 있다.In the present invention, the late-ripening species is a famous or Sumi variety, and the early-ripening species may be one or more species selected from the group consisting of Mihong, Yumi, Chiyomaru, and Misshong varieties.

본 발명의 다른 실시예는 상기 프라이머 세트를 포함하는 복숭아 숙기 구분용 키트이다.Another embodiment of the present invention is a kit for distinguishing ripeness of peaches including the above primer set.

본 발명의 키트에서, 상기 프라이머 세트 이외에 상기 증폭반응을 수행하기 위한 시약을 포함할 수 있으며, 구체적으로 DNA 폴리머라제, dNTPs, 버퍼 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.In the kit of the present invention, in addition to the primer set, reagents for performing the amplification reaction may be included, and may specifically include DNA polymerase, dNTPs, buffer, etc. In addition, the kit of the present invention may additionally include a user guide describing optimal reaction performance conditions. The guide is a printed material that explains how to use the kit, for example, how to prepare PCR buffer, and the suggested reaction conditions. Instructions include information leaflets in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.

또한 본 발명의 또 다른 실시예는 상기 프라이머 세트를 포함하는 복숭아 숙기 구분용 조성물이다.In addition, another embodiment of the present invention is a composition for distinguishing ripeness of peaches including the primer set.

본 발명의 또 다른 실시예는 (a) 복숭아 시료에서 게놈 DNA를 분리하는 단계; (b) 상기 분리된 게놈 DNA를 주형으로 하고, 서열번호 1 및 2로 표시되는 제1 프라이머 세트; 서열번호 3 및 4로 표시되는 제2 프라이머 세트; 및 서열번호 5 및 6으로 표시되는 제3 프라이머 세트;로 이루어진 군에서 선택된 프라이머 세트를 이용하여 PCR 증폭 반응을 수행하는 단계; 및 (c) 상기 (b) 단계의 증폭된 산물을 검출하는 단계를 포함하는 복숭아 숙기 구분방법이다.Another embodiment of the present invention includes the steps of (a) isolating genomic DNA from a peach sample; (b) a first primer set using the isolated genomic DNA as a template and represented by SEQ ID NOs: 1 and 2; a second primer set represented by SEQ ID NOs: 3 and 4; and a third primer set represented by SEQ ID NOs: 5 and 6; performing a PCR amplification reaction using a primer set selected from the group consisting of; and (c) detecting the amplified product of step (b).

본 발명에서 상기 복숭아 시료는 복숭아의 종자, 뿌리, 잎, 줄기 및 열매로 이루어진 군에서 선택된 1종 이상의 조직일 수 있다.In the present invention, the peach sample may be one or more types of tissue selected from the group consisting of peach seeds, roots, leaves, stems, and fruits.

본 발명에서, 상기 단계 (a)는 복숭아 시료에서 게놈 DNA를 분리하는 단계로 사용될 수 있는 시료의 예는 상기에서 설명한 바와 같으며, 이에 제한되는 것은 아니다. 복숭아 시료에서 게놈 DNA를 분리하는 방법은 DNA 추출 키트를 사용할 수 있으며, 당업계에 공지된 방법을 당업자에 의해 용이하게 변형시켜 사용할 수 있다.In the present invention, step (a) is a step of isolating genomic DNA from a peach sample, and examples of samples that can be used are as described above, but are not limited thereto. A method of isolating genomic DNA from a peach sample can use a DNA extraction kit, and methods known in the art can be easily modified and used by those skilled in the art.

본 발명에서, 상기 단계 (b)는 분리된 DNA를 주형으로, 서열번호 1 및 2로 표시되는 제1 프라이머 세트; 서열번호 3 및 4로 표시되는 제2 프라이머 세트; 및 서열번호 5 및 6으로 표시되는 제3 프라이머 세트;로 이루어진 군에서 선택된 프라이머 세트를 이용하여 표적서열을 증폭 시키는 것이다.In the present invention, step (b) uses the isolated DNA as a template, and uses a first primer set represented by SEQ ID NOs: 1 and 2; a second primer set represented by SEQ ID NOs: 3 and 4; and a third primer set represented by SEQ ID NOs: 5 and 6. The target sequence is amplified using a primer set selected from the group consisting of.

