KR101748567B1 - A method for identifying plum varieties using microsatellites markers - Google Patents

Abstract

The present invention relates to a method of identifying a plum cultivar using a supersatellite primer set. More particularly, the present invention relates to a method for identifying a plum cultivar using a super-satellite primer set for identification of plum varieties having polymorphism in 109 plums collected in Korea. By using the primer set according to the present invention as a supersatellite marker for identification of plums, it can greatly contribute to various fields such as identification of authenticity of plum varieties, arbitration of seed disputes, selection of control varieties for varieties protected varieties.

Description

Technical Field [0001] The present invention relates to a method for identifying plum varieties using microsatellite markers

The present invention relates to a method for identifying a plum cultivar using a supersatellite marker. More particularly, the present invention relates to a supersatellite primer set for identifying a primordial cultivar, a kit including the primer set, and a method for identifying a primordial cultivar using the primer set.

A DNA marker refers to a specific nucleotide sequence fragment that can be used to determine whether a polymorphism is present on the genome. DNA markers have been used in the field of crop breeding for the development of markers related to traits and marker assisted selection (MAS), gene mapping, quantitative trait locus analysis, purity testing, genetic diversity analysis and breed identification.

In general, methods for identifying plant cultivars are divided into two stages: morphological characterization through cultivation tests, assays based on differences between isoenzymes and DNA analysis methods. DNA analysis method is advantageous in that it is objective and reproducible because it is not influenced by cultivation environment and crop growth stage as compared with phenotype-based identification method. The UPOV is in the process of discussing the use of DNA markers to investigate the characteristics of new varieties and to grant protection to new varieties of plants. Suggesting the possibility of using molecular beacons for identification. Specifically, SSR (Simple Sequence Repeat) and SNP (Single Nucleotide Polymorphism) methods are proposed to take into consideration the degree of polymorphism among varieties, reproducibility of analysis, and chromosomal distribution.

In Korea, RDA has reported the technology for identification of varieties using SSR molecular markers and CAPS molecular markers for rice and beans in Korea. The National Seed Institute has used the SSR molecular label to database the crop DNA profile for pepper, cabbage, watermelon, tomato, peach, rose, onion, apple, lettuce, blueberry, melon, strawberry, The use of molecular markers as a means of mediating them and the use of genetic analysis results in selection of control varieties for varieties of protected varieties are trends.

In Spain, SSR analysis technology for grape and peach crops in Spain is used to identify the basic derived varieties and to manage the existing varieties by databaseing the DNA profiles of each varieties. In China, DNA profiles using SSR and SNP molecular markers are databaseed for about 4,000 corn varieties. The court also uses gene analysis results to judge cases of breed protection breaches. Japan has developed SSR molecular markers for peaches, pears, and apples, and varietal identification methods using CAPS molecular markers for plums and tea, and is using them to protect breeder rights. In Europe, a variety of varieties are collected for potatoes and tomatoes, and a DNA profile database is constructed and studied for its potential for cultivation.

Plums are cultivated as crossbreeding varieties of apricot and plum, new varieties cultivated by native species, plum cross breeding. As of August 2014, 12 varieties of plum cultivars have been filed for protection of new varieties in the National Seed Source, and 377 plots have been filed for domestic production and import sales. It is important to conduct breeding tests for the breeding of plums, and the importance of breeding and breeding identification methods using molecular beacons is increasing because of the time required for characterization and the influence of the cultivation environment on the breeding test.

Therefore, the present invention aims to establish a method and system for identification of a variety of plums using the molecular markers of plum cultivars collected in Korea.

The present invention provides a primer set for identifying a prime variety.

The present invention provides a kit for identifying a prune variety comprising the primer set.

The present invention provides a method for identifying a variety of plums using the primer set.

