KR101603156B1 - A method for identifying citrus varieties using microsatellites markers - Google Patents

A method for identifying citrus varieties using microsatellites markers Download PDF

Info

Publication number
KR101603156B1
KR101603156B1 KR1020140022893A KR20140022893A KR101603156B1 KR 101603156 B1 KR101603156 B1 KR 101603156B1 KR 1020140022893 A KR1020140022893 A KR 1020140022893A KR 20140022893 A KR20140022893 A KR 20140022893A KR 101603156 B1 KR101603156 B1 KR 101603156B1
Authority
KR
South Korea
Prior art keywords
citrus
cim
primer set
seq
nos
Prior art date
Application number
KR1020140022893A
Other languages
Korean (ko)
Other versions
KR20150101319A (en
Inventor
홍지화
권용삼
채치원
윤무경
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020140022893A priority Critical patent/KR101603156B1/en
Publication of KR20150101319A publication Critical patent/KR20150101319A/en
Application granted granted Critical
Publication of KR101603156B1 publication Critical patent/KR101603156B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Abstract

본 발명은 초위성체 프라이머 세트를 이용한 감귤 품종식별 방법에 관한 것이다. 보다 상세하게는 국내에서 수집된 감귤 77개 품종에 대해 다형성을 보이는 감귤 품종식별용 초위성체 프라이머 세트를 이용한 감귤 품종의 식별방법에 관한 것이다. 본 발명에 따른 프라이머 세트를 감귤 품종 식별용 초위성체 마커로 사용함으로써, 감귤 품종의 진위성 규명, 농가와 회사 및 회사와 회사 간의 종자 분쟁의 중재 및 품종보호 출원품종의 대조품종 선정 등과 같은 여러 분야에 크게 기여할 수 있다.The present invention relates to a citrus variety identification method using a supersatellite primer set. More particularly, the present invention relates to a method for identifying citrus cultivars using a supermatcher primer set for discriminating citrus cultivars showing polymorphism in 77 citrus cultivars collected in Korea. By using the primer set according to the present invention as a supersatellite marker for citrus cultivar identification, it is possible to identify the authenticity of the citrus cultivar, to mediate the seed dispute between the farmer and the company and between the company and the company, and to select the control varieties of the varieties Can greatly contribute.

Figure R1020140022893
Figure R1020140022893

Description

초위성체 마커를 이용한 감귤 품종식별 방법{A method for identifying citrus varieties using microsatellites markers}Technical Field [0001] The present invention relates to a method for identifying citrus varieties using microsatellite markers,

본 발명은 초위성체 마커를 이용한 감귤 품종식별 방법에 관한 것이다. 보다 상세하게는, 감귤 품종을 식별하기 위한 초위성체 프라이머 세트, 상기 프라이머 세트를 포함하는 키트, 및 상기 프라이머 세트를 이용한 감귤 품종의 식별 방법에 관한 것이다.The present invention relates to a citrus variety identification method using a supersatellite marker. More particularly, the present invention relates to a supersatellite primer set for identifying citrus cultivars, a kit including the primer set, and a method for identifying citrus cultivars using the primer set.

DNA 마커는 게놈상에서 다형성 여부를 판단할 수 있는 특정 염기서열 단편으로 작물 육종분야에서 형질과 연관된 마커의 개발과 이를 이용한 marker assisted selection (MAS), 유전자 지도 작성, 양적 형질 유전자좌 분석, 순도 검정, 유전적 다양성 분석 및 품종식별 등의 분야에 활용되고 있다. DNA markers are specific nucleotide sequences that can be used to determine polymorphisms in the genome. These include marker-assisted selection (MAS), gene mapping, quantitative trait locus analysis, purity assay, genetic markers And is used in fields such as species diversity analysis and breed identification.

일반적으로 식물 품종을 식별하는 방법은 크게 재배시험을 통한 형태적 특성 검정과 품종간 동위효소의 차이를 통한 검정, DNA 분석 방법으로 나뉜다. 이 중 DNA 분석 방법은 표현형에 근거한 식별방법에 비해 재배환경 및 작물의 생장단계에 영향을 받지 않아 객관적이며 재현성 또한 높다는 장점이 있다. 국제 신품종 보호 연맹(UPOV)은 DNA 마커를 신품종의 특성조사와 식물 신품종보호권 부여에 활용하기 위한 논의를 진행 중이며, 아직까지 유전자 수준에서 단순한 염기서열 차이를 품종의 구별성으로 인정하고 있지는 않으나, 품종식별을 위한 분자표지의 활용 가능성을 제안하고 있다. 구체적으로 분자표지 종류 중 품종간 다형성 정도, 분석의 재현성, 염색체상의 분포 정도를 고려할 때 SSR(Simple Sequence Repeat), SNP(Single Nucleotide Polymorphism) 방법을 활용하는 것을 제안하고 있다. In general, methods for identifying plant cultivars are divided into two stages: morphological characterization through cultivation tests, assays based on differences between isoenzymes and DNA analysis methods. DNA analysis method is advantageous in that it is objective and reproducible because it is not influenced by cultivation environment and crop growth stage as compared with phenotype-based identification method. The UPOV is in the process of discussing the use of DNA markers for the investigation of the characteristics of new varieties and for granting protection to new varieties of plants. Although the genetic sequence does not recognize simple nucleotide sequence differences as varieties, Suggesting the possibility of using molecular beacons for identification. Specifically, SSR (Simple Sequence Repeat) and SNP (Single Nucleotide Polymorphism) methods are proposed to take into consideration the degree of polymorphism among varieties, reproducibility of analysis, and chromosomal distribution.

국내에서 품종식별에 대한 DNA 분석 개발 및 활용 현황을 살펴보면, 농촌진흥청에서 벼, 콩 등에 대한 SSR 분자표지 및 딸기에 대한 CAPS 분자표지를 이용한 품종식별 기술을 보고한 바 있다. 국립종자원은 SSR 분자표지를 이용하여 고추, 배추, 수박, 토마토, 복숭아, 장미, 양파, 사과, 상추, 블루베리 등에 대한 작물의 DNA 프로파일을 데이터베이스화하였으며, 종자 분쟁 발생 시 이를 중재하기 위한 수단으로서 분자표지를 활용하고 품종보호 출원품종에 대한 대조품종 선정에 유전자 분석 결과를 활용하고 있는 추세이다. In Korea, RDA has reported the SSR molecular labeling for rice and soybean and the breeding identification technology using CAPS molecular label for strawberry. The National Seed Institute has used SSR molecular markers to database the crop DNA profile for pepper, cabbage, watermelon, tomato, peach, rose, onion, apple, lettuce, blueberry and so on. And the use of genetic analysis results in selection of control varieties for varieties of protected varieties.

국외 국가의 사례를 살펴보면 스페인에서는 포도, 복숭아 등의 작물에 SSR 분석 기술을 이용하여 각 품종별 DNA 프로파일을 데이터베이스화하여 기본 유래 품종의 식별, 기존 품종 관리 등에 활용하고 있다. 중국의 경우 옥수수 약 4000 품종에 대하여 SSR, SNP 분자표지를 이용한 DNA 프로파일을 데이터베이스화하고 있으며 법원에서도 품종보호 침해사례 판단에 유전자분석 결과를 적극 활용하고 있다. 일본은 복숭아, 배, 사과 등에 SSR 분자표지와, 딸기, 차에 CAPS 분자표지를 활용한 품종식별 방법을 개발하여 육종가 권리 보호에 활용하고 있다. 또한, 유럽에서는 감자, 토마토 등에 대하여 많은 품종을 수집하여 DNA 프로파일 데이터베이스를 구축한 후 재배심사에 활용 가능성을 연구 중에 있다. In Spain, SSR analysis technology for grape and peach crops in Spain is used to identify the basic derived varieties and to manage the existing varieties by databaseing the DNA profiles for each varieties. In China, DNA profiles using SSR and SNP molecular markers are databaseed for about 4,000 corn varieties. The court also uses gene analysis results to judge cases of breed protection breaches. Japan has developed SSR molecular markers for peaches, pears, and apples, and varietal identification methods using CAPS molecular markers on strawberries and tea, and is using them to protect breeder rights. In Europe, a variety of varieties are collected for potatoes, tomatoes, etc., and a DNA profile database is constructed and studied for its potential for cultivation.

