KR102192664B1 - Identification of kiwifruit using SCAR markers and multiplex PCR assays - Google Patents

Abstract

The present invention relates to a method for using multiple sequence characterized amplified region (SCAR) molecular marker assays to identify kiwifruit and, more specifically, to a kiwifruit identification primer set and a kiwifruit identification method and a kiwifruit identification kit using the same. According to the present invention, the kiwifruit identification primer set can correctly identify 30 kiwifruit varieties, thereby being used as a variety authentication technology for preventing variety mixing of distributed seedlings and distributing domestic seedlings, and being used for strengthening the protection rights of domestically grown varieties. Moreover, the SCAR molecular marker used for identifying kiwifruit varieties is not affected by the environment, such as a reaction condition and the like, more than other polymerase chain reaction (PCR) markers, thereby being used as a correct and accurate molecular marker.

Description

Identification of kiwifruit using SCAR markers and multiplex PCR assays}

The present invention relates to a primer set for determining kiwi varieties, a method for determining kiwi varieties using the same, and a kit for determining kiwi varieties as a method for determining kiwi varieties using SCAR molecular marker multi-test.

Kiwi is the fruit of the deciduous vine of the family Actinidia (Morton, J. 1987. Kiwifruit. p. 293-300, "Kiwifruit: Actinidia deliciosa In: Fruits of Warm Climates, 1987"), bluefin, or Chinese Also named gooseberry. In Korea, it was first cultivated in 1977, but it is a fruit with high dependence on foreign countries as kiwi production in 10 countries including China, Italy and New Zealand accounts for 90% of the world. Therefore, as a result of continuing research to develop independent kiwi varieties in Korea, various domestic varieties such as Jesse Gold, Halla Gold, and Haehyang, which are gold kiwi varieties, were cultivated, and the domestic production amount was steadily from 3.6 billion won in 1989 to 46.2 billion won in 2010. This is an increasing trend.

Kiwi is a fruit with a high content of vitamin C, and it contains actinidin, a protein-degrading enzyme, so it not only helps digestion, but also prevents chronic diseases and promotes health, such as phenolic components and flavonoids. Contains a lot of ingredients. In addition, green kiwi (i.e., Actinidia deliciosa variety Hayward) has been attracting attention as an effective product in the area of digestion through several studies demonstrating its effectiveness at present (Stonehouse et al., 2012 and Chinese Patent Application No. 2967263). It has been disclosed that the effect of removing impurities of green kiwi is mainly due to dietary fiber and actinidin (enzyme) contained in green kiwi (Chang et al., 2010; Rush et al., 2002; Stonehouse et al., 2012; Drummond & Gearry 2013) ). On the other hand, gold kiwi (i.e. Actinidia chinensis variety Hort16A) has not been associated with defecation so far (Ferguson 2003; Rush 2002). Gold kiwis have been known to contain little or no actinidin and less fiber when compared to green kiwis. Some varieties of kiwi have been studied for immune effects (Hunter et al. 2012; Skinner 2012), and gold kiwis with low or low impurity removal effects may increase immunity, especially in children where an increase in impurity removal may be undesirable. There were also claims (Adaim 2010). As such, since nutrients and intake effects are different depending on the kiwi variety, it is required to accurately distinguish kiwi varieties.

However, since all domestically grown varieties of fruit trees are supplied in the state of seedlings, it is difficult to distinguish them in morphology, so the demand for the development of molecular labeling technology for the identification of varieties is increasing in leading fruit tree seedling companies. Accordingly, the present inventors completed the present invention by developing a molecular label for discrimination of kiwi varieties to prevent cultivar mixing of distributed seedlings and strengthen protection rights of domestically grown varieties.

The present invention is a first primer set consisting of the primers represented by SEQ ID NOs: 1 to 10; And/or a second primer set consisting of primers represented by SEQ ID NOs: 11 to 20. An object thereof is to provide a primer set for determining kiwi varieties.

In addition, an object of the present invention is to provide a kit for determining kiwi varieties comprising the primer set.

In addition, the present invention a) extracting genomic DNA from a sample; b) amplifying the extracted genomic DNA with the primer set; And c) determining whether genomic DNA is amplified or not.

According to one embodiment, the present invention comprises a first primer set consisting of the primers represented by SEQ ID NOs: 1 to 10; And/or it provides a primer set for determining kiwi variety comprising a second primer set consisting of the primers represented by SEQ ID NOs: 11 to 20.

The primer set includes primers using SCAR molecular markers capable of discriminating 30 previously developed kiwi varieties, and may be used for multiplex PCR (multiplex PCR) that simultaneously detects a plurality of genes or nucleotide sequences. have.

The sequence characterized amplified region (SCAR) molecular label is used to check the presence or absence of a band by the allele-specific associated primer (ASAP) method, and is relatively insensitive to the amplification environment compared to other molecular markers, and the results can be easily read. Therefore, it is recognized as an efficient molecular marker for cultivar identification with reproducibility, universality and simplicity. Therefore, it can be used as a more precise and detailed primer.

The primer refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be amplified, and may serve as an starting point for synthesis of a primer extension product. The length and sequence of the primers should allow the synthesis of the extension product to begin.

In addition, according to another embodiment, the present invention provides a kit for determining kiwi varieties comprising the primer set.

The primer set may include, for example, a first primer set consisting of primers represented by SEQ ID NOs: 1 to 10; Or a second primer set consisting of primers represented by SEQ ID NOs: 11 to 20, or a first primer set consisting of primers represented by SEQ ID NOs: 1 to 10; And a second primer set consisting of primers represented by SEQ ID NOs: 11 to 20. Preferably, it may include both the first primer set and the second primer set.

The kiwi varieties are 30 kinds of kiwi varieties, Bulgi, Deliung, First Emperor, Gamwang, Gamnok, Golden Ball, Goldwon, Gold Rush, Green Mall, Halla Gold, Hayward, Hongyang, Hort16A, Jesse Gold , Jesse Green, Mega Gold, NHK12, NHK13, NHK41, NHK42, Nokga, Octo Green, Bohwa, Book, Red Vita, Sensation Apple, Skinny Green, Sonoku, Sunfl and Sweet Gold Sweetgold) may be one or more selected from the group consisting of.

In addition, according to another embodiment, the present invention comprises the steps of: a) extracting genomic DNA from a sample; b) amplifying the extracted genomic DNA with the primer set; And c) determining whether or not genomic DNA is amplified.

Step a) is a process of extracting genomic DNA from kiwi.

At this time, the genomic DNA extraction method can be used without limitation, methods known in the art, for example, CTAB (cetyltrimethylammonium bromide) method, phenol/chloroform extraction method, SDS extraction method, etc., or commercially available DNA extraction kits can be used. have.

Step b) is a process of amplifying the genomic DNA of kiwi using a primer set capable of identifying kiwi varieties.

At this time, more than one primer set may be used, and a plurality of primers may be used at the same time to more accurately identify kiwi varieties.

For example, the primer set includes a first primer set consisting of primers represented by SEQ ID NOs: 1 to 10; And a second primer set consisting of primers represented by SEQ ID NOs: 11 to 20. At this time, when genomic DNA is amplified with the primer set, kiwi varieties are selected from Bulgi, Deliung, First Emperor, Gam Hwang, Gamnok, Golden Ball, Gold One, Gold Rush, Green Mall, Halla Gold, Hayward, and Hongyang. , Hort16A, Jesse Gold, Jesse Green, Mega Gold, NHK12, NHK13, NHK41, NHK42, Nokga, Octo Green, Bohwa, Book, Red Vita, Sensation Apple, Skinny Green, Songoku, Sunfl ) Or Sweetgold.

The genomic DNA amplification method may be performed by PCR (polymerase chain reaction). PCR may be performed using a PCR reaction mixture containing components known to be necessary for a PCR reaction in the art or using a commercially available kit. The PCR reaction mixture may include genomic DNA extracted from kiwi, the primer set, an appropriate amount of DNA polymerase, dNTP, PCR buffer, and water. The PCR buffer solution may include Tris-HCl, MgCl ₂ , KCl, and the like.

The amplified target sequence (amplification product) can be labeled with a detectable label. For example, the labeling material is a labeling material known in the art, and may be a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling material may be Cy-5 or Cy-3. When amplifying the target sequence, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence may be labeled with a detectable fluorescent labeling material. In the case of using a radioactive material as a labeling material, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution during PCR, the amplification product is synthesized, and the radioactive isotope may be incorporated into the amplification product to be radiolabeled. Meanwhile, the amplification product can be visualized using a silver dyeing kit (Bioneer, Daejeon, Korea).

Step c) is a process of analyzing the amplified DNA product.

Analysis of the amplified DNA product may be performed without limitation using an analysis method known in the art, for example, capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement.

For example, capillary electrophoresis may be performed to detect an amplification product, and may be performed using an ABI sequencer, but is not limited thereto. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product. For example, 6% acrylamide gel electrophoresis can be used. For example, 1 to 5%, preferably 1.4% agarose gel electrophoresis can be used. In addition, the fluorescence measurement method is to label Cy-5 or Cy-3 at the 5'-end of the primer and perform PCR, and the target sequence is labeled with a detectable fluorescent labeling material, and the thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution when performing PCR, and then using a radioactivity measuring instrument such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

When the amplified DNA product is analyzed using gel electrophoresis, the amplified product is electrophoresed on an agarose gel or an acrylamide gel, and the band can be confirmed by EtBr (Ethidium Bromide), silver staining, etc. .

Since the primer set for kiwi variety identification according to the present invention can accurately identify 30 kiwi varieties, it can be used as a variety authentication technology for prevention of variety mixing in distribution seedlings and distribution of domestic seedlings, and protection rights of domestically grown varieties. It can be used to strengthen. In addition, SCAR molecular markers used to identify kiwi varieties can be used as more accurate and detailed molecular markers because they are not affected by the environment such as reaction conditions compared to other PCR markers.

1 shows a gel electrophoresis result using a primer set for determining kiwi varieties according to an embodiment of the present invention, (a) is a first primer set, (b) is a result of the second primer set.

Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings. However, the following examples are described for the purpose of illustrating the present invention, and the scope of the present invention is not to be construed as being limited by the following examples.

1. DNA extraction

DNA was extracted by collecting young leaves of kiwi varieties as shown in Table 1 below, planted at the National Institute of Horticultural Science and Technology of the Rural Development Administration.

number kind number kind One Drops 16 Mega Gold 2 Deliung 17 NHK12 3 First empire 18 NHK13 4 Yellow 19 NHK41 5 Dark green 20 NHK42 6 Golden Ball 21 Rust 7 Gold One 22 Octogreen 8 Gold rush 23 Treasure 9 Green Mall 24 Gemstone 10 Halla Gold 25 Red Vita 11 Hayward 26 Sensation Apple 12 Hongyang 27 Skinny green 13 Hort16A 28 Son Ogong 14 Jesse Gold 29 Sunple 15 Jesse Green 30 Sweet Gold

Young leaves of kiwi were collected and genomic DNA was extracted using the DNeasy plant mini kit (Qiagen, Valencia, CA, USA). The extracted DNA was confirmed by electrophoresis on a 0.8% agarose gel, and the amount of DNA was quantified with a NanoDrop spectrophotometer (Thermo Fisher Scientific, MA, USA), and then diluted to a concentration of 5 ng·μL-1 and used for PCR analysis.

2. PCR analysis

For the extracted kiwi DNA, PCR was performed twice using the first primer set and the second primer set as shown in Table 2, respectively.

First primer set Primer number Base sequence (5'> 3') Amplification products
Size (bp) One F: GTCCACACGGAGACAGTTGACC (SEQ ID NO: 1)
R: GTCCACACGGCCTTAAATACTCA (SEQ ID NO: 2) 182 2 F: GTCAGGGCAACAAGGTGTGTAC (SEQ ID NO: 3)
R: GTCAGGGCAATGACTAGAGAAAAT (SEQ ID NO: 4) 295 3 F: CCGATATCCCTTGATCATAAAAAAATG (SEQ ID NO: 5)
R: CCGATATCCCATCCTTCCCCACC (SEQ ID NO: 6) 433 4 F: CTGACGTCACCAACAAATTTGCA (SEQ ID NO: 7)
R: CTGACGTCACATACCTTAGAAAAA (SEQ ID NO: 8) 468 5 F: GGCATGACCTGACACGATTAAAA (SEQ ID NO: 9)
R: ACGAAACCCTAAGAAAATCACAAG (SEQ ID NO: 10) 764 2nd primer set Primer number Base sequence (5'> 3') Amplification products
Size (bp) 6 F: ACTGGGTGAGAGGAACTTAGTCAC (SEQ ID NO: 11)
R: GAACATGGGTTCAAACAGAACTTT (SEQ ID NO: 12) 287 7 F: CAGCGACTGTATGGTATAGACATG (SEQ ID NO: 13)
R: CAGCGACTGTGGATGTCTTTATC (SEQ ID NO: 14) 316 8 F: CTACGGAGGACAAATCGAGTTC (SEQ ID NO: 15)
R: GAGTAATGAGCAACAGAGCAAGTC (SEQ ID NO: 16) 411 9 F: GAACGTTGAATTGGTAGACAGCTA (SEQ ID NO: 17)
R: GTCACGGTTCAATAACGGTTG (SEQ ID NO: 18) 477 10 F: AGCCACCACTACCCATCTACTATC (SEQ ID NO: 19)
R: CAATCGCCGTTATTGCTACTGAG (SEQ ID NO: 20) 774, 892 *F; Forward primer, R; Reverse primer

The PCR reaction was carried out in a total of 15 μL reaction solution with 20 ng of genomic DNA, 200 μM dNTP, 5 pmol first or second primer set, 1ХPCR buffer (Genetbio), and 0.5 Unit Hot- to minimize non-specific DNA amplification during PCR reaction. It was performed by adding start Taq DNA polymerase (Genetbio).

PCR temperature conditions were: After denaturing the template DNA at 95°C for 10 minutes, the reaction was terminated after 30 times at 95°C for 30 seconds, at 63°C for 30 seconds, and at 72°C for 1 minute 30 times, followed by treatment at 72°C for 5 minutes. The amplified PCR product was confirmed by electrophoresis on a 1.4% agarose gel. The results are shown in Table 3 and FIG. 1 below.

Primer set primer Variety number One 2 3 4 5 6 7 8 9 10 11 12 13 14 15 One One 0 0 One One 0 0 One One 0 0 One 0 0 One 0 One 2 One One 0 0 One 0 0 0 0 0 One 0 0 0 0 One 3 One 0 0 0 0 0 0 0 0 0 One 0 0 0 0 One 4 0 0 0 0 0 0 One 0 0 0 0 0 0 One 0 One 5 One 0 One 0 0 0 0 0 0 0 One 0 One One One 2 6 0 One 0 0 0 0 0 0 0 0 One 0 0 0 0 2 7 0 0 0 0 0 0 0 0 0 0 One 0 0 0 0 2 8 One 0 0 0 0 0 0 0 One 0 0 0 0 0 0 2 9 0 One One 0 0 One 0 0 0 One 0 0 0 One One 2 10-1 0 One One One One 0 0 One 0 One 0 0 0 One One 2 10-2 One One One 0 One One One One One 0 One One One 0 One Total number of amplified fragments 5 5 5 2 3 3 3 3 2 2 7 One 2 5 4 Primer set primer Variety number 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 One One 0 One One One 0 0 One 0 One 0 0 0 One One One One 2 0 0 0 One One 0 One One One 0 0 0 0 0 0 One 3 0 0 0 0 0 0 One One 0 0 0 0 0 0 0 One 4 0 0 One 0 0 0 0 0 0 0 0 0 0 0 One One 5 One 0 0 0 0 0 One One One 0 0 0 One 0 0 2 6 0 0 0 One 0 0 One One One 0 0 0 0 0 0 2 7 0 0 0 0 0 0 0 One 0 0 0 0 0 0 0 2 8 0 0 0 0 0 One 0 0 0 0 0 One 0 0 0 2 9 0 One One One One One 0 0 0 0 One 0 0 0 0 2 10-1 One 0 One 0 One One 0 0 0 One One 0 One 0 One 2 10-2 One One 0 One One One One One One 0 One 0 0 One 0 Total number of amplified fragments 3 3 4 5 4 4 6 6 5 One 3 One 3 2 3 *One; With breed-specific marker, 0; No breed-specific markers.

As a result of using the first primer set consisting of the primers of SEQ ID NOs: 1 to 10 and the second primer set consisting of the primers of SEQ ID NOs: 11 to 20, specific markers were observed differently for each kiwi variety. Therefore, when using a primer set including the first primer set and the second primer set according to the present invention, 30 kinds of kiwi varieties can be accurately identified.

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Identification of kiwifruit using SCAR markers and multiplex PCR assays <130> RDA-P190104 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer 1_F <400> 1 gtccacacgg agacagttga cc 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer 1_R <400> 2 gtccacacgg ccttaaatac tca 23 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer 2_F <400> 3 gtcagggcaa caaggtgtgt ac 22 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 2_R <400> 4 gtcagggcaa tgactagaga aaat 24 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer 3_F <400> 5 ccgatatccc ttgatcataa aaaaatg 27 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer 3_R <400> 6 ccgatatccc atccttcccc acc 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer 4_F <400> 7 ctgacgtcac caacaaattt gca 23 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 4_R <400> 8 ctgacgtcac ataccttaga aaaa 24 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer 5_F <400> 9 ggcatgacct gacacgatta aaa 23 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 5_R <400> 10 acgaaaccct aagaaaatca caag 24 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 6_F <400> 11 actgggtgag aggaacttag tcac 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 6_R <400> 12 gaacatgggt tcaaacagaa cttt 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 7_F <400> 13 cagcgactgt atggtataga catg 24 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer 7_R <400> 14 cagcgactgt ggatgtcttt atc 23 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer 8_F <400> 15 ctacggagga caaatcgagt tc 22 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 8_R <400> 16 gagtaatgag caacagagca agtc 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 9_F <400> 17 gaacgttgaa ttggtagaca gcta 24 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer 9_R <400> 18 gtcacggttc aataacggtt g 21 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer 10_F <400> 19 agccaccact acccatctac tatc 24 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer 10_R <400> 20 caatcgccgt tattgctact gag 23

Claims (8)

A first primer set consisting of primers represented by SEQ ID NOs: 1 to 10; And/or
A primer set for determining kiwi varieties comprising a second primer set consisting of primers represented by SEQ ID NOs: 11 to 20.
The method according to claim 1,
The primer set is for use in multiplex PCR (multiplex PCR), a primer set.
Kit for determining kiwi varieties comprising the primer set of claim 1.
The method of claim 3,
The primer set includes a first primer set consisting of primers represented by SEQ ID NOs: 1 to 10; And
A kit comprising a second primer set consisting of primers represented by SEQ ID NOs: 11 to 20.
The method of claim 3,
The kiwi varieties are Bulgi, Deliung, First Emperor, Gamwang, Gamnok, Golden Ball, Gold One, Gold Rush, Green Mall, Halla Gold, Hayward, Hongyang, Hort16A, Jesse Gold, Jesse Green, Mega Gold, Selected from the group consisting of NHK12, NHK13, NHK41, NHK42, Nokga, Octogreen, Bohwa, Book, Red Vita, Sensation Apple, Skinny Green, Sonoku, Sunfl, and Sweetgold One or more kits.
a) extracting genomic DNA from the sample;
b) amplifying the extracted genomic DNA with the primer set of claim 1; And
c) Checking whether genomic DNA has been amplified
Kiwi variety determination method comprising a.
The method of claim 6,
The primer set includes a first primer set consisting of primers represented by SEQ ID NOs: 1 to 10; And
The method comprising a second primer set consisting of the primers represented by SEQ ID NOs: 11 to 20.
The method of claim 6,
When genomic DNA is amplified with the above primer set, kiwi varieties are selected from Bulgi, Deliung, First Emperor, Gam Hwang, Gamnok, Golden Ball, Gold One, Gold Rush, Green Mall, Halla Gold, Hayward, Hongyang, Hort16A. , Jessie Gold, Jessie Green, Mega Gold, NHK12, NHK13, NHK41, NHK42, Nogga, Octo Green, Bohwa, Book, Red Vita, Sensation Apple, Skinny Green, Sonoku, Sunfl or Sweet gold (Sweetgold) is to determine the method.

Images