The present invention relates to a PLM-1 primer set comprising oligonucleotides of SEQ ID NOS: 1 and 2; A PLM-2 primer set consisting of the oligonucleotides of SEQ ID NOS: 3 and 4; A PLM-3 primer set consisting of the oligonucleotides of SEQ ID NOS: 5 and 6; A PLM-4 primer set consisting of the oligonucleotides of SEQ ID NOS: 7 and 8; A PLM-5 primer set consisting of oligonucleotides of SEQ ID NOS: 9 and 10; A PLM-6 primer set consisting of the oligonucleotides of SEQ ID NOS: 11 and 12; A PLM-7 primer set consisting of the oligonucleotides of SEQ ID NOS: 13 and 14; A PLM-8 primer set consisting of the oligonucleotides of SEQ ID NOS: 15 and 16; A PLM-9 primer set consisting of the oligonucleotides of SEQ ID NOS: 17 and 18; A PLM-10 primer set consisting of the oligonucleotides of SEQ ID NOS: 19 and 20; A PLM-11 primer set consisting of the oligonucleotides of SEQ ID NOS: 21 and 22; A PLM-12 primer set consisting of oligonucleotides of SEQ ID NOS: 23 and 24; A PLM-13 primer set consisting of the oligonucleotides of SEQ ID NOS: 25 and 26; A PLM-14 primer set consisting of the oligonucleotides of SEQ ID NOS: 27 and 28; A PLM-15 primer set consisting of oligonucleotides of SEQ ID NOS: 29 and 30; A PLM-16 primer set consisting of oligonucleotides of SEQ ID NOS: 31 and 32; A PLM-17 primer set consisting of the oligonucleotides of SEQ ID NOS: 33 and 34; A PLM-18 primer set consisting of the oligonucleotides of SEQ ID NOS: 35 and 36; A PLM-19 primer set consisting of oligonucleotides of SEQ ID NOS: 37 and 38; A PLM-20 primer set consisting of oligonucleotides of SEQ ID NOS: 39 and 40; And a PLM-21 primer set consisting of oligonucleotides of SEQ ID NOs: 41 and 42; (Hereinafter also referred to as " PLM-1 to PLM-21 primer set ").

The primer set may exhibit high polymorphism for the plum varieties distributed in Korea. Thus, the primer set can be used to identify the plum varieties. The primer set may be used, for example, to identify one or more of the plum varieties described in Table 2 below.

Wherein the primer set composition comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 of the PLM-1 to PLM-21 primer sets , At least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 and at least 20 primer sets. Preferably, the primer set composition may comprise all of the PLM-1 to PLM-21 primer sets. The primer sets of 21 pairs comprising the oligonucleotides of SEQ ID NOS: 1 to 42 of the present invention are shown in Table 1 below. As used herein, 'marker' may refer to an amplification product obtained through each primer set or each primer set itself.

SEQ ID NO: SSR Primer sequence Fluorescent label One PLM-1 Forward: CATGTGCCTCAATGCATCTT VIC 2 Reverse: CGGCCCACAAAATTGAACTA 3 PLM-2 Forward: CATGTGCCTCAATGCATCTT VIC 4 Reverse: CGGCCCACAAAATTGAACTA 5 PLM-3 Forward: ACGGGAGACTTTCCCAGAAG VIC 6 Reverse: CTTCTCGTTTCCTCCCTCCT 7 PLM-4 Forward: AGGACATGTGGTCCAACCTC FAM 8 Reverse: GGGTTCCCCGTTACTTTCAT 9 PLM-5 Forward: GCCACTTCGGCTAAAAGAGA VIC 10 Reverse direction: TCCATATCTCCTCCTGCTTGA 11 PLM-6 Forward: TGTCTGCCTCTCATCTTAACCA NED 12 Reverse direction: TTCTTGAGCAGCCCATCTTCT 13 PLM-7 Forward: TGGGTCGTCTTCTTTATCGTG PET 14 Reverse direction: CCTCACCAAAACGGTAGTCAG 15 PLM-8 Forward: GCATTGCAAGCATTTGAAGA VIC 16 Reverse: GATGCTATCCTTTCCGCATC 17 PLM-9 Forward: TCTCACACGCTTTCGTCAAC NED 18 Reverse: AAAAAGCCAAAAGGGGTTGT 19 PLM-10 Forward: CCCATGCTCCTGTGGTAAGT FAM 20 Reverse direction: TTTAGAATCCCAACCCCACA 21 PLM-11 Forward: ATGGGCTAGAAGTGGTGGTG PET 22 Reverse: ATTCCGACTCGAAACGAAGA 23 PLM-12 Forward: CAACAGCGAGTGTCACGTTT VIC 24 Reverse: AGGCAACGGACAAAAATCTG 25 PLM-13 Forward: CATCATCATCCTCACCCAAA FAM 26 Reverse direction: TGCTGATCCGTGAGATCTTG 27 PLM-14 Forward: AGGTGGACAATAGCCGTGAT VIC 28 Reverse direction: TTTCCAGACCCTGAGAAAGC 29 PLM-15 Forward: GCCGCAACTCGTAAGGAATA PET 30 Reverse direction: TCCACCGTTGATTACCCTTC 31 PLM-16 Forward: ACGATGCATGAAATCCATA VIC 32 Reverse: TCTAACCAATCCCCCACATC 33 PLM-17 Forward: TGGCTCAAAAGCTCGTAGTG NED 34 Reverse: CCAACCTTTCGTTTCGTCTC 35 PLM-18 Forward: AACTTTGTCTGCCTCTCATCTTA PET 36 Reverse direction: AGCAGCCCATTTCTTCTCTTG 37 PLM-19 Forward: AATTCCCAAAGGATGTGTATGAG NED 38 Reverse direction: CAGGTGAATGAGCCAAAGC 39 PLM-20 Forward: AGCTCGCAAACCCTGTAAAA FAM 40 Reverse: GCTGGTCTGAGTTCGAGGAC 41 PLM-21 Forward: TCTACAGAGGGCGTTGAACC FAM 42 Reverse direction: AAGGTTTCACCACAAGCCAC