감귤은 로열티 문제로 인해 2012년 1월 7일 품종보호 대상작물로 가장 늦게 지정된 작물로서 국내 신품종의 육성이 시급하고, 품종보호 등록된 품종의 식별이 매우 중요한 작물 중 하나이다. 오늘날 감귤류라고 하면 식물분류학적으로 운향과 감귤아과의 감귤속, 금감속, 탱자속, Citroncirus속 등이 있으며, 감귤속에는 만다린(밀감), 오렌지, 온주밀감, 탄제린, 탄젤로, 탄골, 레몬, 문단, 유자, 파페다, 씨트론 등 다양한 종이 존재한다. 국립종자원에 신고된 감귤의 생산판매신고 품종수는 166건으로(2014년 1월 기준) 과수종자 시장에서 차지하는 비중이 높다고 할 수 있다. 감귤은 재배시험시 재배 환경의 영향을 받고, 품종 육종시 목표 형질 선발에 시간이 소요되기에 분자표지를 이용한 육종 및 DNA 분석 방법에 의한 품종식별의 중요도가 증대되고 있으며 이에 대한 기술 확립이 시급한 상황이다. Due to the problem of royalties, tangerine is one of the most important crops to be protected as varieties on January 7, 2012, and it is urgent to cultivate new domestic varieties and identification of varieties is very important. Citrus fruits include citrus fruits, mandarins, citrus fruits, citrus fruits, citrus fruits, citrus fruits, citrus fruits, citrus fruits, citrus fruits, There are various species such as paragraphs, citron, papeda, citron. The number of reported varieties of citrus production reported to the National Seed Source is 166 (as of January 2014), which accounts for a large portion of the fruit seed market. The importance of cultivar identification by breeding and DNA analysis methods using molecular markers is increasing because the citrus is affected by the cultivation environment during cultivation and it takes time to select target traits in breeding. to be.

따라서 본 발명에서는 국내에서 유통 및 수집된 감귤속(만다린(밀감), 오렌지, 온주밀감, 탄골, 탄제린, 탄제린 X 탄젤로, 탄골, 레몬, 문단, 유자, 파페다, 그레이프후르트, 씨트론, 제주재래), 금감속, 탱자속에 해당되는 품종을 식별할 수 있는 감귤 품종식별 방법 및 체계를 확립하고자 하였다.Accordingly, the present invention provides a method for producing citrus fruit, which is distributed and collected in Korea, And to establish a method and system for identifying citrus cultivars that can discriminate the varieties belonging to the genus Tangis.

본 발명은 감귤 품종식별용 프라이머 세트를 제공한다.The present invention provides a primer set for citrus variety identification.

본 발명은 상기 프라이머 세트를 포함하는 감귤 품종식별용 키트를 제공한다.The present invention provides a citrus variety identifying kit comprising the primer set.

본 발명은 상기 프라이머 세트를 이용하여 감귤의 품종을 식별하는 방법을 제공한다.The present invention provides a method for identifying a variety of citrus fruits using the primer set.

본 발명은 서열번호 1 및 2의 올리고뉴클레오티드로 이루어지는 CIM-1 프라이머 세트; 서열번호 3 및 4의 올리고뉴클레오티드로 이루어지는 CIM-2 프라이머 세트; 서열번호 5 및 6의 올리고뉴클레오티드로 이루어지는 CIM-3 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드로 이루어지는 CIM-4 프라이머 세트; 서열번호 9 및 10의 올리고뉴클레오티드로 이루어지는 CIM-5 프라이머 세트; 서열번호 11 및 12의 올리고뉴클레오티드로 이루어지는 CIM-6 프라이머 세트; 서열번호 13 및 14의 올리고뉴클레오티드로 이루어지는 CIM-7 프라이머 세트; 서열번호 15 및 16의 올리고뉴클레오티드로 이루어지는 CIM-8 프라이머 세트; 서열번호 17 및 18의 올리고뉴클레오티드로 이루어지는 CIM-9 프라이머 세트; 서열번호 19 및 20의 올리고뉴클레오티드로 이루어지는 CIM-10 프라이머 세트; 서열번호 21 및 22의 올리고뉴클레오티드로 이루어지는 CIM-11 프라이머 세트; 및 서열번호 23 및 24의 올리고뉴클레오티드로 이루어지는 CIM-12 프라이머 세트로 구성된 군으로부터 선택되는 하나이상의 프라이머 세트(이하 'CIM-1 내지 CIM-12 프라이머 세트 중 하나 이상의 프라이머 세트'라고도 함)를 포함하는, 감귤 품종을 식별하기 위한 프라이머 세트를 제공한다. The present invention relates to a CIM-1 primer set consisting of oligonucleotides of SEQ ID NOS: 1 and 2; A CIM-2 primer set consisting of the oligonucleotides of SEQ ID NOS: 3 and 4; A CIM-3 primer set consisting of the oligonucleotides of SEQ ID NOS: 5 and 6; A CIM-4 primer set consisting of the oligonucleotides of SEQ ID NOS: 7 and 8; A CIM-5 primer set consisting of the oligonucleotides of SEQ ID NOS: 9 and 10; A CIM-6 primer set consisting of the oligonucleotides of SEQ ID NOS: 11 and 12; A CIM-7 primer set consisting of the oligonucleotides of SEQ ID NOS: 13 and 14; A CIM-8 primer set consisting of the oligonucleotides of SEQ ID NOS: 15 and 16; A CIM-9 primer set consisting of the oligonucleotides of SEQ ID NOS: 17 and 18; A CIM-10 primer set consisting of the oligonucleotides of SEQ ID NOS: 19 and 20; A CIM-11 primer set consisting of the oligonucleotides of SEQ ID NOS: 21 and 22; And a set of CIM-12 primers consisting of oligonucleotides of SEQ ID NOs: 23 and 24 (hereinafter also referred to as 'one or more primer sets of CIM-1 to CIM-12 primer sets') , And a primer set for identifying citrus cultivars.

상기 프라이머 세트는 국내에서 유통되는 감귤 품종에 대해 높은 다형성을 나타낼 수 있다. 상기 프라이머 세트는 감귤속(Citrus), 금자속(Fortunella), 탱자속(Poncirus), 또는 시트론시러스속(Citroncirus)에 속하는 감귤 품종에 대해 높은 다형성을 나타낼 수 있다. 따라서, 상기 프라이머 세트는 감귤속, 금자속, 탱자속, 또는 시트론시러스속에 속하는 감귤 품종을 식별하기 위해 이용될 수 있다. 상기 감귤속에 속하는 품종은 예를 들면, 만다린(밀감), 오렌지, 온주밀감, 탄제린, 탄제린 X 탄젤로, 탄골, 레몬, 문단, 유자, 파페다, 그레이프후르트, 씨트론, 또는 제주재래로 분류되는 것일 수 있다. 상기 프라이머 세트는 예를 들면, 하기 표 2에 기재된 감귤 품종을 식별하기 위해 이용되는 것일 수 있다. The primer set may exhibit high polymorphism for citrus cultivars distributed in Korea. The primer set may represent the high polymorphism for citrus varieties belonging to the genus citrus (Citrus), in Kaneko (Fortunella), taengja in (Poncirus), or when Russ in Citron (Citroncirus). Thus, the primer set can be used to identify citrus cultivars belonging to the genera of the genus Citrus, Porphyra species, Pseudomonas species, or Citron Syrus. The varieties belonging to the above-mentioned citrus are, for example, Mandarins, Orange, Wenzhou Citrus, Tangerine, Tangerine X Tangelo, Tangol, Lemongrass, Yuzawa, Papeda, Grapefruit, Citron, . ≪ / RTI > The primer set may be, for example, one used to identify citrus cultivars described in Table 2 below.

상기 프라이머 세트는 CIM-1 내지 CIM-12 프라이머 세트 중 2 이상, 3 이상, 4 이상, 5 이상, 6 이상, 7 이상, 8 이상, 9 이상, 10 이상, 또는 11 이상의 프라이머 세트를 포함할 수 있다. 바람직하게는, 상기 프라이머 세트는 CIM-1 내지 CIM-12 프라이머 세트를 모두 포함할 수 있다. 본 발명의 서열번호 1 내지 서열번호 24의 올리고뉴클레오티드를 포함하는 12쌍의 프라이머 세트를 하기 표 1에 나타내었다. 본 명세서에서 '마커'는 각 프라이머 세트를 통해 얻어진 증폭 산물 또는 각 프라이머 세트 자체를 의미하는 것일 수 있다.The primer set may include at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 primer sets in the CIM-1 to CIM-12 primer sets have. Preferably, the primer set may include all of the CIM-1 to CIM-12 primer sets. 12 pairs of primer sets containing the oligonucleotides of SEQ ID NOS: 1 to 24 of the present invention are shown in Table 1 below. As used herein, 'marker' may refer to an amplification product obtained through each primer set or each primer set itself.