본 발명에서 표적서열을 증폭하는 방법은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chainreaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Q 복제효소(Q replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법을 사용할 수 있고, 당업계에 공지된 방법을 당업자에 의해 적절하게 변형하여 사용할 수 있다. 본 발명의 일실시예에서는 서열번호 1 및 2로 이루어진 프라이머 세트를 이용하여 중합효소연쇄반응을 통해 표적 서열을 증폭시켰다.Methods for amplifying the target sequence in the present invention include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. ), strand displacement amplification, or amplification via Q replicase, or any other suitable method for amplifying nucleic acid molecules known in the art, may be used, and methods known in the art may be used by those skilled in the art. It can be used by modifying it appropriately. In one embodiment of the present invention, the target sequence was amplified through polymerase chain reaction using a primer set consisting of SEQ ID NOs: 1 and 2.

본 발명에서 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있다. 증폭 산물을 검출하는 방법 중의 하나로서, 모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABi Sequencer를 이용할 수 있다. 또한, 겔 전기영동을 수행할 수 있으며, 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 가장 바람직하게는, 6% 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5, Cy-3 또는 6-FAM을 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행 시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.Detection of amplification products in the present invention can be performed through DNA chips, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can be performed using, for example, the ABi Sequencer. Additionally, gel electrophoresis can be performed, and gel electrophoresis can use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Most preferably, 6% acrylamide gel electrophoresis can be used. In addition, the fluorescence measurement method is to perform PCR by labeling the 5'-end of the primer with Cy-5, Cy-3, or 6-FAM, and the target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured by a fluorometer. It can be measured using . In addition, the radioactivity measurement method involves adding a radioisotope such as 32 P or 35 S to the PCR reaction solution to label the amplification product when performing PCR, and then using a radioactivity measurement device, such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

이하, 본 발명에 따른 구체적인 실시예를 들어 설명한다.Hereinafter, specific embodiments according to the present invention will be described.

실시예 1 : 식물 Genomic DNA 추출Example 1: Plant Genomic DNA Extraction

원예원에서 개발한 '유명'(만숙종, 128일) 복숭아를 모본으로, 일본에서 개발한 '찌요마루'(조숙종, 76일)를 부본으로 교잡한 품종들 '미홍'(조숙종, 76일), '유미'(조숙종, 82일), '미스홍'(조숙종, 109일) 및 '수미'(만숙종, 128일) 6종에 대하여, 꽃이 핀 후 20일 후의 어린잎을 채취하여 genomic DNA를 추출하였다. 액체질소를 이용하여 조직을 마쇄한 후, DNeasy Plant Mini Kit (Qiagen, Germany)의 매뉴얼에 따라 genomic DNA를 추출하였다. 'Yumyeong' (early maturing variety, 128 days) peach developed in a horticultural garden is the model, and 'Mihong' (early maturing variety, 76 days) is a hybrid of 'Chiyomaru' (early maturing variety, 76 days) developed in Japan. For six species of 'Yumi' (early maturing variety, 82 days), 'Miss Hong' (early maturing variety, 109 days) and 'Sumi' (late maturing variety, 128 days), young leaves were collected 20 days after flowering and genomic DNA was collected. Extracted. After triturating the tissue using liquid nitrogen, genomic DNA was extracted according to the manual of the DNeasy Plant Mini Kit (Qiagen, Germany).

추출된 DNA는 1% agarose gel에서 전기영동하여 DNA를 확인하였고, Nanodrop 1000 Spectrophotometer(Thermo Scientific, USA)를 이용하여 농도 및 순도를 확인하였으며, 확인된 DNA들을 1㎕당 4ng의 농도로 희석하여 4㎕를 PCR 분석에 이용하였다.The extracted DNA was confirmed by electrophoresis on a 1% agarose gel, and the concentration and purity were confirmed using a Nanodrop 1000 Spectrophotometer (Thermo Scientific, USA). The confirmed DNA was diluted to a concentration of 4 ng per ㎕ and ㎕ was used for PCR analysis.