The oligonucleotide constituting the primer set may include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, a peptide nucleic acid or an intercalating agent. The oligonucleotide may further comprise fluorescent, phosphorescent or radioactive labeling substance. The fluorescent labeling substance may be VIC, NED, FAM, PET, or a combination thereof. The labeling substance may be labeled at the 5 ' end of the oligonucleotide. In addition, the radioactive labeling substance can be incorporated into the amplification product through PCR reaction using a PCR reaction solution in which a radioisotope such as ³² P or ³⁵ S is added.

The present invention also provides a kit for identifying plum varieties, comprising a primer set composition for identifying plum varieties comprising PLM-1 to PLM-21 primer sets. Preferably, the kit may comprise all of the PLM-1 to PLM-21 primer sets.

The kit may further comprise DNA polymerase, dNTP and PCR buffer solution. In addition, components necessary for PCR reaction or confirmation of an amplification product may be further included in the kit. The PCR buffer may contain KCl, Tris-HCl and MgCl _2. The kit may include a brochure. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

The present invention also relates to a method for amplifying a nucleic acid, which comprises amplifying a nucleic acid using a genomic DNA derived from a plum as a template and a primer set composition for identifying a plum varietal comprising a PLM-1 to PLM-21 primer set as a primer; And determining the varieties of the plum from the resulting amplification products.

The genomic DNA may be derived from the leaf, stem, fruit, or a combination thereof of the plum. The genomic DNA can be obtained using a conventional method for obtaining DNA from a plant. The genomic DNA can be obtained, for example, using a phenol extraction method.

In this method, amplification of the nucleic acid can be performed using PCR. Preferably, amplification of the nucleic acid may be performed using all of the PLM-1 to PLM-21 primer sets. PCR methods are well known in the art, and commercially available kits can be used. The PCR reaction can be performed using a PCR reaction solution containing various components known to be required for PCR reaction in the art. The PCR reaction solution may include, for example, a genomic DNA derived from a plum to be analyzed, a primer set of the present invention, a DNA polymerase (for example, Taq polymerase), a dNTP mixture, a PCR buffer solution and water have.

The method may include detecting the resulting amplification product by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. When detected by gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the amplification product size. In the case of detection through fluorescence measurement, fluorescence can be measured using a fluorescence meter after carrying out PCR using the primer set of the present invention labeled with a fluorescent substance. When detecting by radioactivity, the radioactive material is added to the PCR reaction solution to label the amplified product, and radioactivity is measured using a radioactivity meter such as a Geiger counter or a liquid scintillation counter .

In the above method, the step of determining the cultivar of the plum from the obtained amplification product is characterized in that the obtained amplification product is transformed into a nucleic acid of the plum varieties known by the plum varietal identification primer set composition comprising the PLM-1 to PLM-21 primer sets And comparing the result with the result of amplification.