서열번호SEQ ID NO: 마커명Marker name 프라이머의 염기서열 (5’→3’)The base sequence (5 'to 3') of the primer 형광표지Fluorescent marker 1One CIM-1CIM-1 정방향 : GAAAGGGTTACTTGACCAGGCForward: GAAAGGGTTACTTGACCAGGC VICVIC 22 역방향 : ATTCCCAGCTGCACAAGCReverse: ATTCCCAGCTGCACAAGC 33 CIM-2CIM-2 정방향 : GCTTTCGATCCCTCCACATAForward: GCTTTCGATCCCTCCACATA NEDNED 44 역방향 : GATCCCTACAATCCTTGGTCCReverse direction: GATCCCTACAATCCTTGGTCC 55 CIM-3CIM-3 정방향 : AAAGGGAAAGCCCTAATCTCAForward: AAAGGGAAAGCCCTAATCTCA PETPET 66 역방향 : CTTCCTCTTGCGGAGTGTTCReverse: CTTCCTCTTGCGGAGTGTTC 77 CIM-4CIM-4 정방향 : ACAGAAGAGGAGCCATTATTTForward: ACAGAAGAGGAGCCATTATTT FAMFAM 88 역방향 : CAGAGAGAACCCGAAGAAGReverse direction: CAGAGAGAACCCGAAGAAG 99 CIM-5CIM-5 정방향 : AATCCACTCTCAAACACCAGForward: AATCCACTCTCAAACACCAG VICVIC 1010 역방향 : AACTGCCAAATAACTACCATTCReverse: AACTGCCAAATAACTACCATTC 1111 CIM-6CIM-6 정방향 : GCAAATACCAATCACCTTCTACForward: GCAAATACCAATCACCTTCTAC FAMFAM 1212 역방향 : GTTTACCTACCTTCACCACCTReverse: GTTTACCTACCTTCACCACCT 1313 CIM-7CIM-7 정방향 : ATCAGCAAATAAAGTGGACAAForward: ATCAGCAAATAAAGTGGACAA NEDNED 1414 역방향 : TAGGATAGAAGTTGGGAGATGReverse direction: TAGGATAGAAGTTGGGAGATG 1515 CIM-8CIM-8 정방향 : TTACCCTTGCCGTTTCCGTGForward: TTACCCTTGCCGTTTCCGTG VICVIC 1616 역방향 : CGTGATTCTGATTGGTTGCTGGReverse direction: CGTGATTCTGATTGGTTGCTGG 1717 CIM-9CIM-9 정방향 : AATGCGTGGGCAATAACTTCForward: AATGCGTGGGCAATAACTTC VICVIC 1818 역방향 : TTCAATATCGGCCCAAACTCReverse direction: TTCAATATCGGCCCAAACTC 1919 CIM-10CIM-10 정방향 : GCTTCTTGGAATGGAGCAAGForward: GCTTCTTGGAATGGAGCAAG FAMFAM 2020 역방향 : CGTTTTTCTGAGGTCACGGTReverse: CGTTTTTCTGAGGTCACGGT 2121 CIM-11CIM-11 정방향 : GAGTTGGGATTCTGCTGTTGAForward: GAGTTGGGATTCTGCTGTTGA FAMFAM 2222 역방향 : GACTGTTGTTCTGATGCCGAReverse: GACTGTTGTTCTGATGCCGA 2323 CIM-12CIM-12 정방향 : GCTATGTTATGATACGTCTGForward: GCTATGTTATGATACGTCTG PETPET 2424 역방향 : AGACTCACGTAACCTACTTCReverse direction: AGACTCACGTAACCTACTTC

상기 프라이머 세트를 구성하는 올리고뉴클레오티드는 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트와 같은 뉴클레오티드 유사체(analogue), 펩티드 핵산(peptide nucleic acid) 또는 삽입 물질(intercalating agent)을 포함할 수 있다. 상기 올리고뉴클레오티드는 형광, 인광 또는 방사성을 발하는 표지 물질을 더 포함할 수 있다. 상기 형광 표지 물질은 VIC, NED, FAM, PET, 또는 이들의 조합일 수 있다. 상기 표지 물질은 상기 올리고뉴클레오티드의 5' 말단에 표지될 수 있다. 또한, 방사성 표지 물질은, 32P 또는 35S 와 같은 방사성 동위원소가 첨가된 PCR 반응액을 이용한 PCR 반응을 통해 증폭 산물에 혼입될 수 있다.
The oligonucleotide constituting the primer set may include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, a peptide nucleic acid or an intercalating agent. The oligonucleotide may further comprise fluorescent, phosphorescent or radioactive labeling substance. The fluorescent labeling substance may be VIC, NED, FAM, PET, or a combination thereof. The labeling substance may be labeled at the 5 ' end of the oligonucleotide. In addition, the radioactive labeling substance can be incorporated into the amplification product through PCR reaction using a PCR reaction solution in which a radioisotope such as 32 P or 35 S is added.

또한, 본 발명은 CIM-1 내지 CIM-12 프라이머 세트 중 하나 이상의 프라이머 세트를 포함하는, 감귤 품종식별용 키트를 제공한다. 상기 키트는 CIM-1 내지 CIM-12 프라이머 세트 중 2 이상, 3 이상, 4 이상, 5 이상, 6 이상, 7 이상, 8 이상, 9 이상, 10 이상, 또는 11 이상의 프라이머 세트를 포함할 수 있다. 바람직하게는, 상기 키트는 CIM-1 내지 CIM-12 프라이머 세트를 모두 포함할 수 있다. Further, the present invention provides a citrus variety identification kit comprising at least one primer set of CIM-1 to CIM-12 primer sets. The kit may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 primer sets in the CIM-1 to CIM-12 primer sets . Preferably, the kit may include all of the CIM-1 to CIM-12 primer sets.

상기 키트는 DNA 중합 효소, dNTP 및 PCR 완충용액을 더 포함할 수 있다. 또한, PCR 반응 또는 증폭 산물의 확인에 필요한 구성 성분이 상기 키트에 추가로 포함될 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 함유할 수 있다. 상기 키트는 안내서를 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨, 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.
The kit may further comprise DNA polymerase, dNTP and PCR buffer solution. In addition, components necessary for PCR reaction or confirmation of an amplification product may be further included in the kit. The PCR buffer may contain KCl, Tris-HCl and MgCl 2. The kit may include a brochure. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

또한, 본 발명은 감귤로부터 유래된 게놈 DNA를 주형으로 하고 CIM-1 내지 CIM-12 프라이머 세트 중 하나 이상의 프라이머 세트를 프라이머로 사용하여 핵산을 증폭하는 단계; 및 얻어진 증폭 산물로부터 상기 감귤의 품종을 결정하는 단계를 포함하는, 감귤 품종을 식별하는 방법을 제공한다. Also, the present invention provides a method for amplifying nucleic acid, comprising: amplifying a nucleic acid using genomic DNA derived from citrus as a template and using at least one primer set of CIM-1 to CIM-12 primers as a primer; And determining the varieties of citrus from the resulting amplification products.

상기 게놈 DNA는 상기 감귤의 종자, 잎, 줄기, 과실, 또는 그의 조합으로부터 유래된 것일 수 있다. 상기 게놈 DNA는 식물체로부터 DNA를 채취하는 통상적인 방법을 이용하여 수득될 수 있다. 상기 게놈 DNA는 예를 들면, 페놀 추출 방법을 이용하여 수득될 수 있다.The genomic DNA may be derived from the citrus seed, leaf, stem, fruit, or a combination thereof. The genomic DNA can be obtained using a conventional method for obtaining DNA from a plant. The genomic DNA can be obtained, for example, using a phenol extraction method.

