KR101959732B1 - Primers for detecting SSR markers specific to allotetraploid mandarin orange and uses thereof - Google Patents

Abstract

The present invention relates to primers for detecting SSR markers specific to allotetraploid mandarin orange and uses thereof, and specifically, to a kit and a composition for screening allotetraploid mandarin orange comprising a pair of primers consisting of the nucleotide sequences represented by SEQ ID NOs: 1 and 2, and a method for screening allotetraploid mandarin orange using the composition. The composition of the present invention can be used for cultivating new mandarin orange cultivars by easily screening allotetraploid mandarin orange including nucleus DNA of both navel orange and fruits of Fortunella margarita, thereby exhibiting both characteristics of the two cultivars.

Description

TECHNICAL FIELD [0001] The present invention relates to primers for detecting dicentric tetraploid citrus-specific SSR markers, and their uses. [0002] Primers for detecting SSR markers include,

TECHNICAL FIELD The present invention relates to a primer for detecting a tetraploid citrus-specific SSR marker and a use thereof, and more particularly, to a composition for screening citrus tetraploid citrus comprising a pair of primers consisting of the nucleotide sequences shown in SEQ ID NOS: 1 and 2, And a method for screening for a heterozygous citrus fruit using the composition.

Citrus is one of the most important crops in the world because of its economic and nutritional value. It plays an important role in the Jeju Island industry, accounting for more than 82% of Jeju Island's total area (Ministry of Agriculture, Food and Rural Affairs, 2015). However, the majority of the citrus fruits currently cultivated in Jeju Island are cultivars imported from Japan, and there is a problem that they have to pay huge royalties, so that interest in the cultivation of new variety citrus is increasing.

Plant sarcoma has consisted mainly of selection of mutants by mutagenesis by hybridization with the aim of introducing useful traits lacking in the cultivar, either from near or from annual plants. However, breeding by artificial hybridization is only possible in case of sexual compatability, which is a hindrance to the introduction of useful genetic qualities. These problems, which have become obstacles to traditional breeding methods, have been gradually solved as in vitro breeding has been developed.

Particularly, in citrus fruit, somatic hybridization technique using somatic hybridization protoplast fusion technology is usefully used for breeding of new varieties and commercial varieties. When the protoplasts are fused, not only the cytoplasmic bodies such as chloroplasts and mitochondria are fused, but also plants such as heterozygotes, in which nuclei of each other are fused, are produced. These represent intermediate types of the basic species derived from the relevant traits, The possibility of use as a breeding material is appreciated.

On the other hand, according to the development of molecular biology, various methods for early selection of a plant that can be used as a material for cultivating a new citrus variety have been suggested. For example, random amplified polymorphism DNA (RAPD), restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), cleaved amplified polymorphic sequences (CAPS) and single nucleotide polymorphism (SNP) sequence characterized amplified region marker has been developed (Korean Patent Publication No. 10-1099624).

Under these circumstances, the present inventors have made intensive efforts to develop a method for easily selecting a plant which can be used as a material for cultivating a new variety of citrus fruits. As a result, it has been found that a specific SSR marker of a tetraploid citrus fused with navel orange and gold- The inventors of the present invention have completed the present invention by confirming that when the primer is used, a heterozygous citrus fruit which can be used for developing a new variety having both navel orange and nuclear fusion DNA can be easily selected .

One object of the present invention is to provide a composition for screening citrus tetraploid citrus comprising a pair of primers consisting of the nucleotide sequences represented by SEQ ID NOS: 1 and 2.

Another object of the present invention is to provide a kit for screening citrus tetraploid citrus comprising said composition.

It is still another object of the present invention to provide a method for isolating citrus fruits, which comprises (a) amplifying a nucleic acid using a genomic DNA derived from citrus as a template, And (b) analyzing the resulting amplification product.

In order to achieve the above object, one embodiment of the present invention provides a composition for screening citrus quadruplet citrus comprising a pair of primers consisting of the nucleotide sequences shown in SEQ ID NOs: 1 and 2.

In the present invention, a primer capable of detecting SSR markers specific to the nuclear DNA of Navel orange and nucleus DNA of flaxseed was developed in order to develop citrus fruits in which navel orange and fennel characteristics are expressed together. It was confirmed that the heterozygous tetraploid citrus containing both the nuclear DNA and the nuclear DNA of the ginseng can be easily selected. Furthermore, it was confirmed that the heterozygous citrus citrus selected using the primer exhibited all the useful characteristics of the navel orange and gold Respectively.

The term "heterozygote citrus citrus" of the present invention means a citrus fruit containing both nuclear DNA of two different citrus varieties. In plants, tetraploids are used as an example of a breeding method, and unlike homogeneous polyploids, heteropolyploids represent the intermediate type of the basic species derived from the trait or have a new trait.

In the present invention, the heterozygous citrus citrus can be a citrus fruit which is prepared by fusing a navel orange and a goldfish, that is, a nuclear DNA of nable orange and nuclear DNA of a goldfish.

The term "navel orange" of the present invention means fruit of an orange tree. Nable orange is the most widely grown sweet orange in the world with valencia orange. It has high sugar content and low acidity. It is mainly used for life and work. It is different from Valencia orange. There are various varieties of nable oranges such as Gilbang, Washington, Thomson, Robatson, Naveline, Navelate and the like. Specifically, the nable orange of the present invention may be nail orange, but is not limited thereto.

The term "fencing" of the present invention means fruit of Fortunella japonica var. Margarita , also referred to as kumquat or kukkang. In general, the ginseng is thin and the skin is ingested. The skin is sweet but the flesh is brisk and has a sour taste. There are a variety of varieties such as long-lived, long-lived, vacant, nondominant, and the like. Specifically, the fence of the present invention may be a fence, but is not limited thereto.

The term "composition for screening citrus tetraploid citrus fruits" of the present invention means a composition for distinguishing, sorting, discriminating or identifying citrus fruits containing both nuclear DNA of two different citrus cultivars. In the present invention, a citrus fruit in which the high sugar content of nable orange and the perishable characteristics of citrus fruit are simultaneously developed, the composition may be selected from a heterogeneous tetraploid citrus fused with navel orange and goldfish.

The term "primer" of the present invention can form a base pair with a template complementary to a base sequence having a short free 3 'hydroxyl group, Means a short sequence functioning as a starting point. Primers used in the present invention for use in SNP marker amplification can be amplified by PCR using appropriate conditions in suitable buffers (e. G., 4 different nucleoside triphosphates and polymeric agents such as DNA, RNA polymerase or reverse transcriptase) Stranded oligonucleotide which can serve as a starting point of DNA synthesis. The appropriate length of the primer may be varied depending on the purpose of use, but it may be generally 15 to 30 nucleotides. The primer sequence is not necessarily completely complementary to the polynucleotide comprising the SNP marker or its complementary polynucleotide, and can be used if it is sufficiently complementary to hybridize. In addition, the primer can be modified and can be modified, for example, by methylation, capping, substitution of nucleotides or modifications between nucleotides, for example, uncharged linkers such as methylphosphonate, phosphotriester, phosphoramidate, Carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

Specifically, the primer can detect an SSR marker specific to a heterozygous citrus fruit fused with nable orange, gilt or navy orange, and a fissure, and can detect the SSR marker in a pair.

Herein, the term "SSR" (simple sequence repeat) means a simple repeating base sequence on a DNA sequence used to identify an individual or a species. SSR shows high reproducibility and can be easily analyzed by PCR method and can be used in various fields such as linkage map creation, marking selection, direct relationship analysis, and evolutionary research.

More specifically, the composition of the present invention may comprise a primer pair consisting of the nucleotide sequences shown in SEQ ID NOs: 1 and 2.

Further, for the purposes of the present invention, the composition may be selected from heterozygous citrus fruits expressing both the high sugar content of nable orange and the non-seedable properties of navel orange, . The seedless nature is attributed to the genes contained in the mitochondria of the navel orange. The heterozygous citrus orange contains the nuclear DNA of navel orange and nuclear DNA of the goldfish, and additionally contains the mitochondrial DNA of nable orange. .

Thus, the composition of the present invention may further comprise a pair of primers consisting of the nucleotide sequence shown in SEQ ID NOs: 5 and 6, which can detect mitochondrial-specific molecular markers of nable orange.

On the other hand, the pair of primers consisting of the nucleotide sequences shown in SEQ ID NOS: 3 and 4 can detect SSR markers specific to the heterozygous citrus fused with navel orange, goldfish, or navel orange and goldfish, The composition of the present invention is characterized in that it comprises a pair of primers consisting of the base sequences shown in SEQ ID NOS: 1 and 2, but not the other base sequences.

The sequences used in the present invention are interpreted to include sequences showing substantial identity with the sequences listed in the sequence listing, considering mutations having biologically equivalent activity. The term "substantial identity" means aligning the sequence of the present invention to any other sequence as closely as possible and, when analyzing the aligned sequence using algorithms commonly used in the art, Means a sequence showing 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology.

Therefore, a sequence having high homology with the sequence shown in SEQ ID NO: 1 to 6 according to the present invention, for example, a homology thereof of 70% or more, specifically 80% or more, more specifically 90% or more Are also to be construed as falling within the scope of the present invention.

In one specific embodiment of the present invention, in order to select a heterozygous citrus fruit including all of the nuclear DNA of the Gill Navel orange and the nuclear DNA of the galactosyltransfer, SSR markers specific to nuclear DNA of the two varieties can be detected Primers were prepared (Table 1), and it was confirmed that primer pairs of SEQ ID NOs: 1 and 2 among the primers can detect the SSR markers (FIGS. 2 to 5). In addition, it was confirmed that the primer pairs of SEQ ID NOS: 5 and 6 were able to detect mitochondrial-specific markers of Nile orange (FIG. 6). Furthermore, it was confirmed that the horny tetraploid citrus fruits had a reduced thickness of the perianth compared to the nable orange and showed high sugar content without seeds (FIG. 7 and Table 2).

This suggests that the composition comprising the primer pair can be usefully used for the screening of a heterozygous citrus fruit containing both navel orange and gold nucleus DNA and mitochondrial DNA of nable orange, Among the primer pairs produced by the design, in particular, the primer pairs of SEQ ID NOS: 1 and 2 above can be usefully used for screening of the above-mentioned tetraploid citrus fruits. Further, the primer pairs of SEQ ID NOS: 5 and 6 suggest that dicotyledonous citrus fruits containing mitochondrial DNA of nable orange among the alien tetraploid citrus fruits can be selected.

Another embodiment of the present invention provides a quinquerad citrus screening kit comprising the above composition.

At this time, the description of the "heterozygote citrus citrus" is as described above.

In the kit of the present invention, it is possible to select a heterozygous citrus fruit containing all of the nuclear DNA of navel orange and goldfish using the above composition. Specifically, the kit may be a reverse transcription polymerase chain reaction (RT-PCR) kit, a DNA analysis kit (eg, a DNA chip) kit, but is not limited thereto.

As one example, the kit provided in the present invention may be a kit containing the necessary elements necessary for performing RT-PCR. In addition to the primers of the present invention, the RT-PCR kits can also include test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as Taq polymerase and reverse transcriptase, RNAse inhibitors, DEPC-water, sterile water, and the like.

As another example, the kit of the present invention may be a DNA chip kit containing essential elements necessary for carrying out a DNA chip.

Here, the term "DNA chip" means one of DNA microarrays capable of identifying each base of hundreds of thousands of DNAs at a time. The DNA chip kit is generally formed by attaching nucleic acid species to a glass surface that is not larger than a flat solid support plate, typically a slide for a microscope, in a gridded array. The nucleic acid is uniformly arranged on the chip surface, Hybridization reaction occurs between the nucleic acid on the surface and the complementary nucleic acid contained in the solution treated on the surface of the chip to enable a mass parallel analysis.

Another aspect of the present invention is a method for isolating citrus fruits, comprising the steps of: (a) amplifying a nucleic acid using a genomic DNA derived from citrus as a template and using the composition for screening citrus tetraploid citrus; And (b) analyzing the resulting amplification product.

Specifically, the step (a) is a step of amplifying a heterozygous tetraploid citrus-specific SSR marker including all of nucleolar DNA of dysenteric tetraploid citrus, specifically nable orange and gilt. The SSR markers can be amplified by a pair of primers consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2 of the present invention.

The amplification can be carried out by any method known to those skilled in the art, and specific examples include PCR, ligase chain reaction (LCR), transcription amplification, self-sustaining sequence replication or nucleic acid-based sequence amplification (NASBA).

Here, the genomic DNA may be derived from citrus seed, leaf, stem, fruit, or a combination thereof, but is not limited thereto.

In addition, the step (b) may include a step of comparing and analyzing the obtained amplification products, but not limited thereto, by a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Specifically, when detecting through gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the amplification product size. In the case of detection through fluorescence measurement, fluorescence can be measured using a fluorescence analyzer after carrying out PCR using a primer pair of the present invention labeled with a fluorescent substance. When detecting by radioactivity, the radioactive material is added to the PCR reaction solution to label the amplified product, and the radioactivity is measured using a radiometer such as a Geiger counter or a liquid scintillation counter .

Finally, the method may further include the step of (c) judging the amplified product to be a heterozygous citrus citrate when the size of the amplified product is the same as the product obtained by amplifying genomic DNA derived from navel orange and goldfish.

In a specific embodiment of the present invention, PCR was carried out on the genomic DNA extracted from the leaves of a tetraploid citrus tree containing all of nuclear DNA of Gill Navel orange and flax seeds using the primer pairs of SEQ ID NOS: 1 and 2 PCR amplification products were analyzed by gel electrophoresis. As a result, it was confirmed that the heterogeneous tetraploid citrus fruits exhibited an amplification product of the same size as that of the navel orange and the flax seedling (Figs. 2 to 5). Furthermore, it was confirmed that the horny tetraploid citrus fruits had a reduced thickness of the perianth compared to the nable orange and showed high sugar content without seeds (FIG. 7 and Table 2).

This suggests that the method of the present invention using the above primer pair can easily select a heterozygous citrus fruit which includes both navel orange and gold nucleus DNA and exhibits navel orange and fennel characteristics together.

The composition of the present invention can be used for cultivating new citrus cultivars because it can easily discriminate heterogeneous tetraploid citrus fruits including both navy orange and gold nucleus DNA and exhibiting both characteristics of the two varieties.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a flow cytometric analysis result of a tetraploid citrus plant of the present invention. FIG. 1 is a graph showing the result of flow cytometry analysis of a tetraploid citrus plant of the present invention, wherein A is a nail gill orange, B is a persimmon ginseng plant, Lt; / RTI > citrate ").
FIG. 2 is an electrophoresis image showing the results of performing PCR using primers (SEQ ID NOS: 1 and 2) for nuclear DNA-specific SSR marker detection according to the present invention. A1 is a size marker, A2 is a nail-first orange, C1 is a hallucinogen, A4-A12, and B1-B12 are related to the above-mentioned tetraploid citrus.
3 is a chromatogram obtained by performing PCR using primers (SEQ ID NOS: 1 and 2) for detecting nuclear DNA-specific SSR markers according to the present invention and analyzing the amplified products thereof and showing them as peaks. A is Nile orange, B is Salmonella, and C is a tetraploid citrus.
4 is an electrophoresis image showing the result of performing PCR using primers (SEQ ID NOS: 3 and 4) for detecting nuclear DNA-specific SSR markers according to the present invention. A1 is a size marker, A2 is a nail orange before ailment, A3 is a hallowed hallmark, and A4 to A12 and B1 to B7 are related to the above-mentioned tetraploid citrus.
FIG. 5 is a chromatogram obtained by performing PCR using primers (SEQ ID NOS: 3 and 4) for nuclear DNA-specific SSR marker detection according to the present invention and analyzing the amplified products thereof and showing them as peaks. A is Nile orange, B is Salmonella, and C is a tetraploid citrus.
FIG. 6 is an image showing the result of performing PCR using primers (SEQ ID NOS: 5 and 6) for detecting mitochondria-specific markers according to the present invention, in which A1 is a size marker, A2 is a pregabal navel orange, And C11, C12, D1 to D12, E1 and E2 are related to the above-mentioned tetraploid citrus fruits.
FIG. 7 is an image showing the morphology of a tetraploid citrus fruit selected using the primer of the present invention, wherein A represents a fruit section and B represents a fruit plane. In this case, "K" stands for a banquet hall, "G" stands for a navel orange, "G" stands for a giant tetraploid citrus fused with a nile orange and a hallucinogen.

Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example 1: Preparation of a heterogeneous tetraploid citrus fruit

In order to develop a variety of citrus fruits that can eat peel and flesh together with high sugar content and without seeds, it first contains all of the nuclear DNA of the Gill Navel Orange and the nuclear DNA of the follicular gland, and the dysentery 4 containing the mitochondrial DNA of Gill Navel Orange Citrus fruits. On the other hand, nable oranges are characterized by high sugar content and no seeds, and they are characterized by the fact that they have thin skin and can be eaten.

Specifically, cell fusions were carried out using PEG solution by a method known in the art, using a callus of Nile orange or a leaf tissue of a fusarium saplings as a material. The fused cells were cultivated in an appropriate medium and regenerated to prepare a dicentric tetraploid citrus plant (hereinafter, referred to as "heterozygous citrus citrus") of Gil Navel orangewan. Drainage of the heterotrophic citrus fruits was assayed by flow cytometry.

As a result, as shown in FIG. 1, it was confirmed that the heterozygous tetraploid citrus fruits were fused with nuclear DNA (diploid) and nuclear DNA (diploid) Respectively.

Example 2. Screening method for citrus tetraploid citrus fruit

Among the heterozygous tetraploid citrus fruits prepared in Example 1, it was tried to select a heterozygous citrus fruit having the nucleus DNA of the nailleaf orange and the nuclear DNA of the navelle orange, and further the mitochondrial DNA of the nile orange.

Specifically, SEQ ID NOS: 1 and 2, which can detect SSR sequences specific to the nuclear DNA of Gil Navel orange and simultaneously detect SSR sequences specific to the nuclear DNA of the silkworm; Or 3 and 4 primers were prepared. In addition, primers of SEQ ID NOS: 5 and 6 were prepared which can detect sequences specific to the mitochondrial DNA of Nile orange. The primer sequences of SEQ ID NOS: 1 to 6 are summarized in Table 1 below.

Detection site The primer (5 '- > 3') Fragment length (bp) navel
Orange Fence nucleus SEQ ID NO: 1 CATCACCACCACAGCAACAA 148 107, 116, 129 SEQ ID NO: 2 TTCAGGTGAAAGCCCCTCT SEQ ID NO: 3 AACCCACCAACGCATTCTTC 159, 175, 180 151, 156, 164, 176 SEQ ID NO: 4 GGATGCGACTTCAATGGTCC Mitochondria SEQ ID NO: 5 GTGTTGCTGAGACATGCGCC 88, 175, 423 86, 251, 406, 564 SEQ ID NO: 6 ATATGGCGCAAGACGATTCC

Then, the genomic DNA extracted from the citrus leaves was subjected to PCR by a known method using the above primers to analyze nuclear DNA and mitochondrial DNA of the plant.

As a result, as shown in FIG. 2, it was confirmed that the primers 1 and 2 produced an amplification product which was distinguished from the nuclear DNA of the nailleaves orange and the nuclear DNA of the cytoplasm, and the heterozygous All fourteen - sex citrus fruits showed all the specific amplification products of Nile oranges and Fusarium oxysporum, and it was confirmed that they contained all of nuclear DNA and nuclear DNA of the nile orange.

As shown in FIG. 3, the primers 1 and 2 had a peak of 148 bp for nuclear DNA of pregabal navel orange; Peaks of 107, 116, 129, 148 and 157 bp were observed for the nuclear DNA of the heterozygous gibberellin, respectively, and the peaks of 107, 116, As a result, it was confirmed that all of the products contained nuclear DNA of Nile oranges and nucleus DNA of the cytoplasm.

On the other hand, as can be seen from FIG. 4, the primers of SEQ ID NOS: 3 and 4, which have different sequences from the primers of SEQ ID NOS: 1 and 2, As a result of amplification products, it was confirmed that it was difficult to distinguish citrus nile oranges, licorice, or tetraploid citrus fused with them.

5, the primers 3 and 4 had peaks at 159, 175, and 180 bp for nuclear DNA of pregabal navel oranges; The peak sizes of 151, 156, 164, and 176 bp are very similar for nuclear DNA of filamentous fibrinolysis, and the differences between 2 and 4 bp in the amplification products are not significant, 4 primer could not be used for the distinction of the pre-navel orange, the hallucination, or the tetraploid citrus.

As shown in FIG. 6, the primers 5 and 6 were found to produce amplified products distinguishing mitochondrial DNA of mitochondrial DNA and mitochondrial DNA of the nailleaves orange, respectively. Of the 16 heterotrophic citrus fruits, 17 All of the 14 species, except for A8 and B6, showed the same amplification product as Nile orange before harvesting and thus contained mitochondrial DNA of Gill Navel orange.

Through these results, it was found that the nucleotide sequences of SEQ ID NOS: 1 and 2; And the primers of SEQ ID NOS: 5 and 6 were used, it was found that a heterozygous citrus fruit having nucleus DNA of Gill Navel orange and nuclear DNA of Galanthrium and further having mitochondrial DNA of Gill Navel orange could be selected.

Example 3 Identification of phenotypes of selected tetraploid citrus fruits

In the above Examples 1 and 2, a heterozygous tetraploid citrus containing all of the nuclear DNA of Gil Navel orange and nuclear DNA of the galactosyltransferase and further including the mitochondrial DNA of Gil Navel orange was selected, Respectively.

Specifically, the selected heterozygous tetraploid citrus fruits were planted in a greenhouse through atmospheric purification and soil refinement, and after receiving the purified tetraploid citrus fruits were collected and grafted to a 2 year old tangerine. Thereafter, the fruit was sampled to confirm the fruit size, weight, seed presence, sugar content, acidity, etc. The results are summarized in Table 2 below.

kind width
(mm) Height
(mm) weight
(g) Weight of pulp
(g) Thickness of the skin
(mm) piece
(dog) strain
(dog) Sugar content
(Brix) Acidity
(%) Gil Navel Orange 78.7 77.8 222.7 163.8 4.8 10.4 0.0 14.0 1.3 Fence 21.5 30.6 7.7 4.0 1.9 4.2 1.6 12.7 5.6 Heterogeneous tetraploid plant 42.0 44.1 33.9 18.6 4.2 5.0 0.0 11.5 2.7

As a result, as shown in FIG. 7 and Table 2, it was confirmed that the alien tetraploid citrus fruit had a size and weight midway between the nile orange before harvest and the seedling, and had no seeds. In addition, it was confirmed that the fruit peel was reduced compared to the navel orange in the case of the present invention, and further, the sugar content was similar to that of the conventional navel orange and fennel, but the acidity was markedly lower than that of the fennel, .

Through these results, it was found that the nucleotide sequences of SEQ ID NOS: 1 and 2; And the primers of SEQ ID NOS: 5 and 6 were used, it was found that a heterozygous citrus fruit having the advantage of overcoming the shortcomings of the pre-navel orange and the flaxseed can be selected. It can be used effectively for breeding.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primers for detecting SSR markers specific to allotetraploid          mandarin orange and uses thereof <130> KPA170803-KR <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 catcaccacc acagcaacaa 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ttcaggtgaa agcccctct 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 aacccaccaa cgcattcttc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ggatgcgact tcaatggtcc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gtgttgctga gacatgcgcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 atatggcgca agacgattcc 20

Claims (10)

1. A composition for screening citrus quinquefolium prepared by fusing navel orange and goldfish comprising a pair of primers consisting of the nucleotide sequences shown in SEQ ID NOs: 1 and 2.
4. The composition of claim 1, wherein the composition further comprises a primer pair consisting of the nucleotide sequences shown in SEQ ID NOS: 5 and 6.
delete A quinquer system citrate screening kit prepared by fusing a navel orange and a fenugreek, which comprises the composition for screening citrus quinquerous citrus produced by fusing the nable orange and the gold material of claim 1.
5. The kit according to claim 4, wherein the kit is an RT-PCR (Reverse Transcription Polymerase Chain Reaction) kit or a DNA chip kit.
(a) amplifying a nucleic acid using a composition for screening citrus quadruplex prepared by fusing a navel orange and a goldfish of claim 1 or 2, using genomic DNA derived from citrus as a template; And
and (b) analyzing the obtained amplification product. A method for screening a heterozygous citrus fruit produced by fusing a navel orange and a fountain.
delete 7. The method of claim 6, wherein the genomic DNA is from a citrus seed, leaf, stem, fruit, or a combination thereof.
7. The method of claim 6, wherein step (b) comprises detecting the amplification product by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.
7. The method of claim 6, wherein the method further comprises the step of (c) determining the size of the amplification product to be a heterozygous citrus citrus when it is the same as the product obtained by amplifying genomic DNA derived from navel orange and goldfish , Way.

Images