Specifically, the step of determining the plum varieties from the amplified products may be performed by confirming the size of the amplified product (band) using an automatic nucleotide sequencer by a computer program. For example, the presence or absence of the amplified product (corresponding to each allele) through the primer set of the present invention for known plum cultivars is summarized in advance in one table. Specifically, "1" is indicated when an allele is present, and "0" is indicated when an allele is not present. Genomic DNA was isolated from the plums to be identified for breed, amplified using the primer set of the present invention, analyzed for the size of the amplified product, and the result of this analysis was obtained by amplifying the nucleic acid of the known plum varieties You can determine the variety of plums by comparing them using a statistical program.

The primer set for identifying a primate variety according to the present invention has excellent discrimination ability for several primordial cultivars and can be used in various fields such as identification of authenticity of a primordial cultivar, examination of a seed for a primordial seed, selection of a control cultivar for a varietal protection application varieties, and the like.

Figures 1a to 1ab show the results of encoding the presence or absence of alleles identified using the primer set for identifying the primate varieties according to the present invention in 109 varieties of plums.
Figures 2a and 2b show the genetic similarity of each plum varieties analyzed by the primer set for identifying plum varieties according to the present invention.

The present invention will be described in more detail with reference to the following examples. However, the following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited by these examples in any sense.

Example  1: for identification of plum varieties Marker  evaluation

(1) plum samples

In the present invention, 109 plums of the plums described in Table 2 below were used for the identification test of the pluck variety.

Serial number Breed name Serial number Breed name Serial number Breed name One Dae-seok 38 Chou 75 Lee Seung Hyun 2 Seoul plum 39 Giant Dixon 76 Law redemption 3 Angel Heart 40 Cho Kelsey 77 Law abuse 4 Formosa 41 Elephant Ha 78 Baek, Yang 5 Early moonlight 42 Stocking deal 79 Mifu plum 6 Per pearl queen 43 Lobbyist 80 Uncooked plum 7 Prenatal period 44 Black Doris 81 Empress of Everything 8 Undwood 45 Plumphore 82 South Briquette 9 Jai 46 Goya 83 Gong Hong Ri 10 P Americana 47 Italian 84 Gil Folk 11 Ape 48 Matsu Rubi 85 Whitewash 12 Hongyuan Zhen 49 Jilin No. 6 86 Red Frio 13 Wang 50 Blue Purée 87 Rubio 14 Santa Rosa 51 President 88 Kelsey 15 Yellow 52 Repair 3 89 Stabi Prun 16 Rebirth of Dae Seok 53 Tragetti 90 Pipe stone 17 Guiyang 54 Beauty 91 Grand Free 18 Hollywood 55 Red Heart 92 Blue 19 Simca 56 Mammoth 93 Super rear 20 Salvation 57 Starkjai 94 St. Julian A 21 Like center 58 Hairstyle 95 Barira 22 Manchurian 59 Honey Heart 96 Mazorid 23 Exflor 60 Scarlet 97 P.insititia 24 Red plum 61 Jupiter 98 Tsudai 25 Paruru 62 Regeneration 99 SM-66 26 Msley 63 Honey Red 100 Kaga yam 27 Czech Republic 64 Rosa Grande 101 HonnyRosa 28 Sun 65 Plum plum 102 Mineral 29 Wheat 66 Black-and-white 103 Biocherry 30 Mariana8-1 67 Hong psychology 104 Jang Ri No. 17 31 Moniter 68 Taifuri 105 Jangrye No. 15 32 Gersh 69 Kimchi Hongri 106 Gold 33 Whitequeen 70 Minor 107 Color clues 34 Alderman 71 Joe Myeong 108 Hong Mi-in 35 Zia 72 Self-exfoliation 109 Repair 1 36 Fortune 73 Dyeing 37 Chill 74 Duck No. 3

(2) Plum genome DNA Separation of

The leaves of the plum cultivars described in Table 2 were collected, two tungsten beads were placed in a 2 ml Eppendorf tube, and the seeds were evenly ground by a grinder (FRITSCH, Germany). Then NucleoSpin ^? Genome DNA was isolated using a Plant II (Macherey-Nagel Cat. 740 770.250) kit. Cell lysis buffer was PL2. The extracted genomic DNA was electrophoresed on 2% agarose gel to confirm the DNA concentration and quantified and stored in a freezer (-20 ° C) for PCR analysis.

