KR101125745B1 - A Method for Identifying Barley Varieties using Molecular Markers - Google Patents

Abstract

The present invention relates to a marker for identifying barley varieties exhibiting polymorphism with respect to barley varieties distributed in Korea, a barley variety identification method, and a kit including the markers. In detail, the present invention selects a combination of supersatellite markers having a high polymorphism for 71 varieties of barley distributed in Korea and makes it possible to identify barley varieties grown in Korea. The molecular label for barley variety identification used in the method of the present invention can identify 71 varieties of barley grown in Korea. Therefore, the present invention can be very useful in various fields, such as the authenticity of barley varieties, the verification of hybridity in the production of spread and seed seeds, the selection of control varieties and the verification of infringement in varietal protection applications.

Barley, Breed Identification, Supersatellite Marker

Description

A Method for Identifying Barley Varieties using Molecular Markers

The present invention relates to a marker for identifying barley varieties exhibiting polymorphism with respect to barley varieties distributed in Korea, a barley variety identification method, and a kit including the markers.

As molecular biology and genetics develop rapidly, polymorphisms of fragments of specific nucleotide sequences within the chromosome can be searched and developed into molecular markers, and then the developed molecular markers can be mapped to genes, mapping of genes associated with disease resistance ( mapping), morphological characteristics and quality-related gene identification on the chromosome and breed identification. Such molecular labeling technology has the advantage that the cultivation environment, annual variation, etc. are extremely small, as well as the time and effort required for analysis, rather than the phenotype-based analysis method.

If you look at the international trends in the identification of varieties of various techniques using molecular labels, you can find a database of DNA profiles for each variety of crops such as rose and tomato in the Netherlands and pepper, eggplant, cherry, tomato, melon and grape in Spain. Japan is developing methods to identify varieties of corn and rice, such as strawberries, rice, peaches, chestnuts and plums. The molecular labeling and varietal DNA profile database developed by these countries is used to cultivate varieties for protection of varieties, seed distribution management and protection of domestic produce.

Various discussions on the use of molecular labeling techniques in molecular labeling take place at the UPOV International Conference on Molecular Biology and Biochemistry. In addition to the countries participating in this conference, the International Seed Federation (ISF), the International Community of Breeders of Asexually Reproduced Ornamental and Fruit-Tree Varieties (CIOPORA) There is a big problem to use directly in judging the distinction of varieties, but it expresses a willingness to directly use it in fields such as varieties protection. Indeed, in China, the genetic analysis of maize is used to directly determine whether there is a breach of breed protection. On the other hand, in Korea, the Rural Development Administration reported varieties for rice and soybeans, and in the national species, there are some varieties of crop identification systems for peppers, watermelons, melons, melons, and tomatoes. Molecular labeling of crops has been directly used for testing against seed seeds and for determining the authenticity of varieties in case of seed disputes between companies.

The barley cultivation area in Korea is 56,000 ha in 2007 and the output is 176,000 tons, which is less important than in the past. However, due to the recent national health and the government's green growth policy, the importance is expected to increase. Domestic barley varieties are distributed and distributed in the country, 92 varieties registered and registered in the national inventory protection and varieties.

Looking at the trends of molecular genetic research on barley, the international Barley genome project has been conducted in foreign countries, and the database of genetic maps and molecular labeling information is disclosed ( http: //barleygenomics.wsu). edu / databases / databases. html) . In Germany, in particular, 775 simple sequence repeat (SSR) markers have been used to construct an integrated high-density genetic map of barley (Varshney RK, Marcel TC, Ramsay L, Russell J, Roder MS, Stein N, Waugh R, Langridge P). , Niks RE, Graner A. 2007 Theor Appl Genet 114, 1091-1103), in the UK, have reported molecular markers for the identification of 24 varieties of barley grown in the Netherlands, Germany, Austria, Sweden and France (MaCaulay M, Ramsay L, Powell W, Waugh R. 2001 Theor Appl Genet 102, 801-809. Comparison of efficiency between random amplified polymorphic DNA (RAPD) marker and morphological characteristics in Korea (Jang DH, Suh SJ, Baek SB, Kim JG, Nam JH.Korean J Breed 33, 300-305), Microsatellite We have studied the flexibility relationship of Korean barley gene sources (Baek HJ, Yoon MS, Kim HH, Lee JR, Park KL, Cho YH, Choi WY. Korean J Breed 36, 249-259). However, a technique for practically identifying barley varieties by using a supersatellite marker, which is an analysis technique proposed by the International New Variety Protection Federation (UPOV), has not yet been established.

In this regard, the present inventors screened allelic markers for polymorphism for 71 varieties of barley grown in Korea, and amplified barley genomic DNA using primers to identify amplification products. Polymorphic Information Content), the supersatellite marker was found to be suitable for barley varieties identification method, and can be useful for verifying the hybridization of the original and disseminated species, and selecting the control varieties when applying for the protection of varieties. To complete.

An object of the present invention is to select a combination of supersatellite markers showing a high polymorphism for the 71 varieties of barley grown in Korea and to provide a method for identifying barley varieties using the same.

Still another object of the present invention is to provide a method for identifying barley varieties that can be used as supplementary data for varietal protection applications by enabling the prediction of genetic distance of varieties grown in domestic barley breeding institutions.

Still another object of the present invention is to improve the efficiency of new breed development by breeding varieties as well as improving income by supplying highly reliable seeds to farmers by applying molecular biological technology to barley varieties identification.

In order to achieve the above object, the present invention provides a marker for identifying barley varieties, including a set of primers (SEQ ID NOS: 1 to 40) exhibiting polymorphism for barley varieties in circulation in Korea.

In addition, the present invention comprises amplifying a nucleic acid using a genomic DNA derived from barley as a template and a primer set of SEQ ID NO: 1 to SEQ ID NO: 40 as a primer; And

It provides a method for identifying barley varieties, comprising the step of identifying barley varieties from the amplification products.

The present invention also provides a kit for identifying barley varieties comprising primer sets of SEQ ID NOs: 1-40.

Hereinafter, the present invention will be described in more detail.

The present invention provides a marker for identifying barley varieties, including primer sets (SEQ ID NOS: 1 to 40) that exhibit polymorphism for barley varieties in circulation in Korea.

The marker is a supersatellite marker exhibiting high polymorphism for 71 varieties of barley cultivated and distributed in Korea, and can specifically identify barley varieties distributed in Korea. The marker of the present invention is a simple sequence repeat (SSR) marker showing high polymorphism for 71 varieties of barley grown in Korea and spread to farms. Specifically, the marker of the present invention showed high polymorphism for 71 varieties of barley described in Table 2 below.

Preferably, the marker of the present invention may include one or more markers selected from the group consisting of the nucleotide sequences shown in Table 1 below (SEQ ID NOS: 1 to 40).

TABLE 1 Markers Used to Identify Barley Varieties of the Present Invention

SEQ ID NO: Supersatellite markers Base sequence of primer (5 '→ 3') Fluorescent dyeing One Bmac0134
Forward direction: CCAACTGAGTCGATCTCG VIC 2 Reverse: CTTCGTTGCTTCTCTACCTT 3 Bmac0209
Forward direction: CTAGCAACTTCCCAACCGAC NED
4 Reverse: ATGCCTGTGTGTGGACCAT 5 Bmac0273
Forward direction: ACAAAGCTCGTGGTACGT FAM
6 Reverse: AGGGAGTATTTCACCCTTG 7 Bmag0211
Forward: ATTCATCGATCTTGTATTAGTCC PET
8 Reverse: ACATCATGTCGATCAAAGC 9 Bmag0323
Forward direction: TTTGTGACATCTCAAGAACAC VIC
10 Reverse: TGACAAACAAATAATCACAGG 11 Bmag0337
Forward direction: ACAAAGAGGGAGTAGTACGC NED
12 Reverse: GACCCATGATATATGAAGATCA 13 EBmac0711
Forward direction: CAAAAGCAAAAATCATGAGA FAM
14 Reverse: CTAGGTGTGATGAGGGTTTC 15 HVM40
Forward direction: CGATTCCCCTTTTCCCAC PET
16 Reverse: ATTCTCCGCCGTCCACTC 17 HVM67
Forward direction: GTCGGGCTCCATTGCTCT VIC
18 Reverse: CCGGTACCCAGTGACGAC 19 EBmac0764
Forward direction: AGAATCAAGATCGACCAAAC NED
20 Reverse: AAAAACATGAACCGATGAA 21 Bmac0018
Forward direction: GTCCTTTACGCATGAACCGT FAM
22 Reverse: ACATACGCCAGACTCGTGTG 23 Bmag0009
Forward direction: AAGTGAAGCAAGCAAACAAACA PET
24 Reverse: ATCCTTCCATATTTTGATTAGGCA 25 Bmag0382
Forward direction: TGAAACCCATAGAGAGTGAGA VIC
26 Reverse: TCAAAAGTTTCGTTCCAAATA 27 EBmac0415
Forward direction: GAAACCCATCATAGCAGC NED
28 Reverse: AAACAGCAGCAAGAGGAG 29 EBmac0603
Forward direction: ACCGAAACTAAATGAACTACTTCG FAM
30 Reverse: TGCAAACTGTGCTATTAAGGG 31 EBmac0871
Forward direction: TGCCTCTGTTGTGTTATTGT PET
32 Reverse: CCCCAAGTGAACATTGAC 33 HVM74
Forward direction: AGGAAGTCATTGCGTGAG VIC
34 Reverse: TGATCAAGAATGATAACATGG 35 Bmag0223
Forward direction: TTAGTCACCCTCAACGGT NED
36 Reverse: CCCCTAACTGCTGTGATG 37 Bmag0378
Forward direction: CTTTTGTTTCCGTAGCATCTA FAM
38 Reverse: ATCCAACTATAGTAGCAAAGCC 39 Bmag0136
Forward direction: GTACGCTTTCAAACCTGG PET
40 Reverse: GTAGGAGGAAGAATAAGGAGG

In addition, the present invention comprises amplifying a nucleic acid using a genomic DNA derived from barley as a template and a primer set of SEQ ID NO: 1 to SEQ ID NO: 40 as a primer; And

It provides a method for identifying barley varieties, comprising the step of identifying barley varieties from the amplification products.

In the barley variety identification method of the present invention, genomic DNA derived from barley can be obtained by using a conventional method of collecting DNA from the seed of barley and the whole barley plant. Preferably, genomic DNA can be harvested from the seed of barley or the leaves of barley, in particular the seed of the barley and the leaves of young plants of barley after seeding.

In the barley variety identification method of the present invention, amplification of genomic DNA is preferably performed using a polymerase chain reaction (PCR). General PCR methods are well known in the art. Specifically, the PCR reaction may be carried out using a PCR reaction solution containing various components known in the art for the PCR reaction. For example, the PCR reaction solution may include genomic DNA derived from barley to be analyzed, a marker of the present invention, an appropriate amount of DNA polymerase (eg, Taq polymerase), dNTP mixture, PCR buffer, and water. Include. The PCR buffer may contain KCl, Tris-HCl and MgCl ₂ .

In the present invention, the step of identifying the barley varieties from the amplified product can be identified by the computer program after confirming the size of the allele (band) by using an automatic sequencing analyzer to identify each variety. Specifically, barley varieties can be identified by tabulating the presence or absence of an amplification product by the marker of the present invention for each barley variety and comparing the amplified products with the amplified products. For example, using the markers of the present invention, the size of the alleles from each barley variety is summarized in one table, and then indicated as "1" when present, depending on the presence or absence of alleles, and " 0 ". Therefore, after genomic DNA is isolated from the barley to identify the breed, the amplification using the marker of the present invention, the size of the amplified product can be analyzed and then all varieties can be identified through a statistical program.

The present invention also provides a kit for identifying barley varieties comprising primer sets of SEQ ID NOs: 1-40. Kits of the invention include one or more of the primer sets of the invention, DNA polymerase and PCR buffers. In addition, the components necessary for performing electrophoresis to confirm amplification of PCR products may be additionally included in the kit of the present invention.

Using only the barley varieties identification marker of the present invention can be identified 71 varieties of barley that are being fostered in Korea. Therefore, it can be usefully used in various fields such as identifying the authenticity of barley varieties, scientific verification of hybrids of barley varieties and spread varieties, whether or not infringement of varieties protection rights, and selection of control varieties when applying for varieties protection.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the present invention is not limited by the following examples.

Example : How to Identify Barley Varieties

(1) barley sample

In the present invention, 71 varieties of barley described in Table 2 were used for selection of the primer set for identifying the varieties and barley varieties discrimination assay.

<Table 2> 71 Varieties of Barley for Variety Identification

Serial number Breed name Serial number Breed name Serial number Breed name One friendship 25 Daeah 49 Top Goal 2 Shoman 26 Big Alvor No. 1 50 Newall 3 softness 27 Birds 51 The 4 chop 28 British 52 New river 5 Nerds 29 Peace 53 Rush 6 Dasong 30 Dongho Rice 54 Samdo 7 Multidirectional 31 ILJIN 55 Mirak 8 Samgwangchal 32 Daeyeon 56 Great 9 Gwangan 33 Red rice 57 Dairy 10 senate 34 signal 58 Large egg 11 Hojin 35 Evergreen 59 A new egg 12 Cheongho Rice 36 Unit 60 Sheepskin 13 nutrition 37 Great Lake Rice 61 Daejin 14 Donghanchal 38 Jinmi glutinous rice 62 full 15 Taegang 39 eight provinces of Korea 63 Vast rice 16 Article 40 Mudeung Rice 64 Rice 17 South Lake 41 Doosan 8 65 White rice 18 Lakeside 42 Doosan 29 66 White rice 19 Sunwoo 43 Jeju 67 Cold rice 20 Saehanchal 44 Jinyang 68 Long rice 21 health 45 South 69 Ever rice 22 swimming 46 Rice 70 New rice 23 Poongsan Temple 47 Rice flour 71 Songhak 24 Proposal 48 Dowon Rice

(2) extraction of genomic DNA

Seeds of the barley varieties disclosed in Table 2 were sown on a 50-hole plug seedling plate, and after 3 weeks, the leaves of the soft region were collected and used as a material for separating genomic DNA. Three tungsten beads were placed in a 2 ml tube in which the leaves of the barley collected were stored and rapidly frozen with liquid nitrogen (-196 ° C), and the tissues were evenly ground while repeating the vortexing process. Fully ground tissue was isolated genomic DNA using NucleoSpin ^® Plant II (Macherey-Nagel Cat. 740 770.250) kit. The extracted genomic DNA was electrophoresed on 1.0% agarose gel to confirm the DNA concentration. After quantification, the genomic DNA was diluted to a concentration of 10 ng per μl and used for PCR analysis.

(3) Preparation of primer set

As candidate material for the primer set of the present invention, 99 markers whose information is published in the International Genome Research D / B ( http://barleygenomics.wsu.edu/ ) were used. To select markers showing high polymorphism for domestically grown barley varieties, white waxy barley, saebare barley, white barley, broad barley, barley barley, Daeho barley, Dongho barley, cold han barley, healthy barley varieties and 99 primer sets were used. After amplification of the gene, the difference between alleles of each sample was analyzed using a capillary electrophoresis device (HDA-GT12 ^TM System, e GEnE, Inc.) and a computer program (Biocalculator2.0). 24 markers with clear pattern and high degree of polymorphism were selected. Oligofluorescently labeled with one of the chemicals of FAM, VIC, NED, and PET in the forward direction of the primers in Table 1 to obtain more accurate results, except for the four of the 24 selected first, which had low genetic polymorphism. Nucleotide was produced by ordering from Jeonghwa Science.

(4) PCR amplification and electrophoresis

PCR was performed using the prepared genomic DNA and the prepared markers as materials. The composition of the PCR reaction solution was prepared from 20 ng of barley genomic DNA prepared above, the marker of 0.1 μM, 2.0 μl dNTP mixture (2.5 mM), Taq polymerase 1U (Takara CAT. RR011A), 2.5 μl of 10 × PCR buffer (50 mM KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl ₂ ) was added to distilled water to adjust the total volume to 25 μl. PCR (C1000, BioRad, USA) amplification was sufficient to denature the genomic DNA for 5 minutes at 94 ° C, then denaturation at 94 ° C for 30 seconds, annealing at 52-60 ° C for 30 seconds, and kidneys at 72 ° C for 45 seconds. Repeated times were performed. The reaction was carried out at 72 ° C. for 10 minutes for the final elongation of the PCR product, and the annealing temperature was set at 50-60 ° C. according to each primer. Annealing temperatures for each primer set are shown in Table 3 below. After the PCR was completed, the amplification was confirmed by electrophoresis on 2% agarose gel. Amplified samples were stored at -20 ° C for the next experiment. Samples amplified by PCR were divided into five sets of 20 primers for different fluorescent stains attached to the primers, and each amplification product of each set was diluted in 150 μl of ultrapure water. Mix 3 µl of the diluted PCR amplification product with 10 µl of deionized formamide and 0.25 µl of size marker (LIZ500 size standard) to measure the size of the allele and mix for 2 minutes at 94 ° C. Denatured. The denatured gene amplification product was electrophoresed using an automated sequencing device (Genetic Analyzer 3130XL, Applied Biosystem), and then the exact size of alleles of each supersatellite molecule label was determined using Peak Scanner and GeneMapper computer program (Applied Biosystem). Decided.

 (5) Barley variety identification possibility test of the marker according to the present invention

The allelic size identified by the automatic sequencing was examined for the possibility of identifying the barley variety of the marker according to the present invention. Equation 1 was used to calculate the polymorphism information content (PIC) value. In the following equation, P _ij is the frequency of the _j th common band pattern among the bands of the marker _i (Anderson et al., 1993, Genome 36: 181-186).

<Equation 1>

As a result, the size (bp) of the amplification products, the number of alleles and the PIC values according to each marker are shown in Table 3 below.

<Table 3> Characteristics of Markers

Serial number SSR Marker Name Annealing Temperature (℃) Allele size Allele number PIC value One Bmac0134 55 130-160 9 0.800 2 Bmac0209 55 174-195 6 0.669 3 Bmac0273 52 137-162 4 0.583 4 Bmag0211 52 182 ~ 194 8 0.777 5 Bmag0323 52 151-165 8 0.798 6 Bmag0337 52 125-146 8 0.767 7 EBmac0711 55 196-206 6 0.792 8 HVM40 58 146 ~ 163 4 0.792 9 HVM67 60 106-119 5 0.812 10 EBmac0764 52 129-149 7 0.650 11 Bmac0018 55 131-176 6 0.856 12 Bmag0009 55 168-180 6 0.876 13 Bmag0382 55 084 ~ 107 5 0.842 14 EBmac0415 58 228-248 3 0.676 15 EBmac0603 55 135-152 5 0.496 16 EBmac0871 52 184-207 7 0.683 17 HVM74 52 187-238 7 0.878 18 Bmag0223 55 133-173 11 0.852 19 Bmag0378 52 134-149 5 0.522 20 Bmag0136 58 202-204 2 0.499

As shown in Table 3, EBmac0603 showed the lowest PIC value of 0.496 among the markers utilized in the present invention, but 16 markers such as Bmac0134 showed high PIC values of 0.65 or more. Thus, it can be seen that the marker of the present invention can sufficiently identify barley varieties.

In addition, NTSYS pc (version 2.10b) (Rohlf, 2000, Numerical Taxonomy and Multivariate Analysis System-Version 2.10b.Applied Biostatistics Inc., New York.) Genetic similarity values were calculated according to Jaccard's method (Sneath and Sokal 1973, Numerical taxonomy: The Principles and Practice of Numerical Classification, WH Freeman, San Francisco.). Using a genetic similarity, a dendritic diagram was prepared by aggregating by UPGMA (Unweighted Pair-group Method with Arithmetical Average) (Sneath and Sokal, 1973), and the results are shown in FIG. 1. Accordingly, it can be seen that the primer set of the present invention enables the discrimination of all varieties.

Figure 1 shows the coding of each barley varieties analyzed by the marker according to the present invention and shows the genetic similarity of barley varieties identification and varieties using the NTSYSPC computer program.

<110> KOREA SEED & VARIETY SERVICE <120> A METHOD FOR IDENTIFYING BARLEY VARIETIES USING MOLECULAR MARKERS <130> 085054 <160> 40 <170> Kopatentin 1.71 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Bmac0134 forward primer <400> 1 ccaactgagt cgatctcg 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bmac0134 reverse primer <400> 2 cttcgttgct tctctacctt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bmac0209 forward primer <400> 3 ctagcaactt cccaaccgac 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Bmac0209 reverse primer <400> 4 atgcctgtgt gtggaccat 19 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Bmac0273 forward primer <400> 5 acaaagctcg tggtacgt 18 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Bmac0273 reverse primer <400> 6 agggagtatt tcacccttg 19 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Bmag0211 forward primer <400> 7 attcatcgat cttgtattag tcc 23 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Bmag0211 reverse primer <400> 8 acatcatgtc gatcaaagc 19 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Bmag0323 forward primer <400> 9 tttgtgacat ctcaagaaca c 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Bmag0323 reverse primer <400> 10 tgacaaacaa ataatcacag g 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bmag0337 forward primer <400> 11 acaaagaggg agtagtacgc 20 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Bmag0337 reverse primer <400> 12 gacccatgat atatgaagat ca 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EBmac0711 forward primer <400> 13 caaaagcaaa aatcatgaga 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EBmac0711 reverse primer <400> 14 ctaggtgtga tgagggtttc 20 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HVM40 forward primer <400> 15 cgattcccct tttcccac 18 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HVM40 reverse primer <400> 16 attctccgcc gtccactc 18 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HVM67 forward primer <400> 17 gtcgggctcc attgctct 18 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HVM67 reverse primer <400> 18 ccggtaccca gtgacgac 18 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EBmac0764 forward primer <400> 19 agaatcaaga tcgaccaaac 20 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> EBmac0764 reverse primer <400> 20 aaaaacatga accgatgaa 19 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bmac0018 forward primer <400> 21 gtcctttacg catgaaccgt 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bmac0018 reverse primer <400> 22 acatacgcca gactcgtgtg 20 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Bmag0009 forward primer <400> 23 aagtgaagca agcaaacaaa ca 22 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Bmag0009 reverse primer <400> 24 atccttccat attttgatta ggca 24 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Bmag0382 forward primer <400> 25 tgaaacccat agagagtgag a 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Bmag0382 reverse primer <400> 26 tcaaaagttt cgttccaaat a 21 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> EBmac0415 forward primer <400> 27 gaaacccatc atagcagc 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> EBmac0415 reverse primer <400> 28 aaacagcagc aagaggag 18 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> EBmac0603 forward primer <400> 29 accgaaacta aatgaactac ttcg 24 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EBmac0603 forward primer <400> 30 tgcaaactgt gctattaagg g 21 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EBmac0871 forward primer <400> 31 tgcctctgtt gtgttattgt 20 <210> 32 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> EBmac0871 reverse primer <400> 32 ccccaagtga acattgac 18 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HVM74 forward primer <400> 33 aggaagtcat tgcgtgag 18 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HVM74 reverse primer <400> 34 tgatcaagaa tgataacatg g 21 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Bmag0223 forward primer <400> 35 ttagtcaccc tcaacggt 18 <210> 36 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Bmag0223 reverse primer <400> 36 cccctaactg ctgtgatg 18 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Bmag0378 forward primer <400> 37 cttttgtttc cgtagcatct a 21 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Bmag0378 reverse primer <400> 38 atccaactat agtagcaaag cc 22 <210> 39 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Bmag0136 forward primer <400> 39 gtacgctttc aaacctgg 18 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Bmag0136 reverse primer <400> 40 gtaggaggaa gaataaggag g 21  

Claims (5)

A set of Bmag0323 primers consisting of oligonucleotides of SEQ ID NO: 9 and SEQ ID NO: 10; Bmag0337 primer set consisting of oligonucleotides of SEQ ID NO: 11 and SEQ ID NO: 12; An EBmac0711 primer set consisting of oligonucleotides of SEQ ID NO: 13 and SEQ ID NO: 14; An EBmac0764 primer set consisting of oligonucleotides of SEQ ID NO: 19 and SEQ ID NO: 20; An EBmac0603 primer set consisting of the oligonucleotides of SEQ ID NO: 29 and SEQ ID NO: 30; And A primer set for identifying one or more barley varieties selected from the group consisting of barley varieties, consisting of the EBmac0871 primer set consisting of oligonucleotides of SEQ ID NO: 31 and SEQ ID NO: 32. Serial number Breed name Serial number Breed name Serial number Breed name One friendship 25 Daeah 49 Top Goal 2 Shoman 26 Big Alvor No. 1 50 Newall 3 softness 27 Birds 51 The 4 chop 28 British 52 New river 5 Nerds 29 Peace 53 Rush 6 Dasong 30 Dongho Rice 54 Samdo 7 Multidirectional 31 ILJIN 55 Mirak 8 Samgwangchal 32 Daeyeon 56 Great 9 Gwangan 33 Red rice 57 Dairy 10 senate 34 signal 58 Large egg 11 Hojin 35 Evergreen 59 A new egg 12 Cheongho Rice 36 Unit 60 Sheepskin 13 nutrition 37 Great Lake Rice 61 Daejin 14 Donghanchal 38 Jinmi glutinous rice 62 full 15 Taegang 39 eight provinces of Korea 63 Vast rice 16 Article 40 Mudeung Rice 64 Rice 17 South Lake 41 Doosan 8 65 White rice 18 Lakeside 42 Doosan 29 66 White rice 19 Sunwoo 43 Jeju 67 Cold rice 20 Saehanchal 44 Jinyang 68 Long rice 21 health 45 South 69 Ever rice 22 swimming 46 Rice 70 New rice 23 Poongsan Temple 47 Rice flour 71 Songhak 24 Proposal 48 Dowon Rice Amplifying the nucleic acid using genomic DNA derived from barley as a template and using the primer set for barley variety identification according to claim 1 as a primer; And Identifying one or more barley varieties selected from the group consisting of barley varieties, comprising identifying barley varieties from the amplification products. Serial number Breed name Serial number Breed name Serial number Breed name One friendship 25 Daeah 49 Top Goal 2 Shoman 26 Big Alvor No. 1 50 Newall 3 softness 27 Birds 51 The 4 chop 28 British 52 New river 5 Nerds 29 Peace 53 Rush 6 Dasong 30 Dongho Rice 54 Samdo 7 Multidirectional 31 ILJIN 55 Mirak 8 Samgwangchal 32 Daeyeon 56 Great 9 Gwangan 33 Red rice 57 Dairy 10 senate 34 signal 58 Large egg 11 Hojin 35 Evergreen 59 A new egg 12 Cheongho Rice 36 Unit 60 Sheepskin 13 nutrition 37 Great Lake Rice 61 Daejin 14 Donghanchal 38 Jinmi glutinous rice 62 full 15 Taegang 39 eight provinces of Korea 63 Vast rice 16 Article 40 Mudeung Rice 64 Rice 17 South Lake 41 Doosan 8 65 White rice 18 Lakeside 42 Doosan 29 66 White rice 19 Sunwoo 43 Jeju 67 Cold rice 20 Saehanchal 44 Jinyang 68 Long rice 21 health 45 South 69 Ever rice 22 swimming 46 Rice 70 New rice 23 Poongsan Temple 47 Rice flour 71 Songhak 24 Proposal 48 Dowon Rice The method of claim 2, wherein the genomic DNA is derived from seeds of barley or leaves of young plants of barley. The method of claim 2, wherein the step of identifying the barley varieties from the amplification product is a table for the presence or absence of the amplification product by the barley varieties primer identification set of claim 1 for each barley varieties and comparative analysis with the amplified products To identify the barley varieties. At least one barley variety identification kit selected from the group consisting of barley varieties comprising the primer set for barley variety identification, DNA polymerase and PCR buffer of claim 1. Serial number Breed name Serial number Breed name Serial number Breed name One friendship 25 Daeah 49 Top Goal 2 Shoman 26 Big Alvor No. 1 50 Newall 3 softness 27 Birds 51 The 4 chop 28 British 52 New river 5 Nerds 29 Peace 53 Rush 6 Dasong 30 Dongho Rice 54 Samdo 7 Multidirectional 31 ILJIN 55 Mirak 8 Samgwangchal 32 Daeyeon 56 Great 9 Gwangan 33 Red rice 57 Dairy 10 senate 34 signal 58 Large egg 11 Hojin 35 Evergreen 59 A new egg 12 Cheongho Rice 36 Unit 60 Sheepskin 13 nutrition 37 Great Lake Rice 61 Daejin 14 Donghanchal 38 Jinmi glutinous rice 62 full 15 Taegang 39 eight provinces of Korea 63 Vast rice 16 Article 40 Mudeung Rice 64 Rice 17 South Lake 41 Doosan 8 65 White rice 18 Lakeside 42 Doosan 29 66 White rice 19 Sunwoo 43 Jeju 67 Cold rice 20 Saehanchal 44 Jinyang 68 Long rice 21 health 45 South 69 Ever rice 22 swimming 46 Rice 70 New rice 23 Poongsan Temple 47 Rice flour 71 Songhak 24 Proposal 48 Dowon Rice

Images