상기 방법에서, 핵산의 증폭은 PCR을 이용하여 수행될 수 있다. 상기 핵산의 증폭은 CIM-1 내지 CIM-12 프라이머 세트 중 2 이상, 3 이상, 4 이상, 5 이상, 6 이상, 7 이상, 8 이상, 9 이상, 10 이상, 또는 11 이상의 프라이머 세트를 사용하여 수행되는 것일 수 있다. 바람직하게는, 상기 핵산의 증폭은 CIM-1 내지 CIM-12 프라이머 세트를 모두 사용하여 수행되는 것일 수 있다. PCR 방법에 대해서는 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수 있다. PCR 반응은 당업계에 PCR 반응에 필요한 것으로 알려진 여러 성분을 포함하는 PCR 반응액을 이용하여 수행될 수 있다. 상기 PCR 반응액은 예를 들면, 분석하고자 하는 감귤로부터 유래된 게놈 DNA, 본 발명의 프라이머 세트, DNA 중합 효소(예를 들면, Taq polymerase), dNTP 혼합물, PCR 완충용액 및 물을 포함하는 것일 수 있다. In this method, amplification of the nucleic acid can be performed using PCR. The amplification of the nucleic acid may be performed using primer sets of 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 11 or more of CIM-1 to CIM- It can be done. Preferably, the amplification of the nucleic acid may be performed using all of the CIM-1 to CIM-12 primer sets. PCR methods are well known in the art, and commercially available kits can be used. The PCR reaction can be performed using a PCR reaction solution containing various components known to be required for PCR reaction in the art. The PCR reaction solution may include, for example, genomic DNA derived from citrus to be analyzed, a primer set of the present invention, a DNA polymerase (for example, Taq polymerase), a dNTP mixture, a PCR buffer solution and water have.

상기 방법은, 얻어진 증폭 산물을 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 검출하는 단계를 포함할 수 있다. 겔 전기영동을 통해 검출할 경우, 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 형광 측정을 통해 검출할 경우, 형광 물질로 표지된 본 발명의 프라이머 세트를 이용하여 PCR을 수행한 후 형광 측정기를 이용하여 형광을 측정할 수 있다. 방사성 측정을 통해 검출할 경우, 방사성 물질을 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)와 같은 방사성 측정기를 이용하여 방사성을 측정할 수 있다.The method may include detecting the resulting amplification product by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. When detected by gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the amplification product size. In the case of detection through fluorescence measurement, fluorescence can be measured using a fluorescence meter after carrying out PCR using the primer set of the present invention labeled with a fluorescent substance. When detecting by radioactivity, the radioactive material is added to the PCR reaction solution to label the amplified product, and radioactivity is measured using a radioactivity meter such as a Geiger counter or a liquid scintillation counter .

상기 방법에서, 얻어진 증폭 산물로부터 상기 감귤의 품종을 결정하는 단계는, 얻어진 증폭 산물을, CIM-1 내지 CIM-12 프라이머 세트 중 하나 이상의 프라이머 세트에 의해 공지된 감귤 품종의 핵산을 증폭한 결과와 비교함으로써 수행되는 것일 수 있다. In the above method, the step of determining the citrus variety from the obtained amplification product comprises amplifying the obtained amplification product by amplifying nucleic acid of citrus variety known by one or more primer sets of CIM-1 to CIM-12 primer sets and May be performed by comparison.

구체적으로, 상기 증폭된 산물로부터 감귤 품종을 결정하는 단계는 자동 염기서열 분석기를 이용하여 증폭 산물(밴드)의 크기를 컴퓨터 프로그램에 의해 확인함으로써 수행되는 것일 수 있다. 예를 들면, 공지된 감귤 품종에 대하여 본 발명의 프라이머 세트를 통해 증폭된 산물(각 대립유전자에 해당함)의 유무를 미리 하나의 표로 정리한다. 구체적으로, 대립유전자가 존재할 때에는 "1"로 나타내고 대립유전자가 존재하지 않을 때에는 "0"으로 나타낸다. 품종을 식별하고자 하는 감귤로부터 게놈 DNA를 분리한 후, 본 발명의 프라이머 세트를 이용하여 증폭하고 증폭된 산물의 크기를 분석한 다음, 이 분석 결과를 상기 공지된 감귤 품종의 핵산을 증폭한 결과와 통계 프로그램을 이용하여 비교함으로써 감귤의 품종을 결정할 수 있다.Specifically, the step of determining citrus cultivars from the amplified product may be performed by checking the size of the amplified product (band) using an automatic nucleotide sequencer by a computer program. For example, the presence or absence of the amplified product (corresponding to each allele) through the primer set of the present invention for known citrus cultivars is summarized in advance in one table. Specifically, "1" is indicated when an allele is present, and "0" is indicated when an allele is not present. Genomic DNA was isolated from a citrus fruit for which the variety was to be identified, amplified using the primer set of the present invention, analyzed for the size of the amplified product, and the result of amplification of the known citrus variety nucleic acid The varieties of citrus fruits can be determined by comparison using statistical programs.

본 발명에 따른 감귤 품종 식별용 프라이머 세트는 여러 감귤 품종에 대한 식별능이 우수하여, 감귤 품종의 진위성 규명, 농가와 회사 및 회사와 회사 간의 종자 분쟁의 중재 및 품종보호 출원품종의 대조품종 선정 등과 같은 여러 분야에 활용될 수 있다. The primer set for identification of citrus varieties according to the present invention has excellent discriminating ability for various citrus cultivars, and can be used for identification of authenticity of citrus cultivars, arbitration of seed disputes between farmers and companies and companies and selection of control varieties for varieties It can be used in various fields.

도 1a 내지 1f는 감귤 77개 품종을 대상으로 본 발명에 따른 감귤 품종식별용 프라이머 세트를 사용하여 확인된 대립유전자의 유무를 코드화한 결과를 나타낸다.
도 2a 및 2b는 본 발명에 따른 감귤 품종식별용 프라이머 세트에 의해 분석된 각 감귤 품종의 유전적 유사도를 나타낸다. FIGS. 1A to 1F show the results of coding the presence or absence of alleles identified using the citrus variety identifying primer set according to the present invention in 77 varieties of citrus fruits.
2A and 2B show the genetic similarity of each citrus cultivar analyzed by the citrus variety identifying primer set according to the present invention.

본 발명은 하기 실시예에 의하여 더욱 구체적으로 설명한다. 그러나, 하기 실시예는 본 발명의 이해를 돕기 위한 것일 뿐, 어떤 의미로든 본 발명의 범위가 이러한 실시예에 의하여 한정되는 것은 아니다.
The present invention will be described in more detail with reference to the following examples. However, the following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited by these examples in any sense.

실시예Example 1: 감귤 품종식별을 위한  1: For identification of citrus varieties 마커의Marker 평가 evaluation

(1) 감귤 시료(1) Citrus sample

본 발명에서는 하기 표 2에 기재된 감귤 77개 품종을 감귤 품종식별 가능성 검정을 위해 사용하였다. In the present invention, 77 varieties of citrus fruits described in the following Table 2 were used for citrus variety identification test.

번호number 품종명Breed name 학명Scientific name 분류Classification 1One RobinsonRobinson C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 22 SunburstSunburst C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 33 PixiePixie C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 44 KinnowKinnow C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 55 FairchildFairchild C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 66 CleopatraCleopatra C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 77 WilkingWilking C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 88 WillowleafWillowleaf C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 99 ClementineClementine C. clementinaC. clementina 감귤속(만다린)Citrus (Mandarin) 1010 NovaNova C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 1111 OsceolaOsceola C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 1212 King MandarinKing Mandarin C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 1313 EllendaleEllendale C. reticulata × C. sinensisC. reticulata C. sinensis 감귤속(만다린)Citrus (Mandarin) 1414 OROR C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 1515 FortuneFortune C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 1616 Changsha mandarinChangsha mandarin C. reticulataC. reticulata 감귤속(만다린)Citrus (Mandarin) 1717 BergamotBergamot C. bergamiaC. bergamia 감귤속(오렌지)Citrus (orange) 1818 AmbersweetAmbersweet C. sinensisC. sinensis 감귤속(오렌지)Citrus (orange) 1919 길전네블Gill Navel C. sinensis cv.YoshidanavelC. sinensis cv.Yoshidanavel 감귤속(오렌지)Citrus (orange) 2020 광도과연7호No. 7 light intensity C. unshiu cv. Hiroshimakaken7gouC. unshiu cv. Hiroshimakaken7gou 감귤속(온주밀감)Citrus (Citrus) 2121 상도조생Top C.unshiu cv.SangdojosaengC.unshiu cv.Sangdojosaeng 감귤속(온주밀감)Citrus (Citrus) 2222 DweetDweet C. reticulata × C. sinensisC. reticulata C. sinensis 감귤속(탄골)Tangerine (Tin) 2323 부지화Site C. hybrid cv.ShiranuhiC. hybrid cv.Shiranuhi 감귤속(탄골)Tangerine (Tin) 2424 청견Clearness C. hybrid cv.KiyomiC. hybrid cv. Kiyomi 감귤속(탄골)Tangerine (Tin) 2525 청봉Cheongbong C. hybrid cv.SeihouC. hybrid cv.Seihou 감귤속(탄골)Tangerine (Tin) 2626 진지향Jin-Hyeon C. hybrid cv.TsunokaoriC. hybrid cv.Tsunokaori 감귤속(탄골)Tangerine (Tin) 2727 세토카Setoka C. hybrid cv.SetokaC. hybrid cv. 감귤속(탄골)Tangerine (Tin) 2828 감평Impression C. hybrrid cv.KanpeiC. hybrrid cv. Kanpi 감귤속(탄골)Tangerine (Tin) 2929 사토노카오리Satono Kaori C. hybrid cv.SatonokaoriC. hybrid cv. 감귤속(탄골)Tangerine (Tin) 3030 세이난노히카리Seinano Hikari C. hybrid cv.SeinannohikariC. hybrid cv.Seinannohikari 감귤속(탄골)Tangerine (Tin) 3131 세토미Setomi C. hybrid cv.SetomiC. hybrid cv. 감귤속(탄골)Tangerine (Tin) 3232 에히메28호Ehime 28 C. hybrid cv.EhimeKashi28gouC. hybrid cv.EhimeKashi28gou 감귤속(탄골)Tangerine (Tin) 3333 유명famous C. hybrid cv.AriakeC. hybrid cv.Ariake 감귤속(탄골)Tangerine (Tin) 3434 진지휘Jin Gui C. hybrid cv.TsunokagayakiC. hybrid cv.Tsunokagayaki 감귤속(탄골)Tangerine (Tin) 3535 하레히메Harehime C. hybrid cv.HarehimeC. hybrid cv.Harehime 감귤속(탄골)Tangerine (Tin) 3636 DancyDancy C. reticulataC. reticulata 감귤속(탄제린)Tangerine (Tangerine) 3737 남향South C. hybrid cv. NankouC. hybrid cv. Nankou 감귤속(탄제린)Tangerine (Tangerine) 3838 무핵기주밀감Necrotic host citi C. kinokuniC. kinokuni 감귤속(탄제린)Tangerine (Tangerine) 3939 길전폰칸Gillen Vonkan C. reticulata cv.YosidaPonkanC. reticulata cv. Yosida ponkan 감귤속(탄제린)Tangerine (Tangerine) 4040 남진해South C. hybrid cv.NatsumiC. hybrid cv.Natsumi 감귤속(탄제린)Tangerine (Tangerine) 4141 천초Thousand C. hybrid cv.AmakusaC. hybrid cv.Amakusa 감귤속
(탄제린×탄젤로)Citrus
(Tangierin × Tangelo) 4242 PagePage (C. reticulata × C. paradisi)× C. reticulataC. reticulata C. paradisi C. C. reticulata 감귤속(탄젤로)In the citrus (Tangelo) 4343 LeeLee C. reticulataC. reticulata 감귤속(탄젤로)In the citrus (Tangelo) 4444 OrlandoOrlando C. reticulata × C. paradisiC. reticulata × C. paradisi 감귤속(탄젤로)In the citrus (Tangelo) 4545 MinneolaMinneola C. reticulata × C. paradisiC. reticulata × C. paradisi 감귤속(탄젤로)In the citrus (Tangelo) 4646 Sexton tangeloSexton tangelo C. reticulata × C. paradisiC. reticulata × C. paradisi 감귤속(탄젤로)In the citrus (Tangelo) 4747 Sampson tangeloSampson tangelo C. reticulata × C. paradisiC. reticulata × C. paradisi 감귤속(탄젤로)In the citrus (Tangelo) 4848 MurcottMurcott C. reticulataC. reticulata 감귤속(탄골)Tangerine (Tin) 4949 탐도1호Tamdo 1 C. hybrid cv.Tamdo1hoC. hybrid cv. Tamdo1ho 감귤속(탄골)Tangerine (Tin) 5050 Yuma PonderosaYuma Ponderosa C. maximaC. maxima 감귤속(레몬)Citrus (lemon) 5151 알렌레몬Allen Lemon C..limon cv Allen-NewmanEurekaC..limon cv Allen-NewmanEureka 감귤속(레몬)Citrus (lemon) 5252 만백유10,000 C. maximaC. maxima 감귤속(문단)In the citrus (paragraph) 5353 오로블랑코Oro Blanco C. maximaC. maxima 감귤속(문단)In the citrus (paragraph) 5454 다전금All charges C. junos cv.TadanishikiC. junos cv.Tadanishiki 감귤속(유자)Citrus fruits (citron) 5555 스타치Starch C. sudachiC. sudachi 감귤속(유자)Citrus fruits (citron) 5656 MacrophyllaMacrophylla C. celebicaC. celebica 감귤속(파페다)Citrus fruits (papeda) 5757 인창귤Inchang C. ichangensisC. ichangensis 감귤속(파페다)Citrus fruits (papeda) 5858 골든스페샬Golden Special C. paradisi cv. GoldenspecialC. paradisi cv. Goldenspecial 감귤속
(그레이프후르트)Citrus
(Grapefruit) 5959 불수감Numbness C. medica cv. SarcodactylisC. medica cv. Sarcodactylis 감귤속(씨트론)Citrus (citrone) 6060 감자potato C. benikojiC. benikoji 감귤속(제주재래)Citrus fruits (Jeju) 6161 당유자Yuzuji C. grandisC. grandis 감귤속(제주재래)Citrus fruits (Jeju) 6262 동정귤Sympathetic mandarin C. erythrosaC. erythrosa 감귤속(제주재래)Citrus fruits (Jeju) 6363 병귤Mushroom C. platymammaC. platymamma 감귤속(제주재래)Citrus fruits (Jeju) 6464 빈귤Tangerine C. leiocarpaC. leiocarpa 감귤속(제주재래)Citrus fruits (Jeju) 6565 사두감Sadou C. pseudogulgulC. pseudogulgul 감귤속(제주재래)Citrus fruits (Jeju) 6666 유자Citron C. junosC. junos 감귤속(제주재래)Citrus fruits (Jeju) 6767 지각tardy C. aurantiumC. aurantium 감귤속(제주재래)Citrus fruits (Jeju) 6868 진귤Jinju C. sunkiC. proclamation 감귤속(제주재래)Citrus fruits (Jeju) 6969 청귤Citrus C. nippokoreanaC. nippokoreana 감귤속(제주재래)Citrus fruits (Jeju) 7070 편귤Mandarin C. tangerinaC. tangerina 감귤속(제주재래)Citrus fruits (Jeju) 7171 홍귤Cranberry C. tachibanaC. tachibana 감귤속(제주재래)Citrus fruits (Jeju) 7272 영파금감A refugee Fortunella crassifoliaFortunella crassifolia 금감속(금감)Gold deceleration 7373 푸치마루Puchimaru F. sppF. spp 금감속(금감)Gold deceleration 7474 두금감Two fences F. hindsii(Champ.) SwingleF. hindsii (Champ.) Swingle 금감속(금감)Gold deceleration 7575 탱자Tangerine Poncirus trifoliataPoncirus trifoliata 탱자속(탱자)In the tiger (tangerine) 7676 비룡탱자Dragon P.trifoliata cv.FlyingDragonP.trifoliata cv.FlyingDragon 탱자속(탱자)In the tiger (tangerine) 7777 Swingle citrumeloSwingle citrumelo ×Citroncirus× Citroncirus Citroncirus속Citroncirus genus

(2) 감귤 게놈 DNA의 분리(2) Isolation of citrus genomic DNA

상기 표 2에 기재된 감귤 품종의 잎을 채취하여 2 ㎖ Eppendorf 튜브에 텅스텐 구슬 2개를 넣고 분쇄기(FRITSCH, Germany)에 돌려 종자를 고르게 마쇄하였다. 이어 NucleoSpin® PlantⅡ (Macherey-Nagel Cat. 740 770.250) 키트를 이용하여 게놈 DNA를 분리하였다. 세포 용해 버퍼(lysis buffer)는 PL2를 사용하였다. 추출된 게놈 DNA를 2% 아가로스 겔에서 전기영동하여 DNA의 농도를 확인하고, 정량한 후 PCR 분석을 위해 냉동고(-20℃)에서 보관하였다.
The leaves of the citrus cultivars described in Table 2 were collected, two tungsten beads were placed in a 2 ml Eppendorf tube, and the seeds were evenly ground by a grinder (FRITSCH, Germany). Genomic DNA was then isolated using a NucleoSpin ® Plant II (Macherey-Nagel Cat. 740 770.250) kit. Cell lysis buffer was PL2. The extracted genomic DNA was electrophoresed on 2% agarose gel to confirm the DNA concentration and quantified and stored in a freezer (-20 ° C) for PCR analysis.

(3) (3) 프라이머primer 세트의 제작  Production of sets

감귤 품종식별에 효율적인 분자표지를 선발하기 위하여, 상도조생, Robinson, Sunburst, Dweet, Page, Dancy 품종으로부터 분리된 DNA와 기 보고된 203개의 프라이머 세트를 이용하여 증폭한 다음, 다형성 정도가 높은 40개의 마커를 선발하였다. 이들 40개의 분자표지에 대하여, 형광 발생 물질 VIC, NED, FAM 및 PET 중 하나로 형광 표지된 올리고뉴클레오티드를 제작하여 정방향 프라이머로 이용하였다. 자동 염기서열 분석기 (Genetic Analyzer 3130XL, Applied Biosystem)를 통한 분석 결과, 재현성이 높고 밴드의 패턴이 깨끗하면서 다형성 정도가 높은 22개의 마커를 선발하였고, 이 22개 마커를 상기 77개의 감귤 품종에 확대 적용하여 품종식별능력이 높은 최종 12개의 마커를 선정하였다. 선정된 12쌍의 프라이머 세트를 상기 표 1에 나타내었다.
To isolate citrus varieties efficiently, DNA was isolated from top seeds, Robinson, Sunburst, Dweet, Page, and Dancy varieties, and amplified with 203 primer sets. Markers were selected. For these 40 molecular beacons, fluorescently labeled oligonucleotides were prepared with one of the fluorescent materials VIC, NED, FAM and PET and used as forward primers. The results of the analysis using an automatic nucleotide sequencer (Genetic Analyzer 3130XL, Applied Biosystem) revealed 22 markers with high reproducibility and high pattern polymorphism, and these 22 markers were extended to the 77 citrus varieties The final 12 markers with high breed identification ability were selected. Selected 12 pairs of primer sets are shown in Table 1 above.

(4) (4) PCRPCR 증폭 및 전기영동 Amplification and electrophoresis

상기 77개의 감귤 품종으로부터 분리된 게놈 DNA 및 12쌍의 프라이머 세트를 이용한 PCR 증폭 및 전기영동을 수행하였다. PCR amplification and electrophoresis were performed using genomic DNA isolated from 77 citrus cultivars and 12 pairs of primer sets.

PCR 반응액은 감귤 게놈 DNA 20 ng, 10 pmol의 정방향 및 역방향 프라이머 세트, 2.0 ㎕ dNTP 혼합물(2.5 mM), Taq DNA polymerase 1U(GeNet bio, Korea), 2.5 ㎕의 10X PCR 완충용액(50 mM KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl2)에 증류수를 첨가하여 제조하였고, 전체 부피를 25 ㎕로 조절하였다. PCR(Biometra, Germany) 증폭은 94℃에서 4분 동안 감귤 게놈 DNA를 충분히 변성시킨 다음, 94℃에서 변성 30초, 55℃에서 어닐링 30초, 72℃에서 신장 45초를 40회 반복 수행하고, 최종 신장을 위하여 72℃에서 신장 10분을 수행하였다. PCR 완료 후, 2% 아가로스 겔에서 전기영동하여 증폭 여부를 확인하였다. 증폭된 시료들은 다음 실험을 위해 4℃ 냉장고에서 보관하였다. 증폭된 시료를 멸균된 증류수 150 ㎕에 적정 농도로 희석한 다음, 희석된 1 내지 3 ㎕의 PCR 산물을 탈이온 포름아마이드(deionized formamide) 10 ㎕, 사이즈 마커 (LIZ500 size standard) 0.25 ㎕와 잘 혼합하여 섞고 94℃에서 2분간 변성시켰다. 변성시킨 증폭 산물을 자동 염기서열 분석기를 통해 전기영동하였다. GeneMapper 컴퓨터 프로그램 (Applied Biosystem)을 이용하여 각 분자표지별 대립유전자의 정확한 크기를 결정하였다.
The PCR reaction mixture contained 20 ng of citrus genomic DNA, 10 pmol of forward and reverse primer set, 2.0 μl dNTP mixture (2.5 mM), 1 U of Taq DNA polymerase (GeNet bio, Korea), 2.5 μl of 10X PCR buffer , 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl 2 ), and the total volume was adjusted to 25 μl. PCR (Biometra, Germany) amplification was performed by denaturation of the citrus genome DNA at 94 ° C. for 4 minutes, denaturation at 94 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds, and extension at 72 ° C. for 45 seconds, For final elongation, extension was carried out at 72 ° C for 10 minutes. After completion of the PCR, amplification was confirmed by electrophoresis on 2% agarose gel. The amplified samples were stored in a refrigerator at 4 ° C for the next experiment. The amplified sample was diluted to a suitable concentration in 150 μl of sterilized distilled water, and 1 to 3 μl of the diluted PCR product was mixed well with 10 μl of deionized formamide and 0.25 μl of a size marker (LIZ 500 size standard) And denatured at 94 ° C for 2 minutes. The denatured amplification product was electrophoresed through an automated sequencer. Using the GeneMapper computer program (Applied Biosystem), the exact size of each allelic marker was determined.

(5) 본 발명에 따른 (5) According to the present invention 마커의Marker 감귤 품종식별 가능성 검정 Citrus Variety Identification Test

본 발명에 따른 마커의 감귤 품종식별 가능성을 조사하였다. 하기 식 1을 사용하여 PIC(polymorphism information content)값을 산출하였다. 하기 식 1에서 K는 각 대립유전자의 총 밴드수이며 Pi는 마커의 밴드 중에서 i 번째 공통 밴드패턴의 빈도수를 나타낸다 (Anderson et al. 1993).The identification of the citrus variety of the marker according to the present invention was investigated. Polymorphism information content (PIC) values were calculated using the following equation (1). K is the total number of alleles of each allele, and P i is the frequency of the i-th common band pattern among the bands of the marker (Anderson et al. 1993).

<식 1><Formula 1>

Figure 112014019147573-pat00001
Figure 112014019147573-pat00001

마커별 어닐링 온도(℃), 증폭 산물의 크기(bp), 대립유전자의 수 및 PIC 값을 하기 표 3에 나타내었다.The annealing temperature (° C) by marker, the size (bp) of the amplified product, the number of alleles and the PIC value are shown in Table 3 below.

마커명Marker name 어닐링 온도(℃)Annealing temperature (캜) 증폭 산물의 크기(bp)Amplification product size (bp) 대립유전자의 수Number of alleles PIC 값PIC value CIM-1CIM-1 5555 142-203142-203 1515 0.8620.862 CIM-2CIM-2 5555 117-186117-186 1414 0.8410.841 CIM-3CIM-3 5555 118-164118-164 1414 0.7890.789 CIM-4CIM-4 5555 341-379341-379 1010 0.7440.744 CIM-5CIM-5 5555 259-329259-329 1111 0.7870.787 CIM-6CIM-6 5555 160-188160-188 1313 0.8270.827 CIM-7CIM-7 5555 235-274235-274 1212 0.7790.779 CIM-8CIM-8 5555 340-364340-364 1313 0.8340.834 CIM-9CIM-9 5555 201-229201-229 77 0.7810.781 CIM-10CIM-10 5555 193-213193-213 99 0.7660.766 CIM-11CIM-11 5555 118-137118-137 1010 0.7560.756 CIM-12CIM-12 5555 111-129111-129 88 0.7890.789 계system 136136 평균Average 11.311.3 0.7960.796

상기 표 3에 나타난 바와 같이, 본 발명에 따른 감귤 품종식별용 프라이머 세트는 서열번호 1과 2(마커명: CIM-1), 서열번호 3과 4(마커명: CIM-2), 서열번호 5과 6(마커명: CIM-3), 서열번호 7와 8(마커명: CIM-4), 서열번호 9과 10(마커명: CIM-5), 서열번호 11과 12(마커명: CIM-6), 서열번호 13과 14(마커명: CIM-7), 서열번호 15와 16(마커명: CIM-8), 서열번호 17과 18(마커명: CIM-9), 서열번호 19과 20(마커명: CIM-10), 서열번호 21과 22(마커명: CIM-11) 및 서열번호 23과 24(마커명: CIM-12)에서 각각 0.7 이상의 우수한 PIC 값을 나타내는 것을 확인할 수 있었다. 12개 마커의 평균 PIC값은 0.796으로, 본 발명의 마커를 통해 감귤 품종의 식별이 충분히 가능함을 확인하였다.1 and 2 (marker name: CIM-1), SEQ ID NOS: 3 and 4 (marker name: CIM-2), SEQ ID NO: 5 9 and 10 (Marker name: CIM-5), SEQ ID NOS: 11 and 12 (Marker name: CIM-3), SEQ ID NO: 7 and 8 (Marker name: CIM- SEQ ID NOS: 13 and 14 (Marker Name: CIM-7), SEQ ID NOS: 15 and 16 (Marker Name: CIM-8), SEQ ID NOS: 17 and 18 (Marker name: CIM-10), SEQ ID NO: 21 and 22 (marker name: CIM-11) and SEQ ID NO: 23 and 24 (marker name: CIM-12), respectively. The average PIC value of the 12 markers was 0.796, confirming that the identification of citrus cultivars was sufficiently possible through the marker of the present invention.

또한, 본 발명에 따른 마커에 대해 대립유전자(밴드) 유무를 판별하여 밴드가 존재할 경우에는 점수“1”로 코드화하고 밴드가 존재하지 않을 경우에는 “0”으로 코드화하였다. In addition, the presence or absence of alleles (bands) in the marker according to the present invention is judged. When there is a band, the score is coded as "1", and when there is no band, it is coded as "0".

도 1a 내지 1f는 감귤 77개 품종을 대상으로 본 발명에 따른 감귤 품종식별용 프라이머 세트를 사용하여 확인된 대립유전자의 유무를 코드화한 결과를 나타낸다. FIGS. 1A to 1F show the results of coding the presence or absence of alleles identified using the citrus variety identifying primer set according to the present invention in 77 varieties of citrus fruits.

품종을 식별하고자 하는 감귤로부터 게놈 DNA를 분리한 후, 본 발명의 프라이머 세트를 이용하여 증폭하고 증폭 산물과 도 1의 결과를 비교 분석함으로써 감귤 품종을 식별할 수 있다.Genomic DNA is isolated from a citrus fruit in which a variety is to be identified, amplified using the primer set of the present invention, and compared with the result of the amplification product and the result of FIG. 1, the citrus variety can be identified.

대립유전자의 유무를 NTSYS pc(version 2.10b)(Rohlf, 2000) 컴퓨터 프로그램에 입력하고 Jaccard's 방법(Sneath and Sokal, 1973)에 준하여 유전적 유사도 값을 계산하였다. 계산된 유전적 유사도를 이용하여 UPGMA(Unweighted Pair-group Method with Arithmetical Average)(Sneath and Sokal, 1973)에 의해 집괴 분석하여 계통도(dendrogram)를 작성하고 그 결과를 도 2에 나타내었다.Genetic similarity values were calculated according to Jaccard's method (Sneath and Sokal, 1973) by inputting the presence of an allele into a computer program of NTSYS pc (version 2.10b) (Rohlf, 2000). Using the calculated genetic similarity, an unweighted pair-group method with an arithmetical average (Sneath and Sokal, 1973) was used to analyze the cluster and a dendrogram was created. The results are shown in FIG.

도 2a 및 2b는 본 발명에 따른 감귤 품종식별용 프라이머 세트에 의해 분석된 각 감귤 품종의 유전적 유사도를 나타낸다. 이를 통해, 본 발명의 프라이머 세트를 이용하여 모든 품종의 구별이 가능함을 확인할 수 있었다.2A and 2B show the genetic similarity of each citrus cultivar analyzed by the citrus variety identifying primer set according to the present invention. Thus, it was confirmed that all the cultivars can be distinguished by using the primer set of the present invention.

<110> Korea seed and variety service <120> A method for identifying citrus varieties using microsatellites markers <130> PN104613 <160> 24 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-1_F <400> 1 gaaagggtta cttgaccagg c 21 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CIM-1_R <400> 2 attcccagct gcacaagc 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-2_F <400> 3 gctttcgatc cctccacata 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-2_R <400> 4 gatccctaca atccttggtc c 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-3_F <400> 5 aaagggaaag ccctaatctc a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-3_R <400> 6 cttcctcttg cggagtgttc 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-4_F <400> 7 acagaagagg agccattatt t 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CIM-4_R <400> 8 cagagagaac ccgaagaag 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-5_F <400> 9 aatccactct caaacaccag 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CIM-5_R <400> 10 aactgccaaa taactaccat tc 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CIM-6_F <400> 11 gcaaatacca atcaccttct ac 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-6_R <400> 12 gtttacctac cttcaccacc t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-7_F <400> 13 atcagcaaat aaagtggaca a 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-7_R <400> 14 taggatagaa gttgggagat g 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-8_F <400> 15 ttacccttgc cgtttccgtg 20 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CIM-8_R <400> 16 cgtgattctg attggttgct gg 22 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-9_F <400> 17 aatgcgtggg caataacttc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-9_R <400> 18 ttcaatatcg gcccaaactc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-10_F <400> 19 gcttcttgga atggagcaag 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-10_R <400> 20 cgtttttctg aggtcacggt 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-11_F <400> 21 gagttgggat tctgctgttg a 21 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-11_R <400> 22 gactgttgtt ctgatgccga 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-12_F <400> 23 gctatgttat gatacgtctg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-12_R <400> 24 agactcacgt aacctacttc 20 <110> Korea seed and variety service <120> A method for identifying citrus varieties using microsatellites          markers <130> PN104613 <160> 24 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-1_F <400> 1 gaaagggtta cttgaccagg c 21 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CIM-1_R <400> 2 attcccagct gcacaagc 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-2_F <400> 3 gctttcgatc cctccacata 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-2_R <400> 4 gatccctaca atccttggtc c 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-3_F <400> 5 aaagggaaag ccctaatctc a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-3_R <400> 6 cttcctcttg cggagtgttc 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-4_F <400> 7 acagaagagg agccattatt t 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CIM-4_R <400> 8 cagagagaac ccgaagaag 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-5_F <400> 9 aatccactct caaacaccag 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CIM-5_R <400> 10 aactgccaaa taactaccat tc 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CIM-6_F <400> 11 gcaaatacca atcaccttct ac 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-6_R <400> 12 gtttacctac cttcaccacc t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-7_F <400> 13 atcagcaaat aaagtggaca a 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-7_R <400> 14 taggatagaa gttgggagat g 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-8_F <400> 15 ttacccttgc cgtttccgtg 20 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CIM-8_R <400> 16 cgtgattctg attggttgct gg 22 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-9_F <400> 17 aatgcgtggg caataacttc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-9_R <400> 18 ttcaatatcg gcccaaactc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-10_F <400> 19 gcttcttgga atggagcaag 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-10_R <400> 20 cgtttttctg aggtcacggt 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CIM-11_F <400> 21 gagttgggat tctgctgttg a 21 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-11_R <400> 22 gactgttgtt ctgatgccga 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-12_F <400> 23 gctatgttat gatacgtctg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CIM-12_R <400> 24 agactcacgt aacctacttc 20

Claims (7)

서열번호 1 및 2의 올리고뉴클레오티드로 이루어지는 CIM-1 프라이머 세트;
서열번호 3 및 4의 올리고뉴클레오티드로 이루어지는 CIM-2 프라이머 세트;
서열번호 5 및 6의 올리고뉴클레오티드로 이루어지는 CIM-3 프라이머 세트;
서열번호 7 및 8의 올리고뉴클레오티드로 이루어지는 CIM-4 프라이머 세트;
서열번호 9 및 10의 올리고뉴클레오티드로 이루어지는 CIM-5 프라이머 세트;
서열번호 11 및 12의 올리고뉴클레오티드로 이루어지는 CIM-6 프라이머 세트;
서열번호 13 및 14의 올리고뉴클레오티드로 이루어지는 CIM-7 프라이머 세트;
서열번호 15 및 16의 올리고뉴클레오티드로 이루어지는 CIM-8 프라이머 세트;
서열번호 17 및 18의 올리고뉴클레오티드로 이루어지는 CIM-9 프라이머 세트;
서열번호 19 및 20의 올리고뉴클레오티드로 이루어지는 CIM-10 프라이머 세트;
서열번호 21 및 22의 올리고뉴클레오티드로 이루어지는 CIM-11 프라이머 세트; 및
서열번호 23 및 24의 올리고뉴클레오티드로 이루어지는 CIM-12 프라이머 세트를 포함하는, 감귤 품종식별용 프라이머 세트.A CIM-1 primer set consisting of the oligonucleotides of SEQ ID NOS: 1 and 2;
A CIM-2 primer set consisting of the oligonucleotides of SEQ ID NOS: 3 and 4;
A CIM-3 primer set consisting of the oligonucleotides of SEQ ID NOS: 5 and 6;
A CIM-4 primer set consisting of the oligonucleotides of SEQ ID NOS: 7 and 8;
A CIM-5 primer set consisting of the oligonucleotides of SEQ ID NOS: 9 and 10;
A CIM-6 primer set consisting of the oligonucleotides of SEQ ID NOS: 11 and 12;
A CIM-7 primer set consisting of the oligonucleotides of SEQ ID NOS: 13 and 14;
A CIM-8 primer set consisting of the oligonucleotides of SEQ ID NOS: 15 and 16;
A CIM-9 primer set consisting of the oligonucleotides of SEQ ID NOS: 17 and 18;
A CIM-10 primer set consisting of the oligonucleotides of SEQ ID NOS: 19 and 20;
A CIM-11 primer set consisting of the oligonucleotides of SEQ ID NOS: 21 and 22; And
A primer set for citrus variety identification comprising a CIM-12 primer set consisting of oligonucleotides of SEQ ID NOs: 23 and 24. 청구항 1에 있어서, 상기 감귤 품종은 감귤속(Citrus), 금자속(Fortunella), 탱자속(Poncirus), 또는 시트론시러스속(Citroncirus)에 속하는 것인, 감귤 품종식별용 프라이머 세트.The citrus variety identifying primer set according to claim 1, wherein the citrus variety belongs to Citrus , Fortunella , Poncirus , or Citroncirus . 청구항 1의 감귤 품종식별용 프라이머 세트를 포함하는, 감귤 품종식별용 키트.A citrus variety identification kit comprising the citrus variety identifying primer set of claim 1. 감귤로부터 유래된 게놈 DNA를 주형으로 하고 청구항 1의 감귤 품종식별용 프라이머 세트를 프라이머로 사용하여 핵산을 증폭하는 단계; 및
얻어진 증폭 산물로부터 상기 감귤의 품종을 결정하는 단계를 포함하는, 감귤 품종을 식별하는 방법.Amplifying the nucleic acid using a genomic DNA derived from citrus as a template and using a citrus variety identifying primer set of claim 1 as a primer; And
And determining the varieties of citrus from the resulting amplification products. 청구항 4에 있어서, 상기 게놈 DNA는 상기 감귤의 종자, 잎, 줄기, 과실, 또는 그의 조합으로부터 유래되는 것인, 감귤 품종을 식별하는 방법.5. The method according to claim 4, wherein the genomic DNA is derived from the citrus seed, leaf, stem, fruit, or a combination thereof. 청구항 4에 있어서, 얻어진 증폭 산물을 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 검출하는 단계를 포함하는 것인, 감귤 품종을 식별하는 방법.The method according to claim 4, comprising detecting the obtained amplification product by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. 청구항 4에 있어서, 얻어진 증폭 산물로부터 상기 감귤의 품종을 결정하는 단계는, 얻어진 증폭 산물을, 청구항 1의 감귤 품종식별용 프라이머 세트에 의해 공지된 감귤 품종의 핵산을 증폭한 결과와 비교함으로써 수행되는 것인, 감귤 품종을 식별하는 방법.[Claim 4] The method according to claim 4, wherein the step of determining the varieties of citrus fruits from the obtained amplification products is carried out by comparing the obtained amplification products with the results obtained by amplifying a citrus variety nucleic acid known by the citrus variety identifying primer set of claim 1 How to identify citrus varieties.
KR1020140022893A 2014-02-26 2014-02-26 A method for identifying citrus varieties using microsatellites markers KR101603156B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140022893A KR101603156B1 (en) 2014-02-26 2014-02-26 A method for identifying citrus varieties using microsatellites markers

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140022893A KR101603156B1 (en) 2014-02-26 2014-02-26 A method for identifying citrus varieties using microsatellites markers

Publications (2)

Publication Number Publication Date
KR20150101319A KR20150101319A (en) 2015-09-03
KR101603156B1 true KR101603156B1 (en) 2016-03-17

Family

ID=54242520

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140022893A KR101603156B1 (en) 2014-02-26 2014-02-26 A method for identifying citrus varieties using microsatellites markers

Country Status (1)

Country Link
KR (1) KR101603156B1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101877532B1 (en) * 2017-06-01 2018-07-12 대한민국(농촌진흥청장) Primers for detecting SNP markers specific to Haryejosaeng and uses thereof
KR101959732B1 (en) * 2017-11-09 2019-03-26 대한민국 Primers for detecting SSR markers specific to allotetraploid mandarin orange and uses thereof
KR102227030B1 (en) * 2020-03-17 2021-03-12 주식회사 바이오메딕 Microsatellite molecular markers for identifying Citrus varieties developed in Korea and uses thereof
KR102272593B1 (en) * 2020-06-17 2021-07-05 주식회사 바이오메딕 Primer set for discriminating red-fleshed Citrus fruit and uses thereof
KR102461777B1 (en) * 2020-12-17 2022-11-01 대한민국 Novel marker for selecting a citrus variety 'Asumi'and the use thereof
KR102461769B1 (en) * 2020-12-18 2022-11-01 대한민국 Novel marker for selecting a lemon variety and the use thereof
CN115927713B (en) * 2022-02-22 2023-09-19 江西省农业科学院园艺研究所 Primer group, kit and method for identifying honey pomelo cultivar

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100842432B1 (en) 2007-04-11 2008-07-01 대한민국 Ssr primer derived from mandarin and use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100842432B1 (en) 2007-04-11 2008-07-01 대한민국 Ssr primer derived from mandarin and use thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J. Amer. Soc.Hort. Sci. 2003, Vol. 128, No. 4, pp.584-590.
Journal of Horticulture and Forestry. 2009, Vol. 1, No. 7, pp.120-125.
World Journal of Agricultural Sciences 2013, Vol. 9, No. 4. pp.316-324.*

Also Published As

Publication number Publication date
KR20150101319A (en) 2015-09-03

Similar Documents

Publication Publication Date Title
KR101603156B1 (en) A method for identifying citrus varieties using microsatellites markers
Moreno et al. The use of RAPD markers for identification of cultivated grapevine (Vitis vinifera L.)
Zhang et al. A novel strategy for identification of 47 pomegranate (Punica granatum) cultivars using RAPD markers
KR101642702B1 (en) A method for identifying pear varieties using microsatellites markers
KR101555972B1 (en) A method for identifying pumpkin varieties using microsatellites markers
KR101605530B1 (en) A method for identifying strawberry varieties using microsatellites markers
Abdelkhalik et al. Morphological and sequence-related amplified polymorphism-based molecular diversity of local and exotic wheat genotypes
KR101423299B1 (en) A method for identifying melon varieties using microsatellites markers
KR101174409B1 (en) A Method for Identifying Cucumber Varieties using Microsatellites Markers
KR101748566B1 (en) A method for identifying chrysanthemum varieties using microsatellites markers
KR102082987B1 (en) Primer set for discriminating cultivars of onion and method for cultivars of onion using HRM analysis
Mu et al. Employment of a new strategy for identification of lemon (Citrus limon L.) cultivars using RAPD markers
KR102283638B1 (en) Random Amplified Polymorphic DNA primer for discrimination of tobacco cultivars
KR101959732B1 (en) Primers for detecting SSR markers specific to allotetraploid mandarin orange and uses thereof
KR101766274B1 (en) A method for identifying blueberry varieties using microsatellites markers
KR102335806B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba &#39;SanJo&#39; cultivar and uses thereof
KR101531303B1 (en) A method for identifying soybean varieties using microsatellites markers
KR101444178B1 (en) A method for identifying hot pepper varieties using microsatellites markers
KR101359542B1 (en) Microsatellite primer sets for discriminating cultivars of peach and uses thereof
KR101301863B1 (en) A method for identifying lettuce varieties using microsatellite primer set
KR101748567B1 (en) A method for identifying plum varieties using microsatellites markers
KR20120100095A (en) Microsatellite primer set for identifying onion varieties
KR101758610B1 (en) A method for identifying gerbera varieties using microsatellites markers
Sakhravi et al. Genetic relationships among common bean (Phaseolus vulgaris L) genotypes using ISSR markers
Atri et al. Agro-biochemical based characterization and molecular profiling of linseed (Linum usitattissimum L.) Cultivars

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant