KR101555972B1 - A method for identifying pumpkin varieties using microsatellites markers - Google Patents

Abstract

The present invention relates to a method for identifying an amber cultivar using a supersaturate marker for identification of an amber varietal, which exhibits polymorphism in an amber cultivar distributed in Korea, and a kit including the supersmal marker. Specifically, the present invention can identify the combination of supersatellite markers having a high polymorphism for 160 varieties of pumpkin distributed in the country, and can identify the pumpkin varieties distributed in the domestic seed market. The molecular markers for identification of the amber varieties used in the method of the present invention not only can identify 160 varieties of amber which are distributed in the domestic market but also have a marker showing the heterozygosity which identifies the parents of all varieties, Can be usefully used for assay. Accordingly, the present invention provides an arbitration means for solving the occurrence of a seed dispute occurring between a farmer and a seed company or a seed company and a seed company, identifying the genuineness of the amber varieties distributed in the market, selecting a control varietal at the time of breeding protection application, It can be very useful for various fields such as proactive monitoring of the infringement of rights and purity verification of F1 seeds.

Description

Technical Field [0001] The present invention relates to a method for identifying pumpkin varieties using microsatellite markers

The present invention relates to a supersatellite marker showing polymorphism in an amber variety cultivated in a domestic seed company, a method of identifying an amber varietal using the marker, a method of identifying an amber F1 seed purity, and a kit containing the marker.

In order to establish reliable databases and to obtain reliable results when using molecular markers for breed protection system and breed identification, UPOV has selected the method of genetic analysis, selection criteria of DNA markers, DNA separation method And database construction. In this guideline, the use of molecular markers is not only highly reproducible between laboratories and researchers, but also exhibits a bare property. The molecular markers used are evenly distributed on the chromosome, . SSR (Simple Sequence Repeat) analysis method which confirms the polymorphism between analysis material and breed using the difference of simple repetitive nucleotide sequence existing on the chromosome is the most suitable gene analysis method to this standard.

In the CPVO of the European Union, a DNA testing consortium consisting of wheat, potatoes, roses, tomatoes, oilseed rape, and other crops is organized by a group of laboratories in several countries to compare errors between analysis markers and materials and laboratories. And the DNA profile database for more than 100 to 500 varieties of each crop has been constructed and the results of the research have been published. In Japan, a genetic analysis system has been established for fruits and processed products of cultivar registered varieties such as rice, canned food, matting, and fruits such as peaches, apples, chestnuts and citrus fruits to identify varieties of processed products of agricultural products and to protect agricultural products We are actively utilizing it in the same field. In recent years, DNA of more than 2500 varieties of 203 crops has been stored for the purpose of rapid genetic analysis in the case of rights disputes of nutrition breeding crops and utilization as analytical material in future development of DNA assay technology.

On the other hand, in Korea, the use of SSR markers that are highly polymorphic for crops such as red pepper, watermelon, radish, Chinese cabbage, melon, and cucumber which are highly important in the seed market or are likely to cause conflict in the seed market, A database of DNA profiles for more than 200 to 600 varieties per plant has been constructed or is under construction. In fact, these results have been used to select varieties of varieties protected varieties and to confirm the discriminability, uniformity and stability of varieties protected cultivation. In recent years, genetic analysis of seeds of basic plants submitted by seeds and breeder at the time of registration of breed protection has been carried out, and then characteristics of cultivated varieties showing different results of analysis have been investigated to confirm the authenticity of breed protection registered varieties And its application range is gradually expanding. In addition, breed identification molecular markers are being actively used as a means to mediate breeding grounds related to the breeding genotypes between farmers, seed companies, farmers, nurseries and seed companies.

Amber is a one-year-old vine herbaceous plant belonging to the genus Bacillus, maxima), Asian (Cucurbita. moshata), page pogye (Cucurbita pepo ), interspecific hybrids ( C. moshata / C. pepo , C. moshata / C. moshata ), Cucurbita ficifolia ) amber. Various kinds of varieties are cultivated, and 855 varieties, varieties, and registered 49 varieties, which are notified of production import and sale, are distributed in the domestic market. The area of pumpkin cultivation in Korea is expected to increase by 1% to 15,188 hectares due to the continuous increase in demand due to popularization of pumpkin consumption in 2013. In addition, production is estimated to be 342,000 tons, which is slightly higher than in 2012. In particular, the steady imports of pumpkins are one of the crops whose economic import is growing to reach 24,000 tons in 2013.

Molecular genetic research on pumpkin has been carried out in 2002 by using RAPD, AFLP, and SSR markers to generate genetic map (Brown RN and Myers JR 2002). J Am Soc Hortic Sci 127: 568-575) There were only about twenty-seven SSR markers on the genetic map. In order to overcome this problem, we developed 500 SSR markers and constructed a high-density genetic map using 405 molecular markers that show polymorphism in the dual-phenotype and oriental amber (Gong L, Stift G, Kofler R, Pachner M and Lelley T. 2008. Theoretical Applied Genetics, 117, 37-48), using these markers to characterize the genetic resources of pepper-based amber (Gong L, Paris HS, Nee MH, Stift G, Pachner M, Vollmann J and Lelley T. 2012. Theoretical Applied Genetics, 124, 875-891). Recently, a genome research project (http://www.icugi.org/) of foams and crops such as watermelons, melons, amber, and cucumbers has begun, and pumpkins also have SSR and SNP markers (Esteras C, Gomez P, Monforte AJ, Blanca J, Vicente-Dolera N, Roig C, Nuez F and Pico B. 2012), and the results of research on gene mapping and mapping of loci associated with quantitative traits have been reported BMC Genomics 13: 8). As a result of this study, the method that can identify the Korean pumpkin varieties by the SSR marker, which is one of the genetic analysis techniques proposed by UPOV, is not yet established, There is no established DNA profile.