(3) primer  Production of sets

In order to select efficient molecular markers for identification of plum varieties, DNAs isolated from Daejangwon, Formosa, Zaebang, Guiyang, Santa Rosa, Purple Queen, Honey Red, After amplification using a primer set, 39 markers representing polymorphism in 8 cultivars were selected. For these 39 molecular markers, fluorescently labeled oligonucleotides were prepared with one of the fluorescent materials VIC, NED, FAM and PET and used as forward primers. As a result of analyzing with the automatic genome analyzer (Genetic Analyzer 3130XL, Applied Biosystem), 21 markers having high reproducibility, high band pattern and high polymorphism were selected for the 109 pruning varieties. Selected primer sets of 21 pairs are shown in Table 1 above.

(4) PCR  Amplification and electrophoresis

PCR amplification and electrophoresis were performed using genomic DNA isolated from 109 prune cultivars and 21 pairs of primer sets.

The PCR reaction mixture contained 20 ng of the primed genomic DNA, 10 pmol of forward and reverse primer set, 2.0 μl of dNTP mixture (2.5 mM), 1 μl of Taq DNA polymerase (GeNet bio, Korea), 2.5 μl of 10 × PCR buffer , 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl ₂ ), and the total volume was adjusted to 25 μl. PCR (Biometra, Germany) amplification was performed by repeating 40 cycles of denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and elongation at 72 ° C for 45 seconds, after denaturing the plum genomic DNA sufficiently at 94 ° C for 4 minutes , And elongation 10 minutes at 72 ° C for final elongation. After completion of the PCR, amplification was confirmed by electrophoresis on 2% agarose gel. The amplified samples were stored in a refrigerator at 4 ° C for the next experiment. The amplified sample was diluted to a suitable concentration in 150 μl of sterilized distilled water, and 1 to 3 μl of the diluted PCR product was mixed well with 10 μl of deionized formamide and 0.25 μl of a size marker (LIZ 500 size standard) And denatured at 94 ° C for 2 minutes. The denatured amplification product was electrophoresed through an automated sequencer. Using the GeneMapper computer program (Applied Biosystem), the exact size of each allelic marker was determined.

(5) According to the present invention Marker  Identification of plum varieties

The possibility of identifying the plum varieties of the markers according to the present invention was investigated. Polymorphism information content (PIC) values were calculated using the following equation (1). K is the total number of alleles of each allele, and P _i is the frequency of the i-th common band pattern among the bands of the marker (Anderson et al. 1993).

<Formula 1>

The annealing temperature (° C) by marker, the size (bp) of the amplified product, the number of alleles and the PIC value are shown in Table 3 below.

Serial number Marker name Annealing temperature (캜) Amplified
Gene size Number of alleles PIC value One PLM-1 55 147-165 6 0.696 2 PLM-2 55 120-129 6 0.724 3 PLM-3 55 140-182 26 0.913 4 PLM-4 55 120-180 16 0.875 5 PLM-5 55 120-179 27 0.838 6 PLM-6 55 153-204 20 0.851 7 PLM-7 55 147-183 19 0.876 8 PLM-8 55 168-225 35 0.926 9 PLM-9 55 166-210 19 0.905 10 PLM-10 55 108-189 28 0.901 11 PLM-11 55 139-188 23 0.814 12 PLM-12 55 139-218 26 0.910 13 PLM-13 55 171-227 21 0.854 14 PLM-14 55 160-224 22 0.876 15 PLM-15 55 93-129 21 0.875 16 PLM-16 55 113-305 15 0.839 17 PLM-17 55 131-186 18 0.875 18 PLM-18 55 157-208 16 0.804 19 PLM-19 55 116-172 22 0.854 20 PLM-20 55 212-264 5 0.642 21 PLM-21 55 87-111 3 0.601 Total 394 Mean 18.8 0.831

1 and 2 (marker name: PLM-1), SEQ ID NO: 3 and 4 (marker name: PLM-2), SEQ ID NO: 5 SEQ ID NOS: 7 and 8 (marker name: PLM-4), SEQ ID NOS: 9 and 10 (marker name: PLM-5), SEQ ID NOS: 11 and 12 (marker name: PLM- SEQ ID NOS: 13 and 14 (Marker Name: PLM-7), SEQ ID NOS: 15 and 16 (Marker Name: PLM-8), SEQ ID NOS: 17 and 18 SEQ ID NOS: 21 and 22 (marker name: PLM-11), SEQ ID NOS: 23 and 24 (marker name: PLM-12), SEQ ID NOS: 25 and 26 (marker name: PLM-13) , SEQ ID NOS: 27 and 28 (marker name: PLM-14), SEQ ID NOS: 29 and 30 (marker name: PLM-15) 37 and 38 (Marker name: PLM-19), SEQ ID NO: 39 and 40 (Marker name: PLM-20) and SEQ ID NOs: The average of the 21 markers of numbers 41 and 42 (marker name: PLM-21) The PIC value was 0.831, confirming that the identification of the plum varieties was sufficiently possible through the marker of the present invention.

In addition, the presence or absence of alleles (bands) in the marker according to the present invention is judged. When there is a band, the score is coded as "1", and when there is no band, it is coded as "0".

FIGS. 1A to 1BB show the results of encoding the presence or absence of alleles identified using the prime set for identification of the primate variety according to the present invention in 109 varieties of plums.

The genomic DNA is isolated from the plum which is to be discriminated from the cultivars, amplified using the primer set of the present invention, and the plum varieties can be identified by comparing the amplification products with the results of Figs. 1a to 1ab.

Genetic similarity values were calculated according to Jaccard's method (Sneath and Sokal, 1973) by inputting the presence of an allele into a computer program of NTSYS pc (version 2.10b) (Rohlf, 2000). Using the calculated genetic similarity, an aggregate analysis was performed by UPGMA (Unweighted Pair-group Method with Arithmetical Average) (Sneath and Sokal, 1973) to generate a dendrogram, and the results are shown in FIGS.

Figures 2a and 2b show the genetic similarity of each plum varieties analyzed by the primer set for identifying plum varieties according to the present invention. Thus, it was confirmed that all the cultivars can be distinguished by using the primer set of the present invention.

<110> Korea Seed and Variery Service <120> A method for identifying plum varieties using microsatellites          markers <130> PN106832 <160> 42 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CATGTGCCTCAATGCATCTT <400> 1 catgtgcctc aatgcatctt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-1 R <400> 2 cggcccacaa aattgaacta 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-2 F <400> 3 catgtgcctc aatgcatctt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-2 R <400> 4 cggcccacaa aattgaacta 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-3 F <400> 5 acgggagact ttcccagaag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-3 R <400> 6 cttctcgttt cctccctcct 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-4 F <400> 7 aggacatgtg gtccaacctc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-4 R <400> 8 gggttccccg ttactttcat 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-5 F <400> 9 gccacttcgg ctaaaagaga 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PLM-5 R <400> 10 tccatatctc ctcctgcttg a 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PLM-6 F <400> 11 tgtctgcctc tcatcttaac ca 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PLM-6 R <400> 12 ttcttgagca gcccatcttc t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PLM-7 F <400> 13 tgggtcgtct tctttatcgt g 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PLM-7 R <400> 14 cctcaccaaa acggtagtca g 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-8 F <400> 15 gcattgcaag catttgaaga 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-8 R <400> 16 gatgctatcc tttccgcatc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-9 F <400> 17 tctcacacgc tttcgtcaac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-9 R <400> 18 aaaaagccaa aaggggttgt 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-10 F <400> 19 cccatgctcc tgtggtaagt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-10 R <400> 20 tttagaatcc caaccccaca 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-11 F <400> 21 atgggctaga agtggtggtg 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-11 R <400> 22 attccgactc gaaacgaaga 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-12 F <400> 23 caacagcgag tgtcacgttt 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-12 R <400> 24 aggcaacgga caaaaatctg 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-13 F <400> 25 catcatcatc ctcacccaaa 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-13 R <400> 26 tgctgatccg tgagatcttg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-14 F <400> 27 aggtggacaa tagccgtgat 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-14 R <400> 28 tttccagacc ctgagaaagc 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-15 F <400> 29 gccgcaactc gtaaggaata 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-15 R <400> 30 tccaccgttg attacccttc 20 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PLM-16 F <400> 31 acgatgcatg aaatccata 19 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-16 R <400> 32 tctaaccaat cccccacatc 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-17 F <400> 33 tggctcaaaa gctcgtagtg 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-17 R <400> 34 ccaacctttc gtttcgtctc 20 <210> 35 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PLM-18 F <400> 35 aactttgtct gcctctcatc tta 23 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PLM-18 R <400> 36 agcagcccat ttcttctctt g 21 <210> 37 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PLM-19 F <400> 37 aattcccaaa ggatgtgtat gag 23 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PLM-19 R <400> 38 caggtgaatg agccaaagc 19 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-20 F <400> 39 agctcgcaaa ccctgtaaaa 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-20 R <400> 40 gctggtctga gttcgaggac 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-21 F <400> 41 tctacagagg gcgttgaacc 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLM-21 R <400> 42 aaggtttcac cacaagccac 20