실시예 2 : 레퍼런스 '미홍' SSR 프라이머 선발과 다형성 예측 SSR 프라이머 선발Example 2: Reference ‘Mihong’ SSR primer selection and polymorphism prediction SSR primer selection

'미홍' 복숭아 241.05Mb조립 시퀀스, 200개 스캐폴드 서열로부터, 단순반복염기서열이 두 개에서 10개 모티프를 가지는 78,209개 SSRs을 탐색하였다. 탐색된 SSRs 기반으로 양쪽말단 300bp씩 부착한 서열들을 추출하였다. From the 'Mihong' peach 241.05Mb assembly sequence and 200 scaffold sequences, 78,209 SSRs with simple repetitive sequences containing two to ten motifs were searched. Based on the discovered SSRs, sequences with 300 bp attached to both ends were extracted.

Primer3 프로그램(version3-2.2.3)을 사용하여 SSRs반복서열이 포함된 증폭산물의 크기가 150~200bp 사이에서 나올 수 있도록 프라이머를 설계하였다. '미홍' 복숭아 서열 기반 20,313개 프라이머쌍이 설계되었고, 이를 하기 표 1에 나타내었다. 프라이머쌍의 최종 선발은 스캐폴드별로 300Kb에서 1Mb 이상 물리적 거리를 가진 마커들을 선발하였고, 총 260쌍의 프라이머를 선발하였다Using the Primer3 program (version3-2.2.3), primers were designed so that the size of the amplification product containing the SSRs repeat sequence would be between 150 and 200 bp. 20,313 primer pairs were designed based on the 'Mihong' peach sequence, and are shown in Table 1 below. For the final selection of primer pairs, markers with a physical distance of 300 Kb to 1 Mb or more were selected for each scaffold, and a total of 260 primer pairs were selected.

Repeat-typeRepeat-type SSR primer pairsSSR primer pairs Polymorphic SSR primer pairs in four cultivarsPolymorphic SSR primer pairs in four cultivars Selected Polymorphic SSR primer pairs in four cultivarsSelected Polymorphic SSR primer pairs in four cultivars Di-nucloetideDi-nucloetide 16,557 16,557 2,2212,221 239239 Tri-nucloetideTri-nucloetide 3,060 3,060 141141 1212 Tetra-nucloetideTetra-nucloetide 451 451 3232 1One penta-nucloetidepenta-nucloetide 110 110 99 00 hexa-nucloetidehexa-nucloetide 96 96 1818 44 Hepta-nucloetideHepta-nucloetide 20 20 44 22 Octa-nucloetideOcta-nucloetide 15 15 44 22 Ennea-nucloetideEnnea-nucloetide 4 4 1One 00 Deca-nucloetideDeca-nucloetide 00 00 00 totaltotal 20,313 20,313 2,4302,430 260260

실시예 3 : 복숭아 SSR 프라이머 활용한 PCR 분석Example 3: PCR analysis using peach SSR primers

PCR 분석은 16ng genomic DNA와 10pmol/㎕의 양방향 프라이머와 멸군수로 10㎕를 맞추고, 2배 농도의 TOPsimpleTMDyeMIX-nTaq(Taq DNA polymerase 0.2 U, dNTPs 0.4 mM, MgCl2 3 mM; Enzynomics, Daejeon, Korea)을 10㎕ 넣은 조성액을, 반복 없이, 94℃에서 5분 동안 pre-denaturation을 수행한 뒤, 94℃에서 30초, 60℃에서 30초, 72℃에서 1분의 조건을 30회 반복하는 조건으로 수행하였고, 이에 대한 결과를 도 1 내지 3에 나타내었다.For PCR analysis, 16 ng genomic DNA, 10 pmol/㎕ bidirectional primer, and 10 ㎕ were mixed with steril water, and 2 times the concentration of TOPsimple TM DyeMIX- n Taq (Taq DNA polymerase 0.2 U, dNTPs 0.4 mM, MgCl 2 3 mM; Enzynomics, The composition solution containing 10㎕ of Daejeon, Korea) was pre-denatured at 94°C for 5 minutes without repetition, and then subjected to conditions of 30 seconds at 94°C, 30 seconds at 60°C, and 1 minute at 72°C 30 times. It was performed under repeated conditions, and the results are shown in Figures 1 to 3.