Therefore, the present inventors selected a supersatellite marker showing polymorphism for 160 cultivars of domestic amber, and confirmed the amplification product after amplifying the amber genomic DNA using the supersatellite marker set, And PIC (Polymorphic Information Content) values, it was confirmed that the supersampling markers were suitable for the amber type identification method. In addition, it was confirmed that there is a heterozygous molecular marker which can identify the parents of all the amber varieties disclosed, and it was judged that this marker set can be very usefully used for the purity determination of the amber seeds. These results can be applied to various aspects such as selection of control varieties at the time of application for breed protection, scientific verification of breed authenticity at seed occurrence, seed distribution control and quality control of F1 seed.

It is an object of the present invention to provide a supersatellite marker that exhibits high polymorphism for 160 varieties of pumpkins distributed in Korea.

It is still another object of the present invention to provide a method of identifying an amber variety using the supersamma marker.

It is another object of the present invention to provide a method for identifying an amber varieties which makes it possible to predict the genetic similarity of the amber varieties breeded by a seed company at the DNA level, thereby directly utilizing the varietal varieties in selection of a control varietal.

Another object of the present invention is to apply the molecular biology technology to the authenticity testing of the pumpkin cultivars and judge the authenticity of the pumpkin cultivars sold in the seed market at the level of the laboratory to contribute to eradicating the distribution of the bad seeds, And to provide a method of identifying the amber varieties which can be very useful for solving seed conflicts related to the genetic authenticity occurring between a seed company, a seedling maker, a farmer or a seed company and a seed company.

Another object of the present invention is to identify the two alleles according to the varieties among the molecular markers used for the identification of the amber varieties because it shows the genotype of the parents crossed at the breeding time, Level of information.

In order to accomplish the above object, the present invention provides a CMTp137 primer set consisting of oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2, which exhibits polymorphism for an amber variety distributed at home and abroad; A CMTp245 primer set consisting of the oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4; A CMTp252 primer set consisting of the oligonucleotides of SEQ ID NO: 5 and SEQ ID NO: 6; A CMTp254 primer set consisting of oligonucleotides of SEQ ID NO: 7 and SEQ ID NO: 8; A CMTp257 primer set consisting of oligonucleotides of SEQ ID NO: 9 and SEQ ID NO: 10; A CMTm7 primer set consisting of the oligonucleotides of SEQ ID NO: 11 and SEQ ID NO: 12; A CMTm18 primer set consisting of the oligonucleotides of SEQ ID NO: 13 and SEQ ID NO: 14; A CMTm19 primer set consisting of the oligonucleotides of SEQ ID NO: 15 and SEQ ID NO: 16; A CMTm20 primer set consisting of oligonucleotides of SEQ ID NO: 17 and SEQ ID NO: 18; A CMTm34 primer set consisting of oligonucleotides of SEQ ID NO: 19 and SEQ ID NO: 20; A CMTm35 primer set consisting of oligonucleotides of SEQ ID NO: 21 and SEQ ID NO: 22; A CMTm37 primer set consisting of oligonucleotides of SEQ ID NO: 23 and SEQ ID NO: 24; A CMTm48 primer set consisting of oligonucleotides of SEQ ID NO: 25 and SEQ ID NO: 26; A CMTm52 primer set consisting of oligonucleotides of SEQ ID NO: 27 and SEQ ID NO: 28; A CMTm54 primer set consisting of oligonucleotides of SEQ ID NO: 29 and SEQ ID NO: 30; A CMTm60 primer set consisting of oligonucleotides of SEQ ID NO: 31 and SEQ ID NO: 32; A CMTm61 primer set consisting of oligonucleotides of SEQ ID NO: 33 and SEQ ID NO: 34; A CMTm63 primer set consisting of oligonucleotides of SEQ ID NO: 35 and SEQ ID NO: 36; A CMTm80 primer set consisting of oligonucleotides of SEQ ID NO: 37 and SEQ ID NO: 38; A CMTm87 primer set consisting of oligonucleotides of SEQ ID NO: 39 and SEQ ID NO: 40; A CMTm88 primer set consisting of the oligonucleotides of SEQ ID NO: 41 and SEQ ID NO: 42; A CMTm91 primer set consisting of oligonucleotides of SEQ ID NO: 43 and SEQ ID NO: 44; A CMTm111 primer set consisting of the oligonucleotides of SEQ ID NO: 45 and SEQ ID NO: 46; A CMTm119 primer set consisting of oligonucleotides of SEQ ID NO: 47 and SEQ ID NO: 48; A CMTm128 primer set consisting of oligonucleotides of SEQ ID NO: 49 and SEQ ID NO: 50; A CMTm135 primer set consisting of oligonucleotides of SEQ ID NO: 51 and SEQ ID NO: 52; A CMTm137 primer set consisting of oligonucleotides of SEQ ID NO: 53 and SEQ ID NO: 54; A CMTm162 primer set consisting of oligonucleotides of SEQ ID NO: 55 and SEQ ID NO: 56; And a set of CMTm164 primers consisting of the oligonucleotides of SEQ ID NO: 57 and SEQ ID NO: 58 (hereinafter referred to as " a set of 29 pairs of oligonucleotides comprising oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 58 & One or more primer sets "). ≪ / RTI >

The primer set is a primer set for supersatellite markers exhibiting high polymorphism for 160 varieties of amber which are distributed in Korea, and can specifically identify the amber varieties distributed in Korea. The marker of the present invention may refer to the amplification product (s) obtained through at least one primer set among 29 pairs of primer sets comprising oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: The markers of the present invention show high polymorphism for 160 varieties of amber listed in Table 2 below. Preferably, the marker of the present invention may comprise an amplification product obtained using all of the 29 pairs of primer sets. 29 pairs of oligonucleotides comprising the oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 58 of the present invention are shown in Table 1 below.

order
number Super satellites
Marking factor The base sequence (5 'to 3') of the primer Fluorescent marker One CMTp137
Forward: TGAAATCTCTGCGAGACAAAAG FAM 2 Reverse: AATTCAGATTGAGAGGGAGGTG 3 CMTp245
Forward: AGGTAACTGCACCCCAGCTA VIC 4 Reverse direction: CCCATCTCTCAAGCTCATCC 5 CMTp252
Forward: TCTCACTCATCCACCACACC NED 6 Reverse: CGTTTCGAGTCATTTGTTCG 7 CMTp254
Forward: CCCCACATCCATATATCCACA PET 8 Reverse: CTCCAATGCACAACCTTGC 9 CMTp257
Forward: CACGAAGATTTGATGGCCTTA FAM 10 Reverse direction: GGATTGGGATGGTGAAGATG 11 CMTm7
Forward: AACCAAACTCCGGCAAGA VIC 12 Reverse: GTTCTCTCCGTTCAGGATGG 13 CMTm18
Forward: ATGGGTTTCACCAAAAGCTG NED 14 Reverse: AAGCGGACGACTGACGAC 15 CMTm19
Forward: GCATGGGAGATGAAGGTTAG PET 16 Reverse: ATTTCCTGGTGGTATGAGATTC 17 CMTm20
Forward: GTGGGCCATATCGATTCACT FAM 18 Reverse direction: CGAAAGTCGCAGAGAACACA 19 CMTm34
Forward: TGAAACTACACTACATGACCTTGG VIC 20 Reverse direction: TGGGTTGGTAGACTTGTAGTTGA 21 CMTm35
Forward: CATCAGGTTATTGAGTTTTACTCAGAC NED 22 Reverse: TCGTCTGCCCCAATAATTC 23 CMTm37
Forward: CGTGTTTGTGTTGGAAAAGC PET 24 Reverse: AAGCAAACCCACAGAAGGAG 25 CMTm48
Forward: AAGCCTTTGGGGACCTTTAC FAM 26 Reverse direction: TTGAAACCTTCAAACAAGAAATTG 27 CMTm52
Forward: GCTCTCCATTTTCCAGCTTC VIC 28 Reverse: GACGCAGAGGGAGATTAATGA 29 CMTm54
Forward: GTGTGGATGCAAATGGTGAG NED 30 Reverse direction: GGGAATCGAGGGTTTTGAAT 31 CMTm60
Forward: TCCTCCAAAGCATACCAACTGT PET 32 Reverse: GCGCCATTTTATTGATTGGAT 33 CMTm61
Forward: GCCATTATTCCACTCCATGC FAM 34 Reverse direction: TGCCTGCACCTGTTTTAGC 35 CMTm63
Forward: GCAGAAGATACCGTCGGAGT VIC 36 Reverse: AAGGTGAACGGGAATGTGAG 37 CMTm80
Forward: GGCCTAATGGGTTGTGAAGA NED 38 Reverse direction: AGTGGAATCCATTTGTTCGTG 39 CMTm87
Forward: AATCTGCAAACGGACTTCAAT PET 40 Reverse: TCACAGTGATCCCCAAACTC 41 CMTm88
Forward: CATCGACATTCGCCTCATC FAM 42 Reverse direction: AGGCAGCTTCCAAATCAGC 43 CMTm91
Forward: CCCTAGAATTAGTGGGCAAT VIC 44 Reverse direction: TAGGCCTAAAAAGACCCAAT 45 CMTm111
Forward: CTCCATTCCCATGGCTTC NED 46 Reverse: CCATGAGCTTGAGAGAGGTG 47 CMTm119
Forward: GAAGCTGCCGGAAGTTAGC PET 48 Reverse: GGGACCACCCTCTTCTCTTC 49 CMTm128
Forward: ACCAATTTTTGATTTTCAGTTTGC FAM 50 Reverse: AGGGGGAAGAAAAGCGAAG 51 CMTm135
Forward: GTGGCCGTAGGTTTGTCAGT VIC 52 Reverse: TCAGAGAATCGGAGCAGAGAG 53 CMTm137
Forward: ACGTTCTTTCTGCCTCCAT NED 54 Reverse: ATGCCCATTATGCAATTCTC 55 CMTm162
Forward: TGGATGGGGAAATTATTGGA PET 56 Reverse: ATTCAGGGGAGATTGGGACT 57 CMTm164
Forward: AGCCTTTCAGAAGAACCAAG FAM 58 Reverse direction: GGCTTCAAACAAATACTAACCA

The invention also provides a kit for identifying an amber variety comprising at least one primer set of 29 pairs of primer sets comprising oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: Preferably, the kit may include all of the 29 pairs of primer sets. The kit of the present invention may further comprise a DNA polymerase and a PCR buffer. In addition, components necessary for conducting electrophoresis to confirm whether the PCR product is amplified can be further included in the kit of the present invention.

Further, the present invention provides a method for amplifying nucleic acid, comprising amplifying a nucleic acid using genomic DNA derived from amber as a template and using at least one primer set among 29 pairs of primer sets comprising oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 58 as primers; And determining the varieties of amber from the resulting amplification products. Preferably, the amplifying step may be to amplify the nucleic acid using all of the 29 pairs of primer sets.

The genomic DNA can be obtained by using a conventional method of collecting DNA from the whole plant of amber, seed of amber. For example, the genomic DNA may be derived from the leaves, stems, flesh or roots of pumpkin seeds or pumpkins, and may be obtained from the leaves of young plants of pumpkins, particularly after seeding and emergence.

In the above method, it is preferable to use PCR (polymerase chain reaction) for amplification of genomic DNA. Methods for performing general PCR are well known in the art. Specifically, the PCR reaction can be carried out using a PCR reaction solution containing various components known to be necessary for the PCR reaction in the art. For example, the PCR reaction solution may be prepared by mixing a genomic DNA derived from amber to be analyzed, a primer set of the present invention, an appropriate amount of a DNA polymerase (for example, Taq polymerase), a dNTP mixture, a PCR buffer solution, . The PCR buffer may contain KCl, Tris-HCl and MgCl _2.