Claims (7)

A PLM-1 primer set consisting of the oligonucleotides of SEQ ID NOS: 1 and 2;
A PLM-2 primer set consisting of the oligonucleotides of SEQ ID NOS: 3 and 4;
A PLM-3 primer set consisting of the oligonucleotides of SEQ ID NOS: 5 and 6;
A PLM-4 primer set consisting of the oligonucleotides of SEQ ID NOS: 7 and 8;
A PLM-5 primer set consisting of oligonucleotides of SEQ ID NOS: 9 and 10;
A PLM-6 primer set consisting of the oligonucleotides of SEQ ID NOS: 11 and 12;
A PLM-7 primer set consisting of the oligonucleotides of SEQ ID NOS: 13 and 14;
A PLM-8 primer set consisting of the oligonucleotides of SEQ ID NOS: 15 and 16;
A PLM-9 primer set consisting of the oligonucleotides of SEQ ID NOS: 17 and 18;
A PLM-10 primer set consisting of the oligonucleotides of SEQ ID NOS: 19 and 20;
A PLM-11 primer set consisting of the oligonucleotides of SEQ ID NOS: 21 and 22;
A PLM-12 primer set consisting of oligonucleotides of SEQ ID NOS: 23 and 24;
A PLM-13 primer set consisting of the oligonucleotides of SEQ ID NOS: 25 and 26;
A PLM-14 primer set consisting of the oligonucleotides of SEQ ID NOS: 27 and 28;
A PLM-15 primer set consisting of oligonucleotides of SEQ ID NOS: 29 and 30;
A PLM-16 primer set consisting of oligonucleotides of SEQ ID NOS: 31 and 32;
A PLM-17 primer set consisting of the oligonucleotides of SEQ ID NOS: 33 and 34;
A PLM-18 primer set consisting of the oligonucleotides of SEQ ID NOS: 35 and 36;
A PLM-19 primer set consisting of oligonucleotides of SEQ ID NOS: 37 and 38;
A PLM-20 primer set consisting of oligonucleotides of SEQ ID NOS: 39 and 40; And
A primer set identification primer set for identifying one or more of the plum varieties enumerated in the following table, comprising a set of PLM-21 primers consisting of the oligonucleotides of SEQ ID NOs: 41 and 42,

. delete A kit for identifying a plum varieties, comprising a primer set identification primitive of claim 1, which identifies one or more of the plum varieties listed in the following table:

. Amplifying the nucleic acid using the genomic DNA derived from the plum as a template and the primer set composition for discriminating the cultivar of claim 1 as a primer; And
A method for identifying a plum varieties comprising determining the plum varieties of the plum among the plum varieties listed in the following table from the resulting amplification products:

. 5. The method of claim 4, wherein the genomic DNA is derived from the plum blossom, stem, fruit, or a combination thereof. 5. The method of claim 4, comprising detecting the resulting amplification product by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. [Claim 4] The method according to claim 4, wherein the step of determining the plum varieties is carried out by comparing the obtained amplification product with the result of amplifying the nucleic acid of the plum varieties listed in the above table by the primer set composition for identifying plum varieties of claim 1 Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; plum variety.

Images