CN108977563B - SSR core primer group developed based on radish whole genome sequence and application thereof - Google Patents

Abstract

The invention discloses a set of SSR core primer groups developed based on a radish whole genome sequence and application thereof. The SSR core primer group comprises 21 pairs of primers, and the nucleotide sequence of the SSR core primer group is shown in SEQ No. 1-42. The SSR core primer group provided by the invention is uniformly distributed in a radish genome, has high polymorphism, good amplification repeatability and clear and easy identification of band types, is suitable for detection of a common denaturing polyacrylamide gel electrophoresis detection platform and a capillary fluorescence detection platform, and can be applied to the fields of radish genetic diversity analysis, variety identification, DNA fingerprint construction and the like.

Description

SSR core primer group developed based on radish whole genome sequence and application thereof

Technical Field

The invention relates to a radish SSR marker, in particular to an SSR core primer group developed based on a radish whole genome sequence and application thereof, belonging to the technical field of molecular biology.

Background

The radish is cultivated in China in all regions, the variety is extremely large, and the radish is commonly red radish, green radish, white radish, summer radish, beautiful mood and the like. The root is edible and is one of the main vegetables in China. Radish mainly contains protein, saccharide, B vitamins, vitamin C, iron, calcium, phosphorus, fiber, mustard oil and amylase. According to the determination, the content of the vitamin C in the radish is approximately 10 times higher than that in fruits such as apples and pears. Radish is cool in nature, pungent and sweet in flavor, and has the effects of removing food retention, resolving phlegm, clearing heat, descending qi, relieving epigastric distention and detoxifying. Radish is a genuine health food, and has effects of promoting metabolism, stimulating appetite, promoting digestion, and resolving food stagnation, and can be used for treating dyspepsia, phlegm cough, aphonia, hematemesis, dyspepsia, dysentery, headache, dysuria, etc.; if people eat the radish frequently, the blood fat can be reduced, the blood vessel can be softened, the blood pressure can be stabilized, and the diseases such as coronary heart disease, arteriosclerosis, cholelithiasis and the like can be prevented.

Radish is an important major vegetable in China and is planted all over the country. Can be cultivated in four seasons, is supplied all year round and has large output and sales volume. Due to the improvement of the living standard of people, the change of consumption habits, the development of scientific technology and the development of out-of-season cultivation, the sunlight greenhouse and the plastic big, medium and small sheds are matched for cultivation by utilizing the difference of high mountain climate. The radish is sold on the market in time, and is popular with consumers.

In recent years, the new radish variety breeding in China shows good development momentum, and a large number of new radish varieties are bred. The method can accurately and quickly identify the varieties of the crops, and has important effects on the aspects of crop variety approval, variety protection, true and false variety identification, variety property dispute and the like. The traditional variety identification method is field planting identification, which is to plant the identified varieties under the same growth conditions, observe and record a plurality of quality traits, quantitative traits, disease resistance and the like at each stage of growth and development, compare the varieties and identify the similarities and differences of the varieties. The traditional variety identification method has the problems of long identification period, high possibility of being influenced by the environment, many test characters, large workload and the like, and cannot adapt to the identification requirements of a large number of varieties.

The molecular marker is a genetic marker based on nucleotide sequence variation among individuals, and is a direct reflection of DNA level genetic polymorphism. The molecular marker detection technology has the advantages of short test period, no environmental influence and season limitation, no tissue specificity, large number of selectable markers, capability of performing high-throughput test analysis and the like, and is gradually used for variety identification, seed purity and variety authenticity detection. By using RAPD, AFLP and RFLP markers, radish varieties with different ecological types can be distinguished. However, RAPD is less reproducible; AFLP operation is complex and has poor stability; the RFLP operation process is complicated, the efficiency is low, and the cost is high. SSR (simple Sequence repeats) is a DNA Sequence which is in tandem repetition and takes 1-6 nucleotides as a unit, and is widely distributed in eukaryotic genomes. Compared with other molecular markers, the SSR marker has the advantages of co-dominance, high polymorphism, good repeatability, simple operation and the like, and has been widely applied to the fields of plant genetic diversity research, variety identification, genetic map construction, QTL positioning, marker-assisted selection, comparative genome research and the like as an important DNA marker. Compared with crops such as rice, wheat and the like, the number of the conventional SSR markers of the radishes is small, the research requirement of the radishes cannot be met, and the development of a large number of SSR markers covering the whole genome is still one of the important works of the research of the radishes at present.

disclosure of Invention

The invention aims to provide a set of SSR core primer groups developed based on the whole genome sequence of radish, the primers have the advantages of stable amplification, clear electrophoretic bands and rich polymorphism, and can be effectively used for researches such as radish genetic diversity analysis, variety identification, DNA fingerprint map construction and the like.

The invention provides an SSR core primer group developed based on a radish whole genome sequence, which is characterized by comprising 21 pairs of primers, wherein the primers respectively comprise the following components in parts by weight: LB5-2, LB6-35, LB8-9, LB1-15, LB6-26, LB7-20, LB2-23, LB9-5, LB6-11, LB9-35, LB7-33, LB7-34, LB1-19, LB5-28, LB8-17, LB4-23, LB5-3, LB3-21, LB3-16, RS0027 and RS0073, the nucleotide sequence of which is shown in SEQ No.1-42 or Table 2 in sequence.

The invention also provides the application of the SSR core primer group in genetic diversity analysis, variety identification and DNA fingerprint construction.

The application method of the SSR core primer group in variety identification is characterized in that 21 pairs of primers are adopted for carrying out fluorescence capillary electrophoresis detection, and the number of the ectopic points of the variety differences is more than or equal to 3 according to the detection result of the capillary electrophoresis; the number of the ectopic points of the variety difference is less than 3, and the identification result can be formed.

The invention has the beneficial effects that:

1) The 21 pairs of SSR core primers (namely SSR markers) screened by the invention are uniformly distributed in the radish genome, have high polymorphism and clear banding patterns and are easy to judge. Compared with EST-SSR, the genome SSR is adopted, the polymorphism is higher, the variety discrimination is stronger, and better variety discrimination effect can be obtained by fewer primers.

2) Compared with EST-SSR, the 21 pairs of SSR core primers screened by the method can be screened by a polyacrylamide electrophoresis platform, and more importantly, the requirements of a high-flux fluorescence capillary electrophoresis technology platform can be met. The five-color fluorescence capillary electrophoresis technology is the mainstream molecular marker analysis technology at present, the analysis efficiency is more than 20 times of that of the polyacrylamide electrophoresis technology, the allelic variation data obtained by analysis has good repeatability and strong reproducibility, and the analysis process is clean and environment-friendly.

3) The SSR core primer group disclosed by the invention is uniformly distributed in a radish genome, has high polymorphism and good amplification repeatability, can be used in the fields of radish genetic diversity analysis, variety identification, DNA fingerprint map construction and the like, is favorable for protecting the legal rights and interests of breeders, producers and consumers, and promotes the improvement of radish genetic breeding level and the development of radish industry.

Drawings

FIG. 1 is a schematic diagram of the results of a search conducted by the SSRHUNTER1.3 software;

FIG. 2 shows the polymorphism detected by the primers in radish; wherein, A, B is the polymorphism detected by the primers LB5-3 and LB6-26 in radish respectively, and it can be seen from the figure that: the polymorphism of the primer is most abundant and the band type is clear;

FIG. 3 is a cluster map of 96 varieties of 21 pairs of primer pairs.

Detailed Description

1. Extraction of radish genomic DNA

(1) Material 96 parts radish variety (Table 1)