The step of determining the cultivar of the amber from the amplification product obtained in the above method comprises comparing the detection result of the amplified product with the result of amplifying the nucleic acid of the amber varietal known by the 29 pairs of the primer set for identifying the amber varieties ≪ / RTI > Specifically, the step of determining the amber variety from the amplified product may be performed by confirming the size of the amplified product (band) using an automatic nucleotide sequencer by a computer program. For example, the presence or absence of the amplified product (corresponding to each allele) through the primer set of the present invention for a known amber cultivar is summarized in advance in one table. Specifically, "1" is indicated when an allele is present, and "0" is indicated when an allele is not present. Genomic DNA was isolated from an amber to identify the breed, amplified using the primer set of the present invention, analyzed for the size of amplified product, and the result of this analysis was obtained by amplifying the nucleic acid of the known amber varieties The varieties of amber can be determined by comparison through a statistical program.

The present invention also provides a method for testing the purity of the Amber F1 varieties. Amplifying the nucleic acid using genomic DNA derived from amber as a template and using at least one primer set among 29 pairs of primer sets comprising the oligonucleotides of SEQ ID NOS: 1 to 58 as primers; Selecting a primer set having an amplification product having an allele specific to alleles and having a gene-specific allele; Amplifying the nucleic acid using the genomic DNA of the F1 breed of pumpkin to be tested for purity as a template and using the selected primer set as a primer; And if the amplification result shows that the number of alleles is 2 with allele specific alleles, the F1 breed of pumpkin, which is the object of purity test, may be discriminated to be pure.

The genomic DNA can be obtained by using a conventional method of collecting DNA from zucchini seeds and zucchini plants. Using the obtained genomic DNA as a template, amplification is carried out using at least one primer set among the 29 pairs of primer sets, and the presence or absence of amplification products is tabulated. For example, DNA was collected from 160 varieties of pumpkin distributed in domestic market described in the following Table 2 and amplified by using a primer set for identifying an amber variety, and the presence or absence of the amplification product as shown in Figs. Create.

In the above table, a primer set having a specific allele gene for each of the amber varieties, the number of which is 2, that is, a co-dominance primer set is selected. For example, in CMTp137 primer set for 'Nonghyup's Zucchini' (5th breed), since there is only one band indicating an allele, it can not discriminate between the parents. Therefore, a marker for testing the purity of 'Nonghyup's Zucchini' Can not use it. However, CMTm18 (213 bp / 234 bp), CMTm35 (142 bp / 149 bp), CMTm54 (139 bp / 141 bp), CMTm80 (77 bp / 81 bp), CMTm119 (163 bp / 165 bp), and CMTm128 (183 bp / 200 bp) primer set revealed two specific alleles. Therefore, these markers can be used as markers for testing the purity of the cultivars because they can identify the parents of the 'Nonghyup Zucchini' variety.

Genomic DNA of the F1 varieties of pumpkin to be tested for purity is extracted. The method of extracting the genomic DNA is carried out in the same manner as the method of extracting genomic DNA from the amber.

The nucleic acid is amplified using the genomic DNA of the F1 breed of pumpkin to be tested for purity as a template and the selected primer set as a primer.

If the size of the allele in the amplification product is specific to the variety and the number of the allele is two, the F1 cultivar of the pumpkin is determined to be a purebred normal cross between the parents. If the number of alleles in the amplification product is one, the F1 breed of the amber is determined as not crossing between the parents.

Further, the present invention provides a kit for purity assay of amber-mutant hybrid varieties comprising at least one primer set, DNA polymerase and PCR buffer solution among 29 pairs of primer sets comprising oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 58 do. The kit of the present invention comprises at least one of the primer sets of the present invention, a DNA polymerase and a PCR buffer solution. In addition, components necessary for conducting electrophoresis to confirm whether the PCR product is amplified can be further included in the kit of the present invention.

Using only the markers for identification of the amber varieties of the present invention, it is possible to identify 160 main varieties of amber which are sold in domestic and overseas seed markets. Therefore, it can be useful in various fields such as preliminary monitoring of infringement of breed protection through identification of authenticity of pumpkin varieties, confirmation of infringement, selection of control varieties at the time of application for breed protection, and confirmation of purity when producing F1 seeds.

FIGS. 1A to 1D are graphs showing the genetic similarity of the amber varieties according to the present invention by coding each of the amber varieties analyzed by the marker according to the present invention and using the NTSYSPC computer program.
FIGS. 2A to 2T show the presence of bands according to the size (bp) of an allele gene when amplified using 29 primer sets of the present invention on 160 squash cultivars cultivated in Korea. When a band exists Quot; 1 ", and when there is no band, it is represented by " 0 ".

Hereinafter, the present invention will be described in more detail by way of examples. However, the present invention is not limited by the following examples.

Example  1: For the identification of pumpkin varieties Marker  evaluation

(1) Amber samples

In the present invention, the 160 kinds of amber listed in Table 2 were used for screening primer sets for identifying the amber variety and for testing the discrimination possibility of the amber variety.

