KR101359542B1 - Microsatellite primer sets for discriminating cultivars of peach and uses thereof - Google Patents

Abstract

The present invention provides a primer set for identifying a peach variety comprising at least one oligonucleotide primer set selected from the group consisting of oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 28, the oligonucleotide primer set and a reagent for performing the amplification reaction. The present invention relates to a kit for identifying a peach variety, and a method for identifying a peach variety using the primer set.

Description

Microsatellite primer sets for discriminating cultivars of peach and uses approximately}

The present invention relates to a supersatellite primer set for identifying a peach variety and its use, and more particularly to a peach variety comprising at least one oligonucleotide primer set selected from the group consisting of oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 28 A kit for identifying a peach variety comprising a primer set for identification, the oligonucleotide primer set and a reagent for carrying out an amplification reaction, and a method for identifying a peach variety using the primer set.

Molecular markers include mapping of genes associated with crop resistance and functionality, development of trait markers, identification of chromosomal positions of quantitative genes associated with traits (QTL, Quantitative Trait Locus), and F1 purity assay using molecular markers. It is used in various molecular breeding fields such as Molecular labeling is also used in plant variety protection. The UPOV is discussing the use of DNA markers for characterization of new varieties and granting new plant protection rights, but it has not yet recognized simple sequence differences at the genetic level as distinctive varieties. It proposes the possibility of using molecular labeling for Specifically, in the use of molecular labels to protect breeder's rights, the results obtained by AFLP (Amplified Fragment Length Polymorphism) or RAPD (Random Amplification of Polymorphic DNA) analysis techniques, which were mainly used in the past, are not recognized. Considering the reproducibility of the analysis and the degree of distribution on the chromosome, it is proposed to use the Simple Sequence Repeat (SSR), Microsatellite, Single Nucleotide Polymorphism (SNP) and Cleaved Amplified Polymorphic Sequence (CAPS) methods.

In general, methods for identifying plant varieties are divided into morphological characteristics through cultivation tests, assays through isoenzyme differences between varieties, and DNA analysis methods. Among them, the DNA analysis method has an advantage of being objective and reproducible because it is not affected by the cultivation environment and the growth stage of the crop compared to the phenotype-based identification method.

Indeed, if we look at the status of developing and utilizing DNA analysis for domestic and foreign varieties identification, Korea Rural Development Administration reported SSR molecular labeling for rice, soybean, and CAPS molecular labeling for strawberry. In addition, the National Species Resource used SSR molecular labels to database the DNA profiles of crops for peppers, cabbages, watermelons, tomatoes, peaches, roses, onions, lettuces, and so on. Molecular markers are used directly, and recently, genetic analysis results are used as a supplementary data for selection of control varieties for crops applied for varieties protection. On the other hand, the purity test marker of the SSR molecular label for breed identification was utilized for the F1 purity test for gourds and crops to support breeders.

In the case of foreign countries, in Spain, SSR analysis technology is used to produce a database of DNA profiles for each variety of crops, such as grapes, for use in identifying the base-derived varieties and managing existing varieties. In China, a DNA profile using SSR and SNP molecular labels for about 4000 varieties of maize is databased, and courts are actively using genetic analysis results to determine cases of infringement of varieties protection. Japan has developed a variety identification method using SSR molecular labels on peaches, pears and apples, and CAPS molecular labels on strawberries and teas to protect breeders' rights.

On the other hand, peach, a rose family, is used directly as raw fruit or as a material for processed foods such as jams, juices, and canned foods. In other words, the share of fruit trees is high. Peaches can be broadly classified into white, zodiacal, and nectar according to their lineage, and are bred by selection of live seedlings and mutants by mating.

If you look at the trends in molecular genetic research on peach, the international Rosaceae Genomics Projects have been carried out in foreign countries, and the peach gene mapping, EST (Expressed Sequence Tag) information, molecular labeling information, etc. (Http://www.rosaceae.org/). In Japan, we have developed 60 SSR markers and suggested the possibility of using them to analyze the soft relationships of peach varieties (Toshiya Y et al., 2003. J. Japan. Soc. Hort. Sci. 72 (2): 116 -121). In Italy, 17 SSR markers were developed and used for Prunus species (Cipriani G et al., 1999. Theor. Appl. Genet. 99, 65-72). In the United States, 10 SSR markers showing polymorphisms in 28 varieties were used to map peach genes (Sosinski B et al., Theor. Appl. Genet 101, 421-428). In Korea, SCAR markers have been used to identify peach varieties (Han Sang-eun et al., Korean Society for Breeding, Vol. 42, No. 5, 2010). However, a combination of appropriate markers capable of identifying peach varieties using a set of supersatellite markers and a precise genotyping technique using an automatic base sequencer have not yet been established domestically.

On the other hand, Korean Patent Publication No. 2011-0111069 discloses a method for identifying cucumber varieties using a satellite marker, and Korean Patent No. 1011694 discloses a method for identifying cabbage varieties using a molecular label. However, as in the present invention, there is no disclosure about a set of 96 physiological primers for identification of peach varieties distributed in Korea.

The present invention is derived from the above requirements, the present inventors can produce a genomic library directly from the peach genome (genomic library) peach variety identification method that can save a significant time and cost compared to the method of developing the SSR markers While continuing the study, we selected the supersonic markers showing polymorphism for 96 peach varieties of peach from the peach EST-derived SSR marker and cherry SSR marker for the first time in Korea. The amplification products generated after amplifying the genomic DNA of domestic peach varieties using these supersatellite markers as primers were confirmed, and the present invention was completed by confirming that the amplification products could be practically used for scientific verification of authenticity of peach varieties.

In order to solve the above problems, the present invention provides a primer set for identifying peach varieties comprising at least one oligonucleotide primer set selected from the group consisting of oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 28.

The present invention also provides a kit for identifying a peach variety comprising the oligonucleotide primer set and a reagent for performing an amplification reaction.

The present invention also provides a method of identifying peach varieties using the primer set.

According to the present invention, it is possible to identify 96 peach varieties circulating in Korea using only the peach variety identification marker of the present invention. Therefore, it can be usefully used in various fields, such as identifying the authenticity of peach varieties and selecting control varieties in varietal protection applications.

Figure 1 encodes each peach variety analyzed by the marker according to the present invention and shows the genetic similarity of the peach variety identification and varieties using NTSYSPC computer program.
2 is a coded presence or absence of a band according to the size of the allele when amplified using the 14 primer sets of the present invention in 96 peach varieties grown at home and abroad, represented by "1" when the band is present And when no band is present, " 0 ".

The present invention provides a marker for identifying a peach variety, including a primer set (SEQ ID NOS: 1 to 28) exhibiting polymorphism with respect to the peach variety in circulation in Korea.

The marker is a super satellite marker showing a high polymorphism for 96 varieties of peach distributed in Korea and abroad, and can specifically identify peach varieties distributed in Korea. The marker of the present invention is a supersatellite marker showing high polymorphism for 96 varieties of peaches that are grown and sold by domestic and international breeding agencies and individual breeders. Specifically, the markers of the present invention showed high polymorphism for 96 varieties of peach described in Table 1 below.

The marker of the present invention may include, for example, one or more markers selected from the group consisting of the nucleotide sequences shown in Table 2 below (SEQ ID NOS: 1 to 28).

In this specification, markers can be used interchangeably with primer sets.

The primer set for identifying the peach variety of the present invention is specifically

One or more oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 1 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 2 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 3 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 4 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 5 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 6 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 7 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 8 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. 9 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. 11 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 13 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 14 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

One or more oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of 15 or more consecutive nucleotides in the sequence of SEQ ID NO: 15 and oligonucleotides consisting of fragments of 15 or more consecutive nucleotides in the sequence of SEQ ID NO: 16 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. 17 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 19 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 20 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 21 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 22 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

One or more oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 23 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 24 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 25 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 26 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group; And

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 27 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 28 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

It may comprise one or more oligonucleotide primer set selected from the group consisting of.

The primer set for identifying the peach variety of the present invention is preferably

Oligonucleotide primer sets of SEQ ID NOs: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; An oligonucleotide primer set of SEQ ID NOs: 13 and 14; An oligonucleotide primer set of SEQ ID NOS: 15 and 16; An oligonucleotide primer set of SEQ ID NOS: 17 and 18; An oligonucleotide primer set of SEQ ID NOS: 19 and 20; Oligonucleotide primer sets of SEQ ID NOS: 21 and 22; An oligonucleotide primer set of SEQ ID NOs: 23 and 24; An oligonucleotide primer set of SEQ ID NOs: 25 and 26; And one or more oligonucleotide primer sets selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 27 and 28,

Most preferably,

Oligonucleotide primer sets of SEQ ID NOs: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; An oligonucleotide primer set of SEQ ID NOs: 13 and 14; An oligonucleotide primer set of SEQ ID NOS: 15 and 16; An oligonucleotide primer set of SEQ ID NOS: 17 and 18; An oligonucleotide primer set of SEQ ID NOS: 19 and 20; Oligonucleotide primer sets of SEQ ID NOS: 21 and 22; An oligonucleotide primer set of SEQ ID NOs: 23 and 24; An oligonucleotide primer set of SEQ ID NOs: 25 and 26; And oligonucleotide primer sets of SEQ ID NOs: 27 and 28.

The oligonucleotide primer set according to one embodiment of the present invention is preferably two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, preferably in increasing order, There may be at least 9, at least 10, at least 11, at least 12, at least 13 primer sets, most preferably 14 primer sets. The simultaneous use of 14 SSR primer sets provides the most accurate identification of 96 peach varieties.

The SSR primers may be 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more in the sequence of SEQ ID NO: 1 to SEQ ID NO: 28, depending on the sequence length of each SSR primer. Oligonucleotides consisting of segments of contiguous nucleotides. For example, the SSR primer (20 oligonucleotides) of SEQ ID NO: 1 is an oligonucleotide consisting of segments of at least 15, 16, 17, 18, 19, or 19 contiguous nucleotides within the sequence of SEQ ID NO: 1 It may include, SSR primer of SEQ ID NO: 2 (18 oligonucleotides) may include oligonucleotide consisting of fragments of at least 15, 16 or more, 17 or more consecutive nucleotides in the sequence of SEQ ID NO: 2. In addition, the SSR primer may include a sequence of addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 28.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

In order to achieve still another object of the present invention,

Oligonucleotide primer sets of the invention; And kits for identifying peach varieties, including reagents for conducting amplification reactions.

In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In order to achieve still another object of the present invention,

Amplifying the nucleic acid using genomic DNA derived from a peach as a template and using the primer set for identifying a peach variety of the present invention as a primer; And

It provides a method for identifying a peach variety, comprising the step of identifying the variety of the peach from the amplification product.

In the peach variety identification method of the present invention, genomic DNA derived from peach can be obtained by using a conventional method of collecting DNA from the whole plant of peach, for example, CTAB method can be used, and wizard prep kit ( Promega can also be used. Genomic DNA derived from peach can be derived from the leaves, stems, or fruits of the peach, and in particular can be taken from the leaves of young plants of the peach.

In the peach variety identification method of the present invention, amplification of genomic DNA is performed by PCR, ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system ( There is a transcription-based amplification system, strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, it is preferable to use a polymerase chain reaction (PCR). Specifically, the PCR reaction may be generally performed using a PCR reaction solution containing several components. For example, the PCR reaction solution may include genomic DNA derived from the peach to be analyzed, the primer set of the present invention, an appropriate amount of DNA polymerase (eg, Taq polymerase), dNTP mixture, PCR buffer and water. It includes. The PCR buffer may contain KCl, Tris-HCl and MgCl _2.

In the method of the present invention, the amplified nucleic acid sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive.

In the present invention, the step of identifying peach varieties from the amplified product may be performed by a computer program for checking the size of an allele (band) using an automatic sequencing analyzer and then identifying each variety. Specifically, for each peach variety, the presence or absence of an amplification product by the marker of the present invention can be prepared in a table and the peach variety can be identified through a comparative analysis with the amplified product. For example, using the marker of the present invention, the size of the alleles from each peach variety is summarized in one table, and then the presence or absence of the alleles is indicated. When the alleles are present, the alleles are represented as "1". When not indicated, "0" is displayed. Therefore, after genomic DNA is isolated from the peach to identify the variety, the amplification using the marker of the present invention, the size of the amplified product can be analyzed and then whether the identification of the peach variety can be confirmed through a statistical program.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1: for identifying peach varieties Marker  evaluation

(1) peach sample

In the present invention, 96 peach varieties described in Table 1 were used for selection of primer sets for identifying peach varieties.

96 varieties of peaches for identification Serial number Breed name Serial number Breed name Serial number Breed name One Misrica 33 Casting 65 May Grand 2 Flat red 34 Lion 66 Fame 3 Flavor Top 35 Conversation 67 Mid gold 4 Whiteness 36 Prayer 68 Blue White 5 Aegean 37 White rice 69 White medicine 6 Dobaekbong 38 Amato 2 70 Baekcheon 7 Dosan Baekbong 39 Izumi white island 71 Cedar 8 Amethyst Baekbong 40 Yonggungbaekdo 72 Demodulation 9 Saotome 41 Monthly salary 73 Sun gold 10 Sanri Baekbong 42 Oak spring 74 Sunpre 11 Songsam Algae 43 A window assistant 75 Subong 12 Odoroki (beep) 44 An assistant 76 Suites 13 One thousand one hundred 45 Taste 77 Amato 1 14 Jang Taek Baekbong 46 Elberta 78 Acheon-myeon 15 8 times 47 Rice 79 Earliest 16 Delicacy 48 Summi Gold 80 Elongated zodiacal 17 Encephalitis 49 Sulfur 81 Huanghuang white peach 18 Daegubo 50 Condition 82 January 19 West white 51 Chiyomaru 83 Imheung Baekdo 20 Abu White 52 Inertia 84 Jang Ho Won 21 Early bird 53 gold 85 Jerseyland 22 Cheongsubaekdo 54 Vulture 86 Jumbo Akatsuki 23 Stockings 55 New Yorker 87 Jungjin Whitedo 24 Spring time 56 Jackpot 88 Underground 25 Hacking 57 President 89 Canadian Harmony 26 Cheonhong 58 Derby 90 Collins 27 Hahong 59 Raritan Rose 91 Kirara no Kiwami 28 Inertia 60 Red gold 92 Flodaglo 29 Daemyung 61 Royal zodiacal 93 Fisher 30 Snow White 62 Rose Prince 94 harmony 31 Wolmi Peach 63 Long Tag Gold 95 Hanilbaekdo 32 Phosphorus white 64 Rich Haven 96 Poppy

(2) Extraction of genomic DNA

The leaves of the published peach varieties shown in Table 1 were taken and used as a material for separating genomic DNA. Two tungsten beads were placed in a 2 ml tube in which the leaves of the collected peaches were stored and rapidly frozen with liquid nitrogen (-196 ° C), and the tissues were evenly ground while repeating the vortexing process. Fully ground tissue was isolated genomic DNA using the NucleoSpin ^® Plant II (Macherey-Nagel Cat. 740 770.250) kit. PL2 was used as a cell lysis buffer. The extracted genomic DNA was electrophoresed in 1.2% agarose gel to confirm the concentration of DNA. After quantification, the genomic DNA was diluted to a concentration of 20 ng per μl and used for PCR analysis.

(3) Preparation of primer set

185 markers were used as candidates for the primer set of the present invention. The markers used included not only peaches, but also markers of other species in the genus Rose and Prunus, apples, cherries and pears. These markers include eight peaches (Toshiya Y et al., 2003. J. Japan. Soc. Hort. Sci. 72 (2): 116-121) developed by Yamamoto et al. In Japan, and 13 pears (Yamamoto T et al. , 2002. Molecular Ecology Notes. 2: 14-16), 15 markers of peach and 5 cherries developed in the United States (Sosinski B et al., 2000. Theor.Appl. Genet 101, 421-428), Italy 17 peaches developed in Cipriani G et al., 1999. Theor. Appl. Genet. 99: 65-72; 17 apples developed in Switzerland (Gianfranceschi L et al., 1998. Theor. Appl. Genet. 96: 1069-1076), 14 apples developed in New Zealand (Guilford P et al., 1997. Theor.Appl. Genet. 94: 249-254), 17 markers developed in the United States (Ying Wang et al. Genome 45: 319-32), 14 markers developed in China (Xiaoying Li et al., 2010. BMC Genetics, 11:66), 13 markers developed in Turkey (Yildiz Aka Kacar et al. ., 2005. Journal of Biological Sciences. 5 (5): 616-619) and the International Rosary Crop Genome Project. Peach 61 EST-SSR markers (http://www.rosaceae.org/) were used in the Genome Database for Rosaceae. To select markers with high polymorphism for peach varieties distributed in Korea, genomic DNA from Chiyomaru, female King, Wolbongsaeng, Changbangsaeng, Cheonhong, Dobaekbong, Elberta, and Jangwon Wondo cultivars were used with 185 primer sets. After the PCR reaction, the amplified DNA fragments were electrophoresed for 2 hours in a 6% polyacrylamide sequencing gel and stained with Silver sequence ^™ staining reagent (Promega, USA). After staining, the bands were identified and analyzed for differences in alleles of each sample, and 30 markers with high repeatability, clear band pattern, and high polymorphism were selected first. In order to perform precise analysis through an automatic sequencing analysis of the molecular labels of these 30 markers, oligonucleotides in which the forward primers were fluorescently labeled with one of the fluorescent generating materials FAM, VIC, NED or PET were prepared. As a result of genetic analysis using the 30 markers, a minimum of 14 markers capable of identifying a variety of 96 varieties were finally selected (Table 2).

Peach varieties identification marker SEQ ID NO: Super satellites
Marking factor The base sequence (5 'to 3') of the primer Fluorescent staining One PEM1 Forward: AAGTTCTTCGCCCATCTCAA (SEQ ID NO: 1) FAM 2 Reverse: AGCAGCCGGGCTAATGAT (SEQ ID NO: 2) 3 PEM2 Forward: GACAGACAGACGGACAGACG (SEQ ID NO: 3) VIC 4 Reverse: ACCCTCTCCCTGACTTCCTC (SEQ ID NO: 4) 5 PEM3 Forward: AGACAGAGGGGACAGAGCAA (SEQ ID NO: 5) NED 6 Reverse: CGCGCGGAGAGATAATAGAC (SEQ ID NO: 6) 7 PEM4 Forward: TCGACTACGTCTCCGTCTCC (SEQ ID NO: 7) FAM 8 Reverse: AGCCGAATGCTGTCCTTAGA (SEQ ID NO: 8) 9 PEM5 Forward: GCAATGGCTTTGGCTAGGTA (SEQ ID NO: 9) VIC 10 Reverse: CATGCAACTAATTAACACAATGA (SEQ ID NO: 10) 11 PEM6 Forward direction: ATATAAAGCCCCGTGACCAG (SEQ ID NO: 11) NED 12 Reverse: TACTTTGTCGGAGCGCGTAT (SEQ ID NO: 12) 13 PEM7 Forward: CTCCGTCCCACCCTAAAAAT (SEQ ID NO: 13) PET 14 Reverse: ACAATGACGAAACCGAGGAG (SEQ ID NO: 14) 15 PEM8 Forward: CGAAGCTGAATCGAGATTATGA (SEQ ID NO: 15) VIC 16 Reverse: CCGAAACACAATACTCTTGCAT (SEQ ID NO: 16) 17 PEM9 Forward: CCACTTTTGCCAGACCCTAC (SEQ ID NO: 17) PET 18 Reverse: CAACCCCAATCATACAACCT (SEQ ID NO: 18) 19 PEM10 Forward: AAATCTCCCAATCCCTCACC (SEQ ID NO: 19) VIC 20 Reverse: TCGATTTTCCCCTTTTTGTG (SEQ ID NO: 20) 21 PEM11 Forward: ACGTGGCCACTTACCTCTTT (SEQ ID NO: 21) VIC 22 Reverse: TCCAGACTGCCTCGACCTTC (SEQ ID NO: 22) 23 PEM12 Forward: CCTTACCACTGGCATCATCA (SEQ ID NO: 23) NED 24 Reverse: CAGCTGAGCAGGCAACAAAA (SEQ ID NO: 24) 25 PEM13 Forward: GAACATGTGGTGTGCTGGTT (SEQ ID NO: 25) PET 26 Reverse: TCCACTAGGAGGTGCAAATG (SEQ ID NO 26) 27 PEM14 Forward: GCCACCAATGGTTCTTCC (SEQ ID NO: 27) FAM 28 Reverse: AGCACCAGATGCACCTGA (SEQ ID NO: 28)

(4) PCR amplification and electrophoresis

PCR was performed using the prepared genomic DNA and the prepared markers as materials. The composition of the PCR reaction solution was prepared from 20 ng of the peach genomic DNA prepared above, the marker of 0.1 μM, 2.0 μl dNTP mixture (2.5 mM), Taq polymerase 1U (Takara CAT. RR011A), 2.5 μl of 10 × PCR buffer ( 50 mM KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl ₂ ) was added to distilled water to adjust the total volume to 25 μl. PCR (UNO II Thermocycler, Biometra, Germany) amplification was carried out 40 times at 50 ° C. for 30 minutes at 94 ° C., 30 seconds at 55 ° C., and 45 seconds at 72 ° C. after sufficient denaturation of genomic DNA for 5 minutes at 94 ° C. The run was repeated and reacted for 5 minutes at 72 ° C. for final extension of the PCR product. After the PCR was completed, the amplification was confirmed by electrophoresis on 2% agarose gel. The amplified samples were stored at -20 ° C for the next experiment. The PCR product was diluted to 150 µl of ultrapure water at an appropriate concentration. Then, 5 µl of the diluted PCR product was well mixed with 10 µl of deionized formamide and 0.25 µl of a size marker (LIZ500 size standard) for measuring the size of the allele. It was denatured for 2 minutes at 94 ℃. The denatured PCR product was subjected to electrophoresis using an automatic sequencing device (Genetic Analyzer 3130XL, Applied Biosystem), and then the exact size of alleles per SSR molecule label was determined using GeneMapper computer program (Applied Biosystem).

(5) Peach variety identification possibility test of the marker according to the present invention

Using the allele size identified by the automatic sequencing analyzer, the possibility of identifying the peach variety of the marker according to the present invention was investigated. Equation 1 was used to calculate the polymorphism information content (PIC) value. P _ij is the frequency of the _j th common band pattern among the bands of the marker _i (Anderson et al., 1993, Genome 36: 181-186).

As a result, annealing temperature (° C), amplification product size (bp), number of alleles and PIC value according to each marker are shown in Table 3 below.

Marker Features and Degree of Polymorphism Serial number SSR
Marker name Annealing
Temperature (℃) Allele
Size (bp) Opposition
Number of genes PIC value One PEM1 55 162-166 3 0.479 2 PEM2 55 153-163 4 0.673 3 PEM3 55 188-192 3 0.625 4 PEM4 55 130-145 4 0.358 5 PEM5 55 113-119 4 0.494 6 PEM6 55 218-222 3 0.592 7 PEM7 55 194-200 3 0.547 8 PEM8 55 198-212 7 0.518 9 PEM9 55 137-165 3 0.502 10 PEM10 55 154-156 2 0.500 11 PEM11 55 200-202 2 0.500 12 PEM12 55 152 ~ 154 2 0.494 13 PEM13 55 144-148 2 0.494 14 PEM14 55 163-181 7 0.453 system 49 7.75 Average 3.500 0.517

As shown in Table 3, the number of alleles of the markers utilized in the present invention was distributed in the range of 2 to 7, and the PIC value, which is an index representing the degree of polymorphism for each molecular label, showed a high value of 0.517 on average. Therefore, it was confirmed that the marker of the present invention can sufficiently identify peach varieties.

In addition, the presence or absence of the cultivars band according to the size of the allele for the marker was determined by NTSYS pc (version 2.10b) (Rohlf, 2000, Numerical Taxonomy and Multivariate Analysis System-Version 2.10b.Applied Biostatistics Inc., New York.) Computer program. Genetic similarity values were calculated according to Jaccard's method (Sneath and Sokal 1973, Numerical taxonomy: The Principles and Practice of Numerical Classification, WH Freeman, San Francisco.). Genetic similarity was used to agglomerate a dendogram by aggregating by UPGMA (Unweighted Pair-group Method with Arithmetical Average) (Sneath and Sokal, 1973), and the results are shown in FIG. 1. According to Figure 1 it can be seen that the primer set of the present invention enables the creation of a systematic diagram for 96 peach varieties in circulation at home and abroad. Therefore, it can be seen that the primer set of the present invention enables the identification of 96 peach varieties that are distributed in Korea.

Example  2: peach variety identification

(1) Using the marker of the present invention to prepare a variety identification list

Genomic DNA was extracted from each of 96 peach varieties grown at home and abroad according to the method of the above example. PCR was performed by the method of the above example using 14 markers of the present invention as a primer set. From the PCR result, the marker according to the present invention is discriminated from each other in the 96 peach varieties using the marker of the present invention by encoding a score of 1 if a band is present and a 0 if a band is not present. Peach varieties identification table was prepared and the results are shown in FIG. 2. As shown in Figure 2, each of the peach varieties according to the number of alleles according to the marker of the present invention showed a different type of band.

(2) identification of peach varieties

DNA isolated from the leaves of peach to identify the varieties were amplified by PCR and electrophoresed using each of the 14 markers of the present invention as a primer set. PCR amplification and electrophoresis used the same method as described in Example 1 above. The presence or absence of bands in each electrophoresis result was used to identify 96 peach varieties compared with the results of FIG. 2.

Attach an electronic file to a sequence list

Claims (8)

Oligonucleotide primer sets of SEQ ID NOs: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; An oligonucleotide primer set of SEQ ID NOs: 13 and 14; An oligonucleotide primer set of SEQ ID NOS: 15 and 16; An oligonucleotide primer set of SEQ ID NOS: 17 and 18; An oligonucleotide primer set of SEQ ID NOS: 19 and 20; Oligonucleotide primer sets of SEQ ID NOS: 21 and 22; An oligonucleotide primer set of SEQ ID NOs: 23 and 24; An oligonucleotide primer set of SEQ ID NOs: 25 and 26; And a set of oligonucleotide primers of SEQ ID NOs: 27 and 28. delete delete An oligonucleotide primer set according to claim 1; And a reagent for conducting an amplification reaction. The kit of claim 4, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs and a buffer. Amplifying the nucleic acid using genomic DNA derived from peach as a template and using the primer set for identifying the peach variety of claim 1 as a primer; And
Identifying the peach variety from the amplification product. 7. The method of claim 6, wherein said genomic DNA is derived from a peach leaf, stem or fruit. 7. The method of claim 6, wherein identifying the peach varieties from the amplified products comprises a table for the presence or absence of amplified products by the primer set for identifying peach varieties according to claim 1 for each peach variety and comparing the amplified products with the amplified products. A method of identifying a peach variety, characterized by identifying a peach variety.

Images