Radish cultivar 196 parts in table

(2) Extraction of genomic DNA by CTAB method

Extracting DNA of a radish variety to be tested by adopting a CTAB method: a0.2 g sample of the young tissue mixture was taken, and the mixture was put into a 1.5mL centrifuge tube and ground in liquid nitrogen. Or grinding the seeds and placing into a 1.5mL centrifuge tube. The DNA extract was preheated to 65 ℃ and 400. mu.L of DNA was added to each tube, and the samples were mixed well. Placing the centrifuge tube in a 65 deg.C metal bath or water bath, holding for 23min, taking off, and shaking the centrifuge tube during holding to mix the sample and the extractive solution thoroughly. 400 μ L of 24:1 chloroform-isoamyl alcohol (V/V) was added to the centrifuge tube, and mixed by shaking. Centrifugation is carried out for 10min at 10000 g. Transfer 200. mu.L of the supernatant into another 1.5mL centrifuge tube, add 400. mu.L of precooled absolute ethanol at-20 ℃ to precipitate DNA. Centrifuging at 10000 g for 1min, discarding supernatant, adding 500 μ L ethanol-ammonium acetate solution (weighing 154.6mg ammonium acetate, adding 140mL anhydrous ethanol, diluting with deionized water to volume of 200mL), centrifuging at 6000 g for 5min, and collecting precipitate. Air-dried at room temperature, 100. mu.L of TE (pH8.0) solution was added to dissolve the DNA, and the DNA concentration was measured. Storing at-20 deg.C.

Wherein, the formula of the DNA extracting solution is as follows: 20.0g of hexadecyltriethylammonium bromide and 81.82g of sodium chloride are respectively weighed and placed in a beaker, then 40mL of ethylene diamine tetraacetic acid disodium salt solution (pH8.0), 100mL of 1mol/L trihydroxymethylaminomethane hydrochloric acid solution (pH8.0) and 10.0g of polyvinylpyrrolidone (PVP) are added, 800mL of deionized water is added, the mixture is heated and dissolved in a water bath at 65 ℃, and the volume is adjusted to 1000mL after cooling. Sterilizing at 103.4kPa (121 ℃) for 20 min. Stored at 4 ℃.

2. Development of radish genome SSR primers

(1) Obtaining of radish genome sequence

Radish whole genome sequencing results were downloaded from the radish genome Database Brassica Database (http:// fibrous db. org/read/downloadoverview. php), about 391Mb, comprising 76592 sequences in total.

(2) Acquisition of localized sequences

580 sequences for which chromosomal information has been located were found in 76592 by Raphanus sativus Genome DataBase (http:// radish. kazusa. or. jp/index. html).

(3) Identification of SSR sequences in radish genome sequence

SSR site search is carried out on the located 580 sequences by adopting SSR search software SSRHounter 1.3. The search conditions are as follows: the number of repetitions is at least 5 and the number of nucleotides constituting the repeating unit is at most 6. Complete SSR, incomplete SSR and composite SSR are counted. The results of the ssrfunter 1.3 software search are shown in fig. 1.

(4) Design of radish genome SSR primer

Selecting SSR loci with the repetition times of more than 10 or the number of repeated bases of more than 18 according to the SSR loci obtained in the step (3), and designing a Primer by using conserved flanking sequences at two ends of the repeated sequences and using Primer 5.0. The conditions for primer design were: the length of the PCR product is 100-350 bp; the annealing temperature (Tm) is 50-70 ℃, and the Tm difference between two primers is not more than 4 ℃; the GC% content is 40-65%; the length of the primer is 18-28 bp; the 5 'end of the primer is preferably G/C, and the 3' end avoids A. In order to ensure the specificity of the primer, the conservative flanking sequence for designing the primer is at least separated from the microsatellite locus by 20-23 bases. 353 pairs of primers were successfully designed and synthesized by Soujin Zhi Biotechnology, Inc.

3. Screening of radish genome SSR primers

And 8 radish varieties are selected for detecting the amplification condition and polymorphism of the SSR markers of the radish genome.

And adopting 353 pairs of synthesized primers to amplify the genomic DNA of 8 parts of materials, and screening the primers which can be stably amplified, have clear banding patterns and are rich in polymorphism according to the amplification result.

According to the screening result, 2-4 pairs of primers (shown in figure 2) with most abundant polymorphism and clear band pattern are selected from each chromosome of radish, and the total number is 21 (table 2).

4. PCR amplification and capillary electrophoresis of 96 radish varieties by using 21 pairs of SSR primers

PCR amplification used a 25. mu.L reaction volume containing 0.25mmol/L of each dNTP, 0.4mol/L of each of the forward and reverse primers, 1.0 unit of Taq DNA polymerase, 1 XPCR buffer (Mg 2 excluded), MgCl21.5 mmol/L, and 10-40ng of sample DNA. The reaction procedure is as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 45s, annealing at 65 ℃ for 45s, and extension at 72 ℃ for 45s, and cooling to 1 ℃ per cycle for 15 cycles; denaturation at 94 ℃ for 45s, annealing at 50 ℃ for 30s, and extension at 72 ℃ for 45s for 30 cycles; extending for 10min at 72 ℃, and storing at 4 ℃.

Capillary electrophoresis was performed according to the following procedure: 6-FAM and HEX fluorescently labeled PCR products were diluted 30 times with ultrapure water and TAMRA and ROX fluorescently labeled PCR products were diluted 10 times. Respectively taking the 4 diluted solutions with the same volume, mixing, sucking 1L of the mixed solution, and adding the mixed solution into a deep-hole plate hole special for a DNA analyzer. 0.1LLIZ500 molecular weight internal standard and 8.9L of deionized formamide were added to each well of the plate. The sample is denatured for 5min at 95 ℃ on a PCR instrument, taken out, immediately placed on crushed ice, and cooled for more than 10 min. The transient centrifugation was carried out for 10s and then placed on a DNA analyzer (ABI3730 XL). Besides the sample to be detected, each SSR locus also comprises amplification products of 3-4 reference varieties.

Analyzing the result of capillary electrophoresis. And determining the size of allelic variation of the site of the sample to be detected according to the size of the amplified fragment of the reference variety. The allelic variation at the homozygous locus is recorded as X/X, the allelic variation at the heterozygous locus is recorded as X/Y, wherein X, Y represents the sizes of two different allelic variation fragments at the locus, wherein the small fragment is before and the large fragment is after. The invalid allelic variation was recorded as 0/0, and the data from multiple loci were integrated to form SSR fingerprints of different radish varieties (Table 3). And (3) judging the detection result of the SSR primer according to 21: the number of the different points of the variety difference between the varieties is more than or equal to 3, and the varieties are different; and (5) determining that the number of the ectopic points of the variety difference between the varieties is less than 3 as an approximate variety to form an identification result. Comparing the fingerprint data of 96 varieties, finding that the number of the difference sites between any two varieties is more than 3, and showing that the 21 pairs of core primers can effectively identify the varieties.

Allele number (Na), gene diversity index (He), and Polymorphism Information Content (PIC) of the primers were calculated using PowerMarker V3.25 software. Genetic similarity coefficients between the varieties were calculated using NTSYS-pc V2.10e software, and subjected to cluster analysis using UPGMA method to prepare a dendrogram (FIG. 3). As can be seen in fig. 3: the genetic similarity coefficient of most varieties is less than 0.05, and all varieties can be distinguished.

TABLE 221 sequences of primers

Serial number	Primer name	Fluorescence	Sequence of the Pre-primer	Rear primer sequence
					1	LB5-2	5′6-FAM	TAACAAGGAAATGGATTACAAAGTC	AAGAGGAGAAACAGTAGTGGAGAAG
2	LB6-35	5′-HEX	TCGACAGCTTTGGCGGCGTACTC	ACCCCCCATTCTCCGATCCTTCTTA
					3	LB8-9	5′-TAMRA	CGGCAAAAATACCATCCTACATAAA	GTCTCTGTTCGCTGCTAATAGTCAAT
4	LB1-15	5′6-FAM	GATAATGATGTTCAGGAAAACGGCA	TCCTGGCATTCATTATGTACTGATTTG
					5	LB6-26	5′-HEX	CTGTGAATGCTTTGTTTTCCCGAC	TTGTGGTTGGTGTTAAAGGATGTGG
6	LB7-20	5′-HEX	GAGTAGAGAGATTTTGCGGGTGTT	TCTCTGTTAAGCAACTTCCTCTGGT
					7	LB2-23	5′6-FAM	CTTCAAGATGACGACAAGAACAGC	ACAACCATACATTAACAAGATCCAA
8	LB9-5	5′-HEX	CGGATAGAGTGAACCTGATGAGAG	GCTGAAGATAGACATTGGAGAGTAAG
					9	LB6-11	5′-ROX	CTTTGCTAAATAAGACGCTGAATACG	GAGAGATTACAGATCGATTTTTGAAGG
10	LB9-35	5′-TAMRA	CTATGGGGAGACAATGCTCAGGT	GAACTATGCTAGGGCTAAAAAACGC
					11	LB7-33	5′-ROX	GAAAGCACAAGAGGAAGTAGACAGAG	TAATCAAGACCTACCAAGAACACAAAC
12	LB7-34	5′-TAMRA	TTATTTCTCAGATTTTCGAGTGATGTG	GAATGGGGGAGGGAGAATAAAGTT
					13	LB1-19	5′6-FAM	GCATGACGGTGAGGATTAAACGC	ATTGGGGGACTAAAATGAAAGGGAG
14	LB5-28	5′-HEX	GAGGAAAACAGAAGCCACAGCAGC	GGTGAAGGAGGACGATGAGTTGATG
					15	LB8-17	5′-ROX	CGACCTCCTCTTGTTTCGTCTGTAG	CATTAAAAAGTGCGTGTGGCTG
16	LB4-23	5′-TAMRA	CTACCGTTTTTAGCACACGCAGC	ATCTTATGTAGGGGGAAGTGTTGGA
					17	LB5-3	5′6-FAM	GTCGCTCGCTGAGGCTAGGCTT	CATTCAACTTGTCCACTTGTTTCTGC
18	LB3-21	5′-HEX	GATAGCAGACAGACCCTCAAAACAG	GGACAGTGCTGCTTATCAGAGGAC
					19	LB3-16	5′-ROX	GAGAGATTCTGATCATTTGGGGGTT	GAGGAGGTTGGGGATAGTGACGAG
20	RS0027	5′-ROX	GACACGCCTCTTCCTTCTTG	TCAAGTACCACTTCCCGAGG
					21	RS0073	5′-TAMRA	ATCGAGACAAGGGAAGGGTT	TCAGTCCATCCAACAGACCA

Table 396 fingerprint data

TABLE 3

SEQUENCE LISTING

<110> institute of agricultural sciences of Shandong province

<120> SSR core primer group developed based on radish whole genome sequence and application thereof

<130> 0

<160> 42

<170> PatentIn version 3.3

<210> 1

<211> 25

<212> DNA

<213> Artificial sequence

<400> 1

taacaaggaa atggattaca aagtc 25

<210> 2

<211> 25

<212> DNA

<213> Artificial sequence

<400> 2

aagaggagaa acagtagtgg agaag 25

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<400> 3

tcgacagctt tggcggcgta ctc 23

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence

<400> 4

accccccatt ctccgatcct tctta 25

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<400> 5

cggcaaaaat accatcctac ataaa 25

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence

<400> 6

gtctctgttc gctgctaata gtcaat 26

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence

<400> 7

gataatgatg ttcaggaaaa cggca 25

<210> 8

<211> 27

<212> DNA

<213> Artificial sequence

<400> 8

tcctggcatt cattatgtac tgatttg 27

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence

<400> 9

ctgtgaatgc tttgttttcc cgac 24

<210> 10

<211> 25

<212> DNA

<213> Artificial sequence

<400> 10

ttgtggttgg tgttaaagga tgtgg 25

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence

<400> 11

gagtagagag attttgcggg tgtt 24

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence

<400> 12

tctctgttaa gcaacttcct ctggt 25

<210> 13

<211> 24

<212> DNA

<213> Artificial sequence

<400> 13

cttcaagatg acgacaagaa cagc 24

<210> 14

<211> 25

<212> DNA

<213> Artificial sequence

<400> 14

acaaccatac attaacaaga tccaa 25

<210> 15

<211> 24

<212> DNA

<213> Artificial sequence

<400> 15

cggatagagt gaacctgatg agag 24

<210> 16

<211> 26

<212> DNA

<213> Artificial sequence

<400> 16

gctgaagata gacattggag agtaag 26

<210> 17

<211> 26

<212> DNA

<213> Artificial sequence

<400> 17

ctttgctaaa taagacgctg aatacg 26

<210> 18

<211> 27

<212> DNA

<213> Artificial sequence

<400> 18

gagagattac agatcgattt ttgaagg 27

<210> 19

<211> 23

<212> DNA

<213> Artificial sequence

<400> 19

ctatggggag acaatgctca ggt 23

<210> 20

<211> 25

<212> DNA

<213> Artificial sequence

<400> 20

gaactatgct agggctaaaa aacgc 25

<210> 21

<211> 26

<212> DNA

<213> Artificial sequence

<400> 21

gaaagcacaa gaggaagtag acagag 26

<210> 22

<211> 27

<212> DNA

<213> Artificial sequence

<400> 22

taatcaagac ctaccaagaa cacaaac 27

<210> 23

<211> 27

<212> DNA

<213> Artificial sequence

<400> 23

ttatttctca gattttcgag tgatgtg 27

<210> 24

<211> 24

<212> DNA

<213> Artificial sequence

<400> 24

gaatggggga gggagaataa agtt 24

<210> 25

<211> 23

<212> DNA

<213> Artificial sequence

<400> 25

gcatgacggt gaggattaaa cgc 23

<210> 26

<211> 25

<212> DNA

<213> Artificial sequence

<400> 26

attgggggac taaaatgaaa gggag 25

<210> 27

<211> 24

<212> DNA

<213> Artificial sequence

<400> 27

gaggaaaaca gaagccacag cagc 24

<210> 28

<211> 25

<212> DNA

<213> Artificial sequence

<400> 28

ggtgaaggag gacgatgagt tgatg 25

<210> 29

<211> 25

<212> DNA

<213> Artificial sequence

<400> 29

cgacctcctc ttgtttcgtc tgtag 25

<210> 30

<211> 22

<212> DNA

<213> Artificial sequence

<400> 30

cattaaaaag tgcgtgtggc tg 22

<210> 31

<211> 23

<212> DNA

<213> Artificial sequence

<400> 31

ctaccgtttt tagcacacgc agc 23

<210> 32

<211> 25

<212> DNA

<213> Artificial sequence

<400> 32

atcttatgta gggggaagtg ttgga 25

<210> 33

<211> 22

<212> DNA

<213> Artificial sequence

<400> 33

gtcgctcgct gaggctaggc tt 22

<210> 34

<211> 26

<212> DNA

<213> Artificial sequence

<400> 34

cattcaactt gtccacttgt ttctgc 26

<210> 35

<211> 25

<212> DNA

<213> Artificial sequence

<400> 35

gatagcagac agaccctcaa aacag 25

<210> 36

<211> 24

<212> DNA

<213> Artificial sequence

<400> 36

ggacagtgct gcttatcaga ggac 24

<210> 37

<211> 25

<212> DNA

<213> Artificial sequence

<400> 37

gagagattct gatcatttgg gggtt 25

<210> 38

<211> 24

<212> DNA

<213> Artificial sequence

<400> 38

gaggaggttg gggatagtga cgag 24

<210> 39

<211> 20

<212> DNA

<213> Artificial sequence

<400> 39

gacacgcctc ttccttcttg 20

<210> 40

<211> 20

<212> DNA

<213> Artificial sequence

<400> 40

tcaagtacca cttcccgagg 20

<210> 41

<211> 20

<212> DNA

<213> Artificial sequence

<400> 41

atcgagacaa gggaagggtt 20

<210> 42

<211> 20

<212> DNA

<213> Artificial sequence

<400> 42

tcagtccatc caacagacca 20

Claims (4)

1. An SSR core primer group developed based on a radish whole genome sequence is characterized by comprising 21 pairs of primers: LB5-2, LB6-35, LB8-9, LB1-15, LB6-26, LB7-20, LB2-23, LB9-5, LB6-11, LB9-35, LB7-33, LB7-34, LB1-19, LB5-28, LB8-17, LB4-23, LB5-3, LB3-21, LB3-16, RS0027 and RS0073, the nucleotide sequence of which is shown in SEQ No.1-42 in sequence.

2. The SSR core primer group developed based on the whole genome sequence of radish according to claim 1 is applied to radish variety diversity analysis.

3. The SSR core primer group developed based on the whole genome sequence of radish according to claim 1 is applied to the construction of the DNA fingerprint of radish.

4. The SSR core primer group developed based on the whole genome sequence of radish according to claim 1 is applied to radish variety identification.