Serial number Breed name Upbringing company Serial number Breed name Upbringing company Serial number Breed name Upbringing company One Shinto shrine KOREGON 55 Seated flower beds Nongwoo 109 Previous 10 Asia 2 Black Syngenta 56 Ace Plus Eastern 110 Shedding Daelim 3 Serpas KOREGON 57 Friend's seat Eastern 111 Black Daelim 4 Nonghyup's early life foot NH 58 Vanguard Foot Syngenta 112 The chief Sejong 5 Nonghyup Zoo NH 59 Gitora Eastern 113 Kyogokuji Kyungwon 6 Guardian deity Syngenta 60 Mamma night Syngenta 114 Koitei East and West Agricultural 7 Chukin Eastern 61 Mania Night Syngenta 115 Just shine Southern gardening 8 Cool Eastern 62 Honeymoon Sakata 116 Hibiya Great 9 Thousand Foot Foot Nongwoo 63 Great love Great 117 Gold on the throne Nongwoo 10 Hansol Syngenta 64 Sky gold Koo 118 love Eastern 11 BN911 Syngenta 65 Sunny Gold Koo 119 ES-S 05518 Syngenta 12 Probably copper Sea coast 66 A disease free longevity Eastern 120 Kyungwon Flower Kyungwon 13 High affection Eastern 67 marathon Eastern 121 Immortality Kyungwon 14 full Sea coast 68 Thousands Nongwoo 122 Mini mam NH 15 Ohbok Thong Nongwoo 69 Godmother Nongwoo 123 Sasol Great 16 Super flower house Nongwoo 70 Butterfly Nongwoo 124 Mini-pad Great 17 Nonghyup Greene NH 71 Lava rock Nongwoo 125 The Great 18 T1 Gold Eastern 72 Kaywon Thong Purple 126 Kyung Won Lee Kyungwon 19 treasure Daki 73 Bulocho Great 127 Light Fabric Kyungwon 20 One hand Daki 74 World Sun Chair Sakata 128 Bush mandarin most 21 Golden tree Daki 75 Seoul early childhood Zhengfu Syngenta 129 Danong Saraon noodles Danong 22 Nari Yutaka Sakata 76 Mini Cookie Night Eastern 130 Raw earth left Rice 23 Sweet potato Daki 77 Choco Chestnut Eastern 131 Yuti Alto left Great 24 Number Eight Daki 78 Good NH 132 Manseotou Eastern 25 RS114 Syngenta 79 Steel Asia 133 Beisle Hongik 26 Shinotoito Syngenta 80 Als Power Nongwoo 134 Korean peninsula tree Hongik 27 Union Daki 81 Chatter Nongwoo 135 Strong base Eastern 28 Powerful flower bed Nongwoo 82 Cleanup Nongwoo 136 Sweet pink Hyeon Seong Ahn 29 WinWinTo Eastern 83 Honey pot Nongwoo 137 Sparta Hyeon Seong Ahn 30 Wrestling Eastern 84 Flower Eastern 138 Copper bisplus Asia 31 Hometown NH 85 Good night Eom Young-heon 139 Omai Summer Rice 32 Shine Great 86 Wives Samsung 140 Olcani wood block Hongik 33 Yuna Great 87 A famous master Samsung 141 Melotaurus Kyungwon 34 Shiny gold Eastern 88 Bravo night Samsung 142 Fuji Pica Kyungwon 35 Arirang Daki 89 Action night Samsung 143 A big house Eastern 36 Superfine Sakata 90 Super ball room Samsung 144 strike Eastern 37 ace Eastern 91 Wase Ebisu Daki 145 Magic Flower Eastern 38 Gold Toss Gold Eastern 92 Cutie Seed circle 146 Superman Nongwoo 39 My hometown millstone Eastern 93 Super magic turbo Nongwoo 147 Ichon Town Eastern 40 Vitality Gold Nongwoo 94 Winnie flower Nongwoo 148 harmony Eastern 41 Sweet honey NH 95 Lucifer Nongwoo 149 shiny Phi Phi S 42 Freshness Nongwoo 96 Evergreen Town Eastern 150 Strong Eastern 43 Lakeside Syngenta 97 Singleton Eastern 151 Da Vinci Asia 44 Butina Eastern 98 Common Seed 1 Voice actor 152 Ajihira Eastern 45 Mini Gold Dollar Sakata 99 Saikou Eastern 153 Strong heart Phi Phi S 46 Super SM Sakata 100 Ajiguro NH 154 Kyungwon Foot Kyungwon 47 Dabods Plus Foot Eastern 101 Ace ace NH 155 Powerful throne Kyungwon 48 Heroine Great 102 Aurora High concentration 156 Fwon Nolbu Koo 49 Suyuto left Sakata 103 Oh my Rice 157 Coco Chan Crop 50 The first flower Nongwoo 104 Honey pot Danong 158 Kokochan Eastern 51 Powerful New Sakata Sakata 105 Gwangnaepge 30 Great 159 together Changchun 52 Masterpiece seat Syngenta 106 Plus Alpha Kyungwon 160 Kyungwon Jujuni Kyungwon 53 Rich man Eastern 107 Cheongwol Koryo Mountain 54 Fuzhou Foot Nongwoo 108 Ho mala Asia

(2) Extraction of genomic DNA

The disclosed pumpkin seeds listed in Table 2 above were sown on a 50-well plug seedling plate, and after 3 weeks, the leaves of the soft portion were collected and used as a genomic DNA separation material. Two tungsten beads were placed in a 2-mL tube containing collected pumpkin leaves, rapidly frozen in liquid nitrogen (-196 ° C), and vortexing was repeated to polish the tissue evenly. Genomic DNA was isolated from well-ground tissues using the NucleoSpin ^® Plant II (Macherey-Nagel Cat. 740 770.250) kit. The extracted genomic DNA was electrophoresed on 1.0% agarose gel to quantify the DNA concentration, and each DNA was diluted to a concentration of 10 ng per μl and used for PCR analysis.

(3) SSR marker selection for breed identification

In order to select the markers that are effective for the identification of pumpkin varieties, 22 varieties of pumpkin ('Kyungwon Jujini', 'Jinju Jujini', 'Busy Auto', 'Together', 'ESP S 05518', 'Bien 224''Bushido','Chinchilla','Good','Chinnaeon','Shintoism','Bushidan',' Genomic DNAs of 'Copper Aspen', 'Tangerine', 'Super Magic Tongue', 'Fresh Cucumber' and 'Good Cucumber' were amplified using 300 SSR primer sets reported. The amplification product was analyzed by using capillary electrophoresis system (HDA-GT12TM System, eGEnE, Inc.) and computer program (Biocalculator 2.0). As a result of analysis, 29 markers with high pattern polymorphism were selected. In order to perform a precise analysis with these automated markers on an automatic sequencer, fluorescently labeled oligonucleotides were prepared with forward primers as one of the fluorogenic materials FAM, VIC, NED and PET.

(4) PCR amplification and electrophoresis

PCR was performed using the genomic DNA and the marker as a material. The composition of the PCR reaction solution was 20 ng of genomic DNA, 0.1 μM of the above marker, 2.0 μl of dNTP mixture (2.5 mM), 1 μl of Taq polymerase (Takara CAT.RR011A) and 2.5 μl of 10 × PCR buffer (50 mM KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl ₂ ) was added to distilled water to adjust the total volume to 30 μl. PCR (C1000, BioRad, USA) Amplification was performed by denaturing genomic DNA at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, annealing at 50 ° C for 30 seconds, and elongation at 72 ° C for 45 seconds for 40 times Lt; / RTI > The PCR product was reacted at 72 ° C for 10 minutes for final elongation. The annealing temperatures for each primer set are shown in Table 3 below. After completion of the PCR, amplification was confirmed by electrophoresis on 2.8% agarose gel. The amplified samples were stored at -20 ° C for the next experiment. The PCR amplified samples were diluted to 150 μl of ultrapure water at a proper concentration, and then 1.5 μl of the diluted PCR product was diluted with 10 μl of deionized formamide, a size marker to measure the allele size ( LIZ500 size standard), and then denatured at 94 DEG C for 2 minutes. The denatured gene amplification product was electrophoresed using an automatic base sequence analyzer (Genetic Analyzer 3730XL, Applied Biosystem). The allele size of the supersatellite molecule for each breed was measured accurately using the GeneMapper4.0 computer program (Applied Biosystem).

(5) Identification of the amber variety of the marker according to the present invention

Using the allele size confirmed by the automatic nucleotide sequencer, identification of the marker according to the present invention was investigated. Polymorphism information content (PIC) values were calculated using the following equation (1). In the following equation, Pij is the frequency of the jth common band pattern among the bands of the marker i (Anderson et al., 1993, Genome 36: 181-186).

As a result, annealing temperature (° C), amplification product size (bp), number of alleles and PIC value according to each marker are shown in Table 3 below.

<Formula 1>

Serial number SSR marker name Annealing temperature (캜) The size of the allele (bp) Number of alleles PIC value One CMTp137 50 118-170 7 0.552 2 CMTp245 50 115-133 6 0.327 3 CMTp252 50 156-189 9 0.759 4 CMTp254 50 116-136 7 0.673 5 CMTp257 50 110-145 6 0.587 6 CMTm7 50 112-183 14 0.894 7 CMTm18 50 197-334 11 0.861 8 CMTm19 50 097-115 7 0.696 9 CMTm20 50 094-124 7 0.675 10 CMTm34 50 104-125 5 0.613 11 CMTm35 50 104-149 10 0.690 12 CMTm37 50 136-160 4 0.574 13 CMTm48 50 096-250 10 0.740 14 CMTm52 50 191-251 9 0.821 15 CMTm54 50 120-141 5 0.650 16 CMTm60 50 100-124 8 0.628 17 CMTm61 50 096-102 3 0.562 18 CMTm63 50 108-134 6 0.743 19 CMTm80 50 069-099 6 0.687 20 CMTm87 50 157-162 6 0.675 21 CMTm88 50 119-139 4 0.479 22 CMTm91 50 112-172 13 0.645 23 CMTm111 50 107-112 3 0.650 24 CMTm119 50 135-261 12 0.868 25 CMTm128 50 084-122 12 0.851 26 CMTm135 50 116-122 2 0.500 27 CMTm137 50 082-106 7 0.717 28 CMTm162 50 082-109 10 0.665 29 CMTm164 50 175-200 6 0.766 sum 215 16.051

As shown in Table 3, two of the markers used in the present invention (CMTp245, CMTm88) showed a PIC value lower than 0.50, and the remaining 27 were 0.500 to 0.894, indicating a high PIC value. Therefore, the use of the marker of the present invention can sufficiently discriminate the amber variety.

For each marker, the presence or absence of amplification product of each allele was analyzed using a computer program of NTSYS pc (version 2.10b) (Rohlf, 2000, Numerical Taxonomy and Multivariate Analysis System-Version 2.10b. Applied Biostatistics Inc., New York) And genetic similarity values were calculated according to Jaccard's method (Sneath and Sokal 1973, Numerical taxonomy: The Principles and Practice of Numerical Classification, WH Freeman, San Francisco.). Using a genetic similarity measure, an unweighted pair-group method with an arithmetical average (Sneath and Sokal, 1973) was used to analyze the cluster and a dendrogram was created. The results are shown in FIGS. 1A to 1D, it can be seen that the primer set of the present invention enables identification of 160 amber varieties distributed in Korea.

Example  2: Identification of varieties of pumpkin

(1) Using the marker of the present invention to prepare a variety identification list

Genomic DNA was extracted from each of the 160 pumpkin cultivars cultivated in Korea according to the method (2) of Example 1. PCR was carried out according to the method of (1) in (1) using 29 markers of the present invention as a primer set. From the PCR results, the presence or absence of the bands for the marker of the present invention was determined. When the bands existed, they were coded to score 1, and when there were no bands, they were coded as 0, The results are shown in Figs. As shown in FIGS. 2A to 2T, each of the amber cultivars exhibited different band patterns according to the respective markers. For example, in Table 2, 'Nonghyup's Zucchini', the number 5 of the amber varieties, had an allele at 147 bp when amplified with the molecular marker CMTp137 and two alleles at 142 bp and 149 bp when amplified with CMTm35 There is a gene.

(2) Identification of varieties of pumpkin

Pumpkin seeds were sown on a 50 - well plug seedling plate and after 3 weeks, seedlings were extracted from the leaves and used as genomic DNA isolation material. Three pieces of tungsten beads were placed in a 2 mL tube containing collected pumpkin leaves and rapidly frozen using liquid nitrogen (-196 ° C). The vortexing procedure was repeated to polish the tissue evenly. Genomic DNA was isolated from well-ground tissues using the NucleoSpin ^® Plant II kit. The extracted genomic DNA was electrophoresed on a 1.0% agarose gel to quantitate the DNA concentration, and each DNA was diluted to a concentration of 10 ng per μl.

Using the 29 markers of the present invention, the extracted genomic DNA was subjected to PCR amplification with a template and electrophoresed. PCR amplification and electrophoresis were carried out in the same manner as described in Example 1. The results of the electrophoresis were compared with those of FIGS. 2A to 2T. As a result of comparison, it was confirmed that the amber which was intended to discriminate the cultivar was the 'Nonghyup zucchini' because it showed the same shape in terms of the presence and size of the amplified product and the band of 'Nonghyup zucchini'.

Example  3: Pumpkin F1 seed purity test Marker  Selection

2 (a) to 2 (t), CMTp137 (147 bp), CMTp245 (124 bp), CMTp252 (161 bp), CMTp254 (134 bp), CMTp257 (119 bp), CMTm7 (167 bp), CMTm19 (124bp), CMTm34 (110bp), CMTm37 (136bp), CMTm48 (96bp), CMTm52 (245bp), CMTm60 (104bp), CMTm61 (102bp), CMTm63 (108bp), CMTm87 The PCR amplification using the marker (126 bp), CMTm111 (107 bp), CMTm135 (122 bp), CMTm137 (101 bp) and CMTm162 (96 bp) showed only bands corresponding to one allele, It can not be used for testing. However, the marker CMTm18 (213 bp / 234 bp), CMTm35 (142 bp / 149 bp), CMTm54 (139 bp / 141 bp), CMTm80 (77 bp / 81 bp), CMTm119 (163 bp / 165 bp), and CMTm128 200bp) showed a band corresponding to two parent - specific alleles of F1 breed. Therefore, these markers can be used as a marker for judging that the 'Nonghyup Zucchini' variety of pumpkin was produced by the normal mating of the parents.

Example  4: Purity of pumpkin F1 seed

The seeds of the 'Nonghyup Choo' variety to be tested for purity were isolated according to the procedure described in (2) of Example 2 above. The separated DNA was subjected to PCR amplification using the markers CMTm18, CMTm35, CMTm54, CMTm80, CMTm119, CMTm128, and CMTm164. Amplification conditions were the same as described in (4) of Example 1 above.

Two amplification products corresponding to each allele were obtained for each marker by PCR amplification. As a result of comparing with the breed identification table of Figs. 2a to 2t, the presence and size of the amplified products of each marker were in agreement with those of the Nonghyup zucchini varieties. Therefore, it was found that the seeds of the tested 'Nonghyup Zucchini' F1 breed were purebreds produced from the normal mating of the parents.

<110> Korea Seed and Variety Service <120> A method for identifying pumpkin varieties using microsatellites          markers <130> PN103102 <160> 58 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CMTp137_F <400> 1 tgaaatctct gcgagacaaa ag 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CMTp137_R <400> 2 aattcagatt gagagggagg tg 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTp245_F <400> 3 aggtaactgc accccagcta 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTp245_R <400> 4 cccatctctc aagctcatcc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTp252_F <400> 5 tctcactcat ccaccacacc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTp252_R <400> 6 cgtttcgagt catttgttcg 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CMTp254_F <400> 7 ccccacatcc atatatccac a 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CMTp254_R <400> 8 ctccaatgca caaccttgc 19 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CMTp257_F <400> 9 cacgaagatt tgatggcctt a 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTp257_R <400> 10 ggattgggat ggtgaagatg 20 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CMTm7_F <400> 11 aaccaaactc cggcaaga 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm7_R <400> 12 gttctctccg ttcaggatgg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm18_F <400> 13 atgggtttca ccaaaagctg 20 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CMTm18_R <400> 14 aagcggacga ctgacgac 18 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm19_F <400> 15 gcatgggaga tgaaggttag 20 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CMTm19_R <400> 16 atttcctggt ggtatgagat tc 22 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm20_F <400> 17 gtgggccata tcgattcact 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm20_R <400> 18 cgaaagtcgc agagaacaca 20 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CMTm34_F <400> 19 tgaaactaca ctacatgacc ttgg 24 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CMTm34_R <400> 20 tgggttggta gacttgtagt tga 23 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CMTm35_F <400> 21 catcaggtta ttgagtttta ctcagac 27 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CMTm35_R <400> 22 tcgtctgccc caataattc 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm37_F <400> 23 cgtgtttgtg ttggaaaagc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm37_R <400> 24 aagcaaaccc acagaaggag 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm48_F <400> 25 aagcctttgg ggacctttac 20 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CMTm48_R <400> 26 ttgaaacctt caaacaagaa attg 24 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm52_F <400> 27 gctctccatt ttccagcttc 20 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CMTm52_R <400> 28 gacgcagagg gagattaatg a 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm54_F <400> 29 gtgtggatgc aaatggtgag 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm54_R <400> 30 gggaatcgag ggttttgaat 20 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CMTm60_F <400> 31 tcctccaaag cataccaact gt 22 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CMTm60_R <400> 32 gcgccatttt attgattgga t 21 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm61_F <400> 33 gccattattc cactccatgc 20 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CMTm61_R <400> 34 tgcctgcacc tgttttagc 19 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm63_F <400> 35 gcagaagata ccgtcggagt 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm63_R <400> 36 aaggtgaacg ggaatgtgag 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm80_F <400> 37 ggcctaatgg gttgtgaaga 20 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CMTm80_R <400> 38 agtggaatcc atttgttcgt g 21 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CMTm87_F <400> 39 aatctgcaaa cggacttcaa t 21 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm87_R <400> 40 tcacagtgat ccccaaactc 20 <210> 41 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CMTm88_F <400> 41 catcgacatt cgcctcatc 19 <210> 42 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CMTm88_R <400> 42 aggcagcttc caaatcagc 19 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm91_F <400> 43 ccctagaatt agtgggcaat 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm91_R <400> 44 taggcctaaa aagacccaat 20 <210> 45 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CMTm111_F <400> 45 ctccattccc atggcttc 18 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm111_R <400> 46 ccatgagctt gagagaggtg 20 <210> 47 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CMTm119_F <400> 47 gaagctgccg gaagttagc 19 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm119_R <400> 48 gggaccaccc tcttctcttc 20 <210> 49 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CMTm128_F <400> 49 accaattttt gattttcagt ttgc 24 <210> 50 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CMTm128_R <400> 50 agggggaaga aaagcgaag 19 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm135_F <400> 51 gtggccgtag gtttgtcagt 20 <210> 52 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CMTm135_R <400> 52 tcagagaatc ggagcagaga g 21 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CMTm137_F <400> 53 acgttctttc tgcctccat 19 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm137_R <400> 54 atgcccatta tgcaattctc 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm162_F <400> 55 tggatgggga aattattgga 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm162_R <400> 56 attcagggga gattgggact 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMTm164_F <400> 57 agcctttcag aagaaccaag 20 <210> 58 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CMTm164_R <400> 58 ggcttcaaac aaatactaac ca 22

Claims (8)

A CMTp137 primer set consisting of the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2;
A CMTp245 primer set consisting of the oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4;
A CMTp252 primer set consisting of the oligonucleotides of SEQ ID NO: 5 and SEQ ID NO: 6;
A CMTp254 primer set consisting of oligonucleotides of SEQ ID NO: 7 and SEQ ID NO: 8;
A CMTp257 primer set consisting of oligonucleotides of SEQ ID NO: 9 and SEQ ID NO: 10;
A CMTm7 primer set consisting of the oligonucleotides of SEQ ID NO: 11 and SEQ ID NO: 12;
A CMTm18 primer set consisting of the oligonucleotides of SEQ ID NO: 13 and SEQ ID NO: 14;
A CMTm19 primer set consisting of the oligonucleotides of SEQ ID NO: 15 and SEQ ID NO: 16;
A CMTm20 primer set consisting of oligonucleotides of SEQ ID NO: 17 and SEQ ID NO: 18;
A CMTm34 primer set consisting of oligonucleotides of SEQ ID NO: 19 and SEQ ID NO: 20;
A CMTm35 primer set consisting of oligonucleotides of SEQ ID NO: 21 and SEQ ID NO: 22;
A CMTm37 primer set consisting of oligonucleotides of SEQ ID NO: 23 and SEQ ID NO: 24;
A CMTm48 primer set consisting of oligonucleotides of SEQ ID NO: 25 and SEQ ID NO: 26;
A CMTm52 primer set consisting of oligonucleotides of SEQ ID NO: 27 and SEQ ID NO: 28;
A CMTm54 primer set consisting of oligonucleotides of SEQ ID NO: 29 and SEQ ID NO: 30;
A CMTm60 primer set consisting of oligonucleotides of SEQ ID NO: 31 and SEQ ID NO: 32;
A CMTm61 primer set consisting of oligonucleotides of SEQ ID NO: 33 and SEQ ID NO: 34;
A CMTm63 primer set consisting of oligonucleotides of SEQ ID NO: 35 and SEQ ID NO: 36;
A CMTm80 primer set consisting of oligonucleotides of SEQ ID NO: 37 and SEQ ID NO: 38;
A CMTm87 primer set consisting of oligonucleotides of SEQ ID NO: 39 and SEQ ID NO: 40;
A CMTm88 primer set consisting of the oligonucleotides of SEQ ID NO: 41 and SEQ ID NO: 42;
A CMTm91 primer set consisting of oligonucleotides of SEQ ID NO: 43 and SEQ ID NO: 44;
A CMTm111 primer set consisting of the oligonucleotides of SEQ ID NO: 45 and SEQ ID NO: 46;
A CMTm119 primer set consisting of oligonucleotides of SEQ ID NO: 47 and SEQ ID NO: 48;
A CMTm128 primer set consisting of oligonucleotides of SEQ ID NO: 49 and SEQ ID NO: 50;
A CMTm135 primer set consisting of oligonucleotides of SEQ ID NO: 51 and SEQ ID NO: 52;
A CMTm137 primer set consisting of oligonucleotides of SEQ ID NO: 53 and SEQ ID NO: 54;
A CMTm162 primer set consisting of oligonucleotides of SEQ ID NO: 55 and SEQ ID NO: 56; And
A primer set for identification of a variety of squash cultivars comprising a CMTm164 primer set consisting of oligonucleotides of SEQ ID NO: 57 and SEQ ID NO: A kit for identifying an amber variety, comprising a primer set for identifying an amber variety in claim 1, a DNA polymerase, and a PCR buffer solution. Amplifying the nucleic acid using genomic DNA derived from amber as a template and using a primer set for identifying an amber variety in claim 1 as a primer; And
And determining the varieties of amber from the resulting amplification products. 4. The method according to claim 3, wherein the genomic DNA is derived from leaves, stems and fruit of the seeds or young plants of the amber. The method according to claim 3, wherein the detection of the obtained amplification product is performed by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. 4. The method according to claim 3, wherein the step of determining the cultivar of amber from the obtained amplification product comprises comparing the detection result of the obtained amplification product with the result of amplifying the nucleic acid of the amber varietal known by the amber varietal identification primer set of claim 1 &Lt; / RTI &gt; Amplifying the nucleic acid using the genome DNA derived from amber as a template and the primer set of claim 1 as a primer;
Selecting a primer set having an amplification product having an allele specific to alleles and having a gene-specific allele;
Amplifying the nucleic acid using the genomic DNA of the F1 breed of pumpkin to be tested for purity as a template and using the selected primer set as a primer; And
The purity of amber hybrid (F1) cultivars, including the step of discriminating the F1 breed as an object of purity, to be pure, when the amplification result shows that the number of alleles is 2 with the breed-specific allele How to. A kit for assaying purity of an amber mixed variety comprising the primer set for identifying the amber varieties of claim 1, a DNA polymerase and a PCR buffer solution.

Images