일부 primer의 경우 TM 값에 따라 온도를 조정하였다. PCR 산물은 2.5~3% agarose gel을 만든 후, 1× TAE (Tris-Acetate EDTA) buffer내에서 80V에 3시간 동안 전기영동 하여 양친과 분리집단 다양성을 탐색하였다.For some primers, the temperature was adjusted according to the TM value. PCR products were subjected to electrophoresis in 1×TAE (Tris-Acetate EDTA) buffer at 80V for 3 hours after making a 2.5-3% agarose gel to explore the diversity of parents and isolates.

도 1은 본 발명에 따른 분자표지 #150, #228 및 #246의 PCR 산물 전기영동 결과이다.Figure 1 shows the electrophoresis results of PCR products of molecular markers #150, #228, and #246 according to the present invention.

도 1을 참조하면, SSR 마커, 2600개 쌍을 숙기가 다른 복숭아 6종에 대한 PCR 분석을 수행한 결과, 프라이머 3개쌍이 조숙종과 만숙종을 구분할 수 있으며, 하기 표 2는 3쌍의 프라이머를 나타낸 표이다.Referring to Figure 1, as a result of performing PCR analysis of 2600 pairs of SSR markers on 6 types of peaches at different ripeness, 3 pairs of primers can distinguish between early-ripening and late-ripening types, and Table 2 below shows the 3 pairs of primers. It's a table.

구분division forwardforward reversereverse #150#150 CGAAAGCCGACGAGAATAG(서열번호 1)CGAAAGCCGACGAGAATAG (SEQ ID NO: 1) GGAGAGCTTTAGAAGCACACAG(서열번호 2)GGAGAGCTTTAGAAGCACACAG (SEQ ID NO: 2) #228#228 CACTTCGCTCATCTTCCTCTAC(서열번호 3)CACTTCGCTCATCTTCCTCTAC (SEQ ID NO: 3) CACTTCGCTCATCTTCCTCTAC(서열번호 4)CACTTCGCTCATCTTCCTCTAC (SEQ ID NO: 4) #246#246 GCGGTGGTTGTAGAGAATAGAG(서열번호 5)GCGGTGGTTGTAGAGAATAGAG (SEQ ID NO: 5) TCTTGGCCGACCTAATTG(서열번호 6)TCTTGGCCGACCTAATTG (SEQ ID NO: 6)

이와 같이 본 발명인 복숭아 숙기 구분용 프라이머 세트를 사용하면 복숭아 열매가 열리기 전 만숙종과 조숙종을 구분할 수 있다. In this way, by using the primer set for distinguishing peach ripeness according to the present invention, it is possible to distinguish between late-ripening and early-ripening varieties before the peach fruit opens.

이상으로 본 발명의 바람직한 실시예를 상세하게 설명하였다. 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다.Preferred embodiments of the present invention have been described in detail above. The description of the present invention is for illustrative purposes, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing its technical spirit or essential features.

따라서, 본 발명의 범위는 상세한 설명보다는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미, 범위 및 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.Therefore, the scope of the present invention is indicated by the claims described later rather than the detailed description, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts are interpreted to be included in the scope of the present invention. It has to be.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for ripening peaches and classification method using the same <130> DP20200352 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> #150 forward primer <400> 1 cgaaagccga cgagaatag 19 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> #150 reverse primer <400> 2 ggagagcttt agaagcacac ag 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> #228 forward primer <400> 3 cacttcgctc atcttcctct ac 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> #228 reverse primer <400> 4 cacttcgctc atcttcctct ac 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> #246 forward primer <400> 5 gcggtggttg tagagaatag ag 22 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> #246 reverse primer <400> 6 tcttggccga cctaattg 18 <110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for ripening peaches and classification method using the same <130> DP20200352 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> #150 forward primer <400> 1 cgaaagccga cgagaatag 19 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> #150 reverse primer <400> 2 ggagagcttt agaagcacac ag 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> #228 forward primer <400> 3 cacttcgctc atcttcctct ac 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> #228 reverse primer <400> 4 cacttcgctc atcttcctct ac 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> #246 forward primer <400> 5 gcggtggttg tagagaatag ag 22 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> #246 reverse primer <400> 6 tcttggccga cctaattg 18

Claims (9)

서열번호 1 및 2로 표시되는 제1 프라이머 세트;
서열번호 3 및 4로 표시되는 제2 프라이머 세트; 및
서열번호 5 및 6으로 표시되는 제3 프라이머 세트;로 이루어진 군에서 선택된, 복숭아 숙기 구분용 프라이머 세트.
A first primer set represented by SEQ ID NOs: 1 and 2;
a second primer set represented by SEQ ID NOs: 3 and 4; and
A third primer set represented by SEQ ID NOs: 5 and 6; A primer set for distinguishing peach ripeness, selected from the group consisting of.
제1항에 있어서,
상기 프라이머 세트는 단순 반복 염기 서열(Simple sequence repeat; SSR) 마커 증폭용 프라이머 세트인 것을 특징으로 하는 복숭아 숙기 구분용 프라이머 세트.
According to paragraph 1,
The primer set is a primer set for distinguishing peach ripeness, characterized in that it is a primer set for amplifying a simple sequence repeat (SSR) marker.
제1항에 있어서,
상기 복숭아 숙기 구분은 만숙종과 조숙종을 구분하는 것을 특징으로 하는 복숭아 숙기 구분용 프라이머 세트.
According to paragraph 1,
The peach ripeness classification is a primer set for distinguishing peach ripeness, characterized in that it distinguishes late ripening species from early ripening species.
제3항에 있어서,
상기 만숙종은 120일 내지 130일의 복숭아이고, 상기 조숙종은 110일 이전의 복숭아인 것을 특징으로 하는 복숭아 숙기 구분용 프라이머 세트.
According to paragraph 3,
A primer set for distinguishing peach ripeness, characterized in that the late-ripening species are peaches of 120 to 130 days, and the early-ripening species are peaches of 110 days or earlier.
제4항에 있어서,
상기 만숙종은 유명 또는 수미 품종이고,
상기 조숙종은 미홍, 유미, 찌요마루 및 미스홍 품종으로 이루어진 군에서 선택되는 1종 이상인 것을 특징으로 하는 복숭아 숙기 구분용 프라이머 세트.
According to paragraph 4,
The late-ripening species is a famous or sumi variety,
A primer set for distinguishing peach ripeness, characterized in that the early ripening species is one or more species selected from the group consisting of Mihong, Yumi, Chiyomaru and Miss Hong varieties.
제1항의 프라이머 세트를 포함하는 복숭아 숙기 구분용 키트.
A kit for distinguishing ripeness of peaches including the primer set of claim 1.
제1항의 프라이머 세트를 포함하는 복숭아 숙기 구분용 조성물.
A composition for distinguishing ripeness of peaches comprising the primer set of claim 1.
(a) 복숭아 시료에서 게놈 DNA를 분리하는 단계;
(b) 상기 분리된 게놈 DNA를 주형으로 하고,
서열번호 1 및 2로 표시되는 제1 프라이머 세트; 서열번호 3 및 4로 표시되는 제2 프라이머 세트; 및 서열번호 5 및 6으로 표시되는 제3 프라이머 세트;로 이루어진 군에서 선택된 프라이머 세트를 이용하여 PCR 증폭 반응을 수행하는 단계; 및
(c) 상기 (b) 단계의 증폭된 산물을 검출하는 단계를 포함하는 복숭아 숙기 구분방법.
(a) isolating genomic DNA from a peach sample;
(b) using the isolated genomic DNA as a template,
A first primer set represented by SEQ ID NOs: 1 and 2; a second primer set represented by SEQ ID NOs: 3 and 4; and a third primer set represented by SEQ ID NOs: 5 and 6; performing a PCR amplification reaction using a primer set selected from the group consisting of; and
(c) A method for distinguishing ripeness of a peach comprising the step of detecting the amplified product of step (b).
제8항에 있어서, 상기 PCR 증폭 반응을 수행하는 단계는 단순 반복 염기 서열(Simple sequence repeat; SSR) 마커를 증폭하기 위한 것을 특징으로 하는 복숭아 숙기 구분방법.The method of claim 8, wherein the step of performing the PCR amplification reaction is to amplify a simple sequence repeat (SSR) marker.
KR1020210077342A 2021-06-15 2021-06-15 Primer set for ripening peaches and classification method using the same KR102586234B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020210077342A KR102586234B1 (en) 2021-06-15 2021-06-15 Primer set for ripening peaches and classification method using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020210077342A KR102586234B1 (en) 2021-06-15 2021-06-15 Primer set for ripening peaches and classification method using the same

Publications (2)

Publication Number Publication Date
KR20220167954A KR20220167954A (en) 2022-12-22
KR102586234B1 true KR102586234B1 (en) 2023-10-10

Family

ID=84578472

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020210077342A KR102586234B1 (en) 2021-06-15 2021-06-15 Primer set for ripening peaches and classification method using the same

Country Status (1)

Country Link
KR (1) KR102586234B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102125515B1 (en) 2019-08-22 2020-06-22 대한민국 SNP marker for identification of red-fleshed peach cultivar

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101359542B1 (en) * 2012-03-08 2014-02-24 대한민국 Microsatellite primer sets for discriminating cultivars of peach and uses thereof
KR102192666B1 (en) 2019-12-11 2020-12-17 대한민국 SNP marker for identification of yellow-fleshed peach cultivar

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102125515B1 (en) 2019-08-22 2020-06-22 대한민국 SNP marker for identification of red-fleshed peach cultivar

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Kang Hee Cho 등, J. Plant Biotechnol., 42, 312-325, 2015.
Riaz Ahmad 등, J. Amer. Soc. Hort. Sci., 129(2), 204-210, 2004

Also Published As

Publication number Publication date
KR20220167954A (en) 2022-12-22

Similar Documents

Publication Publication Date Title
KR101516190B1 (en) SSR primer sets for discrimination of oriental melon line or cultivar and uses thereof
KR102634293B1 (en) Molecular marker based on mitochondrial genome sequence for discriminating Schisandra chinensis &#39;Cheongsun&#39; cultivar and uses thereof
KR102192664B1 (en) Identification of kiwifruit using SCAR markers and multiplex PCR assays
KR102150113B1 (en) SCAR marker for identification of kiwifruit and use thereof
KR101229271B1 (en) Method of discriminating Korean native Prunus mume cultivars using SSR markers
KR102586234B1 (en) Primer set for ripening peaches and classification method using the same
KR102332689B1 (en) Molecular marker based on mitochondrial genome sequence for discriminating Panax ginseng &#39;GeumJin&#39; and &#39;SeonHyang&#39; cultivar and uses thereof
KR102654961B1 (en) Marker composition for identification of cucurbita spp. and identification method using the same
KR102332688B1 (en) Molecular marker based on nuclear genome sequence for discriminating Panax ginseng &#39;SeonHyang&#39; cultivar and uses thereof
KR102335806B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba &#39;SanJo&#39; cultivar and uses thereof
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
Cho et al. Blueberry cultivar identification using random amplified polymorphic DNA and sequence-characterized amplified region markers
KR101994831B1 (en) Multiplex primer sets for determining genotype of locus resistant to Citrus tristeza virus and uses thereof
KR102135173B1 (en) Method for identification of Koelreuteria paniculata genotypes using microsatellite markers
KR101649589B1 (en) SSR primer derived from apple and use thereof
KR101699518B1 (en) Primer set for discrimination of a ginseng cultivar Gumpoong and a landrace Hwangsook and uses thereof
KR102623818B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Prunus mume and Prunus armeniaca and uses thereof
KR102623817B1 (en) Molecular marker based on nuclear genome sequence for discriminating Prunus mume, Prunus armeniaca or hybrid of Prunus mume and Prunus armeniaca and uses thereof
KR102524050B1 (en) Molecular marker for discriminating sex of Actinidia arguta and uses thereof
KR102526682B1 (en) Molecular marker for predicting fruit orientation in pepper and uses thereof
KR102370010B1 (en) Molecular marker based on chloroplast genome sequence for discriminating between Korean jujube varieties and Japanese jujube varieties and uses thereof
KR102412898B1 (en) Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus
KR102151225B1 (en) Molecular marker based on nuclear genome sequence for discriminating Platycodon grandiflorum landraces and uses thereof
KR102412899B1 (en) Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus
KR102412903B1 (en) Primer set for discriminating flower color of Platycodon grandiflorus and method for discriminating flower color of Platycodon grandiflorus

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant