KR101423299B1 - A method for identifying melon varieties using microsatellites markers - Google Patents

Abstract

The present invention relates to a method for identifying melon varieties using a supersaturate marker for confirming the varieties of melon, which exhibits polymorphism in melon varieties distributed in Korea, and a kit including the supersatellite markers. Specifically, the present invention can identify melon varieties distributed in the domestic seed market by selecting combinations of supersatellite markers having high polymorphism for 58 varieties of melons which are distributed in the country outside the country. In addition, since there are markers showing heterozygosity for confirming the parents for the variety, they can be used for the purity test of F1 seeds.

Description

Description of the Related Art [0002] A method for identifying melon varieties using microsatellite markers

The present invention relates to a molecular marker showing a polymorphism in a melon breed cultivated in a domestic seed company, a supersatellite marker, a method for identifying a melon variety using the marker, a method for confirming the F1 seed purity, and a kit containing the marker.

The UPOV provides guidelines for the selection of genetic analysis methods, selection of DNA markers, DNA isolation methods, and database construction in order to obtain reliable analysis results between laboratories and researchers on the use of molecular markers . This guideline is based on the assumption that the use of molecular markers is not only highly reproducible between labs and researchers but also has a bellicarity and that the utilized molecular markers are evenly distributed on the chromosome and that the same results should be obtained even when using various analyzers . The best suited for this requirement is the SSR (Simple Sequence Repeat) analysis method which confirms the polymorphism between the analytical materials by utilizing the difference of repetitive nucleotide sequences present on the chromosome. In fact, in Europe, a database of profiles of 500 varieties of potatoes, roses, tomatoes, and other crops under the auspices of the European Variety Protection Office (CPVO) has been established and reported. In China and Japan, SSR analysis technology for rice, corn, raspberry, strawberry, and other crops has been used for databases such as breeder protection rights and protection of agricultural products. On the other hand, in Korea, the use of molecular markers capable of identifying varieties in crops such as pepper, tomato, Chinese cabbage, radish, watermelon, melon, melon and cucumber which are highly important in the seed market or are likely to cause disputes in the national seed source We have constructed or are in the process of constructing a DNA profile database for 100 ~ 500 varieties per crop. In fact, using the database of DNA profiles for each varieties, we can select the control varieties of varieties protected varieties and protect the varieties. In recent years, gene analysis technology has been actively used to confirm the characteristics of varieties that are registered as varieties. In addition, breed identification molecular markers are used as a means to mediate the occurrence of seed disputes related to breed authenticity between farmers, seed companies and seed companies.

As of 2010, the cultivated area of melon is 17,000 ha and its production amount is 42,000 kg. As of May 2012, there are 23 registered varieties of protected varieties and 375 varieties declared for production and sale in the domestic seed market. Since 2001, 30 SSR markers have been developed and used in the evaluation of genetic resource characteristics in 2001. (Danin-Poleg Y, Reis N, Tzuri G and N. Katzir 2001. Theoretical Applied Genetics. 102, 61-72). In Japan, 31 SSR markers were developed and explored for the possibility of applying them to nine foliage and crops including watermelon, amber, and cucumber (Chiba N, Keita Suwabe K, Nunome T, and Hirai M. 2003, Breeding Science 53, 21-27), and 144 SSR markers were developed in Brazil and used to characterize melon genetic resources (Ritschel PS, Lins TC, Tristan RL, Buso GSC, Buso JA and Ferreira ME 2004. BMC Plant Biology 4, 1471-2229). In Spain, a genome study of melon, zucchini, watermelon, and cucumber was carried out to generate a high-density genetic map for the child recombinant and F2 populations using SSR markers derived from the Expressed sequence-tag (EST) database and genomic libraries (Gonzalo MJ, Oliver M, Garcia-Mas J, Monfort A, Dolcet-Sanjuan R, Katzir N, Arus P. Monforte AJ 2005. Theoretical Applied Genetics 100, 802-811; Fernandez- Eduardo I, Blanca J, Esteras C, Pico B, Nuez F, Arus P, Garcia-Mas J, Monforte AJ 2008. Theoretical Applied Genetics 118, 139-150). As a result of this study, it can be concluded that the method of confirming the breed which can be confirmed by the SSR marker, which is a genetic analyzer corporation proposed by UPOV, is not yet established, and that the accurate DNA profile construction by breed using the automatic nucleotide sequence analyzer .

Thus, the present inventors selected supersatellite markers showing polymorphism in 58 varieties of melon cultivated in Korea, amplified melon genomic DNA using these supersatellite marker sets as primers, and confirmed the amplification products produced, Gene patterns and Polymorphic Information Content (PIC) values indicate that the supersampling markers are suitable for the identification of melon varieties, and at the same time, there is a heterozygous molecular marker that can identify the parents of all melon varieties Was confirmed, and it was judged that this marker set can be very usefully used for assaying the purity of melon seeds. These results can be applied to various aspects such as selection of control varieties at the time of application for breed protection, scientific verification of breed authenticity at seed occurrence, seed distribution control and quality control of F1 seed.

It is an object of the present invention to provide a supersatellite marker that exhibits high polymorphism for 58 varieties of melons distributed in Korea.

It is still another object of the present invention to provide a method for identifying a melon variety using the supersatellite marker.

It is another object of the present invention to provide a method for identifying melon varieties which makes it possible to predict the genetic similarity of melon cultivars cultivated in a seed company at the DNA level and directly utilize them for selection of a control cultivar when applying for breed protection.

It is another object of the present invention to apply the molecular biology technique to the authenticity testing of melon varieties to judge whether the melon varieties sold in the seed market are true or not at the laboratory level, And to provide a method for identifying melon varieties which can be very useful for solving seed conflicts related to breed authenticity occurring between seed companies, seedling companies, farmers or seed companies and seed companies.

Another object of the present invention is to provide a method for determining the crossing of parents with respect to the F1 breed because the two alleles representing the two alleles of the varieties among the molecular markers used for confirming the melon breeds represent the genotype of the parents crossed at the breeding time Level of knowledge.

In order to achieve the above object, the present invention provides a marker for identifying a melon variety, which comprises a primer set (SEQ ID NOS: 1 to 58) exhibiting polymorphism for melon varieties distributed at home and abroad.

Also, the present invention provides a method for amplifying a nucleic acid comprising the steps of amplifying a nucleic acid using genomic DNA derived from melon as a template and using at least one primer set of SEQ ID NO: 1 to SEQ ID NO: 58 as a primer; And determining the varieties of melons from the resulting amplification products.

Also, the present invention provides a method for amplifying a nucleic acid comprising the steps of amplifying a nucleic acid using genomic DNA derived from melon as a template and using at least one primer set of SEQ ID NO: 1 to SEQ ID NO: 58 as a primer; Selecting a primer set having the number of the hybridization-specific alleles in the obtained amplification products and having the number of the alleles; Amplifying the nucleic acid using a genomic DNA of a mutant (F1) strain of melon to be tested for purity as a template and using the obtained set of selected primers as a primer; And determining that the obtained amplification product has the size of the above-mentioned allele specific gene and that the number of the alleles is 2 and that the F1 breed of the melon is purebred, the purity of the Melon F1 breed is determined .

The present invention also provides a kit for identifying a melon variety comprising at least one primer set of SEQ ID NOS.

In addition, the present invention provides a kit for assaying the purity of melon-line hybrid (F1) cultivars comprising at least one primer set of SEQ ID NOS: 1 to 58.

Hereinafter, the present invention will be described in more detail.

The present invention provides a marker for identifying a melon variety, including a primer set (SEQ ID NOS: 1 to 58) exhibiting polymorphism for a melon variety distributed in domestic and overseas seed markets.

The marker is a supersatellite marker showing a high polymorphism in 58 varieties of melons distributed in Korea, and can be specifically confirmed as a melon variety distributed in Korea. The markers of the present invention are SSR markers exhibiting high polymorphism for 58 varieties of melons cultivated and sold in domestic seed companies. Specifically, the markers of the present invention exhibited high polymorphism for the 58 melons described in Table 2 below.

The marker of the present invention may include, for example, one or more markers selected from the group consisting of the nucleotide sequences shown in Table 1 (SEQ ID NOS: 1 to 56). And a marker comprising 10 or more contiguous nucleotides derived from one or more SEQ ID NOs selected from the group consisting of SEQ ID NOs: 1 to 58 listed in Table 1 below. The length of the continuous nucleotides may be 10 to 19, such as 10 to 18, 10 to 17, 10 to 16, 10 to 15, 10 to 14, 10 to 13, 10 to 12, or 10 to 11 nucleotides.

The marker used in the identification of the melon variety of the present invention order
number Super satellites
Marking factor The base sequence (5'-3 ') of the primer Fluorescent staining One ECM54
Forward: TCGTGATTTTGCGTCCAGTA VIC
2 Reverse direction: TGCAATCAGGAATGAACAACTC 3 ECM81
Forward: CAACCATTCCTCCCATTCAT FAM
4 Reverse: CACCACCTGTGACATTGTACG 5 ECM91
Forward: GTTGAACATGGAAGAGTCTGCT VIC
6 Reverse direction: AAAGAACCAGCCCTATCCAAA 7 ECM124
Forward: GCGTCCTAAAAAGGGATAAGG NED
8 Reverse: ATTTTCACAAAAGGGGGAGAG 9 ECM130
Forward: GATTGGGAAAAAGGGTATGGA PET
10 Reverse: CTGGCTCCTTCACATTGTTGT 11 ECM172
Forward: CCCCTTCTCCCATTTCTACC PET
12 Reverse direction: TGAGACGTGGCAGAGAAGAA 13 ECM197
Forward: TGTCTTCGCATCAATCCTACC VIC
14 Reverse direction: TTTTGAATCACACCCTTCTGC 15 ECM228
Forward: TCTGATCGGAAAACCCACTT PET
16 Reverse: GCCAAGAATTTTCCCAACAT 17 CMTCN6
Forward: GCATTGCTCGATCAGTTTTAC VIC
18 Reverse: ACTCCGTCAAGATCCCAAAA 19 CMGAN12
Forward: TTTTTGTCGTTATATGAGGG NED
20 Reverse: GTTGCATAATGCTAATTTGG 21 CMTCN18
Forward: ACCAATCCATCACTCTCACT FAM
22 Reverse: GAAAGAATGGGGGAAAAGAG 23 CMTCN50
Forward: TCTACTTCCATGAATCCATC PET
24 Reverse direction: TAGAATGGTTAGGAAACCCT 25 CMBR7
Forward: AAAATGAATGGGAGTGCGTG FAM
26 Reverse: GCCTTCCTTTTCACCATCAA 27 CMBR25
Forward: TGGGGTTGTCAATACAGCAA PET
28 Reverse direction: GGAGTGCGTGGAATGTACG 29 CMBR40
Forward: CGACAATCACGGGAGAGTTT VIC
30 Reverse direction: TTGTTGCATCAAACTAACACAATC 31 CMBR64
Forward: ATACAGCAGATCCACAGGGG NED
32 Reverse: ATGGGAGTGTGTGGGATGTA 33 CMBR79
Forward: AGTGCGTGGAATGTACGTGA PET
34 Reverse direction: TTGCCTTCCTTTTCACCATC 35 CMBR83
Forward: CGGACAAATCCCTCTCTGAA VIC
36 Reverse: GAACAAGCAGCCAAAGACG 37 CMBR95
Forward: TTGACCTTTTACGGTGGTCC NED
38 Reverse direction: CGGACAAATCCCTCTCTGAA 39 CMBR97
Forward: CGACAATCACGGGAGAGTTT FAM
40 Reverse: CATATTAGACCCATATTTGTTGCAT 41 CMBR98
Forward: ATACAGCAGATCCACAGGGG PET
42 Reverse direction: TGAATGGGAGTGTGTGGAAC 43 CMBR120
Forward: CTGGCCCCCTCCTAAACTAA NED
44 Reverse direction: CAAAAAGCATCAAAATGGTTG 45 CM38 Forward: TAGCATCTGATCGGAAAACC PET
46 Reverse: CAACTTCATCCGCCAAGAAT 47 CMSS12-4
Forward: GATGCGGTGAGAAAGAGTTGAGAGA NED
48 Reverse: AGAGGGAGAGAGTTTGTAAAAAAAT 49 ECM123
Forward: TCTAATGGCGGCTTCAACTTA PET
50 Reverse: CTCCTTAGTGCATGGCTTCAC 51 GCM521
Forward: TGGTTCAAATCCTCAGTGGT FAM
52 Reverse direction: CAAGGGATTCTTCCATTTCG 53 CM16
Forward: TGCCTGTTGTGATTGAGGAG PET
54 Reverse direction: TTCTTCTTACCTCCGCCAAA 55 CMBR109
Forward: TGGAATGTACCGTGATGGGT VIC
56 Reverse: ATACAGCAGATCCACAGGGG 57 CMBR78
Forward: AAAATGAATGGGAGTGCGTG NED
58 Reverse direction: TTGCCTTCCTGTTCACCATC

Also, the present invention provides a method for amplifying a nucleic acid comprising the steps of amplifying a nucleic acid using genomic DNA derived from melon as a template and using at least one primer set of SEQ ID NO: 1 to SEQ ID NO: 58 as a primer; And determining the varieties of melons from the resulting amplification products.

The method of the invention may comprise detecting the resulting amplification product. Detection of the obtained amplification product can be performed by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

The genomic DNA derived from melon in the method of identifying melon varieties of the present invention can be obtained by using a conventional method of collecting DNA from the entire plant of melon seed and melon. For example, genomic DNA derived from melon can be derived from melon seeds or leaves, stalks, flesh or roots of melons and can be harvested from the leaves of young melon plants, especially after sowing and seeding seeds.

In the melon variety identification method of the present invention, PCR (polymerase chain reaction) is preferably used for amplification of genomic DNA. Methods for performing general PCR are well known in the art. Specifically, the PCR reaction can be carried out using a PCR reaction solution containing various components known to be necessary for the PCR reaction in the art. For example, the PCR reaction solution may contain genomic DNA derived from melon to be analyzed, a marker of the present invention, an appropriate amount of DNA polymerase (for example, Taq polymerase), a dNTP mixture, a PCR buffer solution, . The PCR buffer may contain KCl, Tris-HCl and MgCl _2.

In the step of determining the melon variety from the amplified products obtained in the present invention, the size of the allele gene band can be determined by a computer program using an automatic nucleotide sequence analyzer, and then the respective varieties can be determined. Specifically, melon varieties can be determined by tabulating the presence or absence of amplification products by the marker of the present invention for each of the melon varieties and comparing and analyzing the obtained amplified products. For example, using the markers of the present invention, the sizes of the alleles from each melon variety are summarized in a table in advance, and the presence or absence of alleles is determined. When alleles are present, they are represented as "1" If not, it is indicated by "0". Therefore, it is possible to isolate genomic DNA from a melon to be breed, amplify it using the marker of the present invention, analyze the size of the amplified product, and determine the melon variety through a statistical program.

The present invention also provides a method for testing the purity of a Melon F1 variety. The method comprises amplifying a nucleic acid using a genomic DNA derived from melon as a template and a primer set of at least one of the melon varieties identified in SEQ ID NOS: 1 to 58 as a primer;

Selecting a primer set which shows a variety specific allele in the obtained amplification product and in which the number of alleles is two;

Amplifying the nucleic acid using a genomic DNA of a Melon F1 variety to be tested for purity as a template and a primer set selected as a primer; And

Determining that the obtained amplification product has the size of the above-mentioned allele-specific allele gene and the number of alleles is 2 and that the F1 breed of melon is pure.

The genomic DNA derived from melon in the present invention can be obtained by using a conventional method of collecting DNA from melon seeds and whole plant of melon. Using the resulting genomic DNA derived from melon as a template, the presence or absence of the amplification product is tabulated using a primer set of at least one of the melon varieties identified in SEQ ID NOS: 1 to 58 as a primer. For example, DNA was collected from 58 varieties of melons distributed in domestic market described in the following Table 2 and amplified using a melon variety confirmation primer set to determine the presence or absence of amplification products as shown in FIGS. . For example, according to FIG. 2 - FIG. 2d, there are two alleles for the ECM172 primer set, and 2 for the ECM197 primer set in the 'Super VIP' varieties (FIGS. 2a, 2b, 2c and 2d 31 varieties) There are two alleles. In the above table, a primer set, that is, a co-dominance primer set, having a specific allele for each melon variety and having the number of alleles, is selected. For example, for the 'Super VIP' variety (No. 31 in FIG. 2A), the marker ECM54 shows only one band representing alleles, and thus it can not discriminate between the parents. Therefore, the purity of the 'Super VIP' Can not be used as a marker. However, for the 'Super VIP' varieties, the markers ECM172 and ECM197 showed a specific allele size and the number of them was two. These markers can be used as markers to check the purity of 'Super VIP' varieties, as they can identify the parents of 'Super VIP' varieties.

Genomic DNA of melon F1 breed to be tested for purity is extracted. The method for extracting the genomic DNA is carried out in the same manner as the method for extracting the genomic DNA from the melon.

Nucleic acid is amplified using a genomic DNA of a melon F1 breed to be tested for purity as a template and a selected primer set obtained as a primer.

If the size of alleles in the obtained amplification product is specific to the variety and the number of the alleles is two, the F1 breed of the melon is verified to be a purebred normal cross between the parents. When the number of alleles is 1 in the obtained amplification product, it is judged that the F1 breed of melon is not crossed between the parents.

The present invention also provides a kit for identifying a melon variety comprising at least one primer set of SEQ ID NOS. The kit of the present invention comprises at least one of the primer sets of the present invention, a DNA polymerase and a PCR buffer solution. In addition, components necessary for conducting electrophoresis to confirm whether the PCR product is amplified can be further included in the kit of the present invention.

In addition, the present invention provides a kit for assaying the purity of melon-line hybrid (F1) cultivars comprising at least one primer set of SEQ ID NOS: 1 to 58. The kit of the present invention comprises at least one of the primer sets of the present invention, a DNA polymerase and a PCR buffer solution. In addition, components necessary for conducting electrophoresis to confirm whether the PCR product is amplified can be further included in the kit of the present invention.

Using only the markers for identifying melon varieties of the present invention, 58 major melon varieties sold in domestic and overseas seed markets can be identified. Therefore, it can be useful in various fields such as preliminary monitoring of infringement of breed protection through identification of genuineness of melon varieties, confirmation of infringement, selection of control varieties at the time of breed protection application, and confirmation of purity when producing F1 seeds.

FIG. 1 is a graph showing melon breed identification and genetic similarity according to the present invention by coding each melon variety analyzed by the marker according to the present invention and using a NTSYSPC computer program.
FIG. 2 shows the results of coding 58 bell pepper cultivars cultivated in Korea using the 29 primer sets of the present invention. The bands were coded according to the size (bp) of alleles. Quot; and " 0 " when no band exists.

Hereinafter, the present invention will be described in more detail by way of examples. However, the present invention is not limited by the following examples.

Example  1: For melon breed identification Marker  evaluation

(1) melon sample

In the present invention, 58 varieties of melon described in Table 2 were used for selection of a set of primers for confirming the variety of melons and for the test for the possibility of confirming the variety of melons.

58 varieties of melon for breed identification Serial number Breed name Upbringing company Serial number Breed name Upbringing company One Yellow papa First seedling farming 30 beauty Monsanto Korea 2 Platinum lump First seedling farming 31 Super VIP Monsanto Korea 3 Wonderful 1 First seedling farming 32 Yellow Dragon Samsung seedling 4 Wonderful 2 First seedling farming 33 SM-7 Samsung seedling 5 Wonderful 3 First seedling farming 34 Good Samsung seedling 6 Papa First seedling farming 35 Earls Party Syngenta seedling 7 papaya First seedling farming 36 Home run star Syngenta seedling 8 Golden chunks First seedling farming 37 Earls Elite Syngenta seedling 9 Earls Summer Star Daikon breeding Institute 38 Earls VIP NH seedlings 10 Papa. Daikon breeding Institute 39 Red Queen NH seedlings 11 White porcelain Daikon breeding Institute 40 flashlight High concentration seedling 12 Super white porcelain Daikon breeding Institute 41 Yellow queen High concentration seedling 13 Black pearl Daikon breeding Institute 42 Earls A specialty garden 14 Fresh spring and autumn Daikon breeding Institute 43 Happy Happy KOREGON 15 picnic Daikon breeding Institute 44 Daegil Asian seedlings 16 smile Daikon breeding Institute 45 Monet Red 907 Asian seedlings 17 Earls Phoenix Summer Daikon breeding Institute 46 Golden melon Asian seedlings 18 Marvel Daikon breeding Institute 47 Platinum melon Asian seedlings 19 Oldsummer boom Daikon breeding Institute 48 Haniyeon Sejong Bio 20 Earl Talent Nongwoo Bio 49 Earls Grand Prix Jeollanam-do 21 Earth Expo Nongwoo Bio 50 Ruby ball spring and spring system This 22 Yellow sun Nongwoo Bio 51 Beta Rich Eastern 23 Earls Luxury Nongwoo Bio 52 Earl Sveta Ricci Eastern 24 The Nongwoo Bio 53 MVP Nongwoo 25 Earls Delicious Seed Land 54 Atlantic Caps 26 Earl Loubie Seed Land 55 Earth-loving spring and autumn Korea 27 Earl King Seed Land 56 Aleksandro Changchun 28 Giant Monsanto Korea 57 Earlsbee Jeonnam 29 Emerald Summer 1 Monsanto Korea 58 Ersmeli Jeonnam

(2) Extraction of genomic DNA

The disclosed melon seeds listed in Table 2 were sown on a 50-well plug seedling plate, and after 3 weeks, the leaves of the fleshy portion were collected and used as a genomic DNA separation material. Three tungsten beads were placed in a 2 ml tube containing stored melon leaves, rapidly frozen in liquid nitrogen (-196 ° C), and vortexed repeatedly to homogenize the tissue. Genome DNA was isolated using a NucleoSpin ^® Plant II (Macherey-Nagel Cat. 740 770.250) kit. The extracted genomic DNA was electrophoresed on 1.0% agarose gel to confirm the DNA concentration. After quantification, the DNA was diluted to a concentration of 10 ng per μl and used for PCR analysis.

(3) Selection of SSR primer for breed identification

In order to select the most effective molecular markers for melon breeding, we have selected 'Yellow Papa', 'Earls Summer Star', 'Lively Spring &Summer','Beauty','SuperVIP','Good',' , 'Earl Talent', 'Giant', and 'MVP' were amplified using 412 primer sets ( http://vegmarks.nivot.affrc.go.jp/ ), and then capillary electrophoresis (HDA- GT12 ^TM System, e GEnE, Inc.) and computer program (Biocalculator 2.0) were used to analyze the difference of alleles of each sample. Then, 29 markers with high band pattern and high polymorphism were selected. In order to carry out the precise analysis with the automatic nucleotide sequencer for the molecular markers of these 29 markers, the forward primer produced fluorescently labeled oligonucleotides with one of the fluorescence generating materials FAM, VIC, NED and PET.

(4) PCR amplification and electrophoresis

PCR was performed using the prepared genomic DNA and the prepared marker as a material. The composition of the PCR reaction mixture was 20 ng of the prepared melon genome DNA, 0.1 μM of the marker, 2.0 μl of dNTP mixture (2.5 mM), 1 μl of Taq polymerase (Takara CAT.RR011A), 2.5 μl of 10 x PCR buffer KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl ₂ ) was added to distilled water to adjust the total volume to 25 μl. PCR (C1000, BioRad, USA) amplification was performed by denaturing the genomic DNA at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and elongation at 72 ° C for 45 seconds for 40 times Lt; / RTI > The PCR product was reacted at 72 ° C for 10 minutes for final elongation. The annealing temperatures for each primer set are shown in Table 3 below. After completion of the PCR, amplification was confirmed by electrophoresis on 2.8% agarose gel. The amplified samples were stored at -20 ° C for the next experiment. The PCR amplified samples were diluted to 150 μl of ultrapure water at an appropriate concentration, and then 3 μl of the diluted PCR product was diluted with 10 μl of deionized formamide, a size marker (size marker LIZ500 size standard) were mixed well and then denatured at 94 ° C for 2 minutes. The denatured gene amplification product was electrophoresed using an automatic sequencing apparatus (Genetic Analyzer 3130XL, Applied Biosystem). The allele size of each species was measured accurately using GeneMapper3.7 computer program (Applied Biosystem).

 (5) Confirmation possibility of the melon variety of the marker according to the present invention

The possibility of identifying the melon varieties of the marker according to the present invention was examined using the allele gene size determined by the automatic nucleotide sequence analyzer. Polymorphism information content (PIC) values were calculated using the following equation (1). In the following Equation 1, P _ij is the frequency of the _jth common band pattern among the bands of the marker _i (Anderson et al., 1993, Genome 36: 181-186).

<Formula 1>

As a result, annealing temperature (° C), amplification product size (bp), number of alleles and PIC value according to each marker are shown in Table 3 below.

Marker Features Serial number SSR marker name Annealing temperature (캜)  The size of the allele (bp) Number of alleles PIC value One ECM54 55 078-107 2 0.500 2 ECM81 55 123-138 2 0.498 3 ECM91 55 269-297 5 0.452 4 ECM124 55 266-274 3 0.748 5 ECM130 55 234-243 3 0.401 6 ECM172 55 107-115 3 0.613 7 ECM197 55 073-111 5 0.691 8 ECM228 55 103-115 4 0.439 9 CMTCN6 55 144-162 5 0.688 10 CMGAN12 55 164-206 9 0.828 11 CMTCN18 55 147-203 6 0.673 12 CMTCN50 55 114-136 8 0.724 13 CMBR7 55 092-113 7 0.840 14 CMBR25 55 149-173 8 0.844 15 CMBR40 55 153-161 3 0.481 16 CMBR64 55 137-163 8 0.844 17 CMBR79 55 084-106 7 0.840 18 CMBR83 55 127-150 4 0.586 19 CMBR95 55 103-125 5 0.607 20 CMBR97 55 170-178 3 0.481 21 CMBR98 55 143-167 8 0.841 22 CMBR120 55 159-172 3 0.522 23 CM38 55 118-130 4 0.439 24 CMSS12-4 55 451-473 5 0.622 25 ECM123 55 239-243 3 0.322 26 GCM521 55 146-161 2 0.453 27 CM16 55 196-209 3 0.317 28 CMBR109 55 127-152 7 0.846 29 CMBR78 55 094-115 7 0.843 sum 111 14.139 Average 4.897 0.643

As shown in Table 3, nine markers (ECM81, ECM91, ECM130, ECM228, CMBR97, CM38, ECM123, ECM521 and CM16) of the markers used in the present invention showed PIC values lower than 0.50, High PIC values ranging from 0.500 to 0.846 were obtained. Therefore, it can be seen that the marker of the present invention can make the melon variety sufficiently visible.

In addition, NTSYS pc (version 2.10b) (Rohlf, 2000, Numerical Taxonomy and Multivariate Analysis System-Version 2.10b. Applied Biostatistics Inc., New York.) Computer program according to the presence of breed bands according to the size of the allele And genetic similarity values were calculated according to Jaccard's method (Sneath and Sokal 1973, Numerical axonomy: The Principles and Practice of Numerical Classification, WH Freeman, San Francisco.). Using a genetic similarity measure, an unweighted pair-group method with an arithmetical average (Sneath and Sokal, 1973) was used to analyze the cluster and a dendrogram was created. The results are shown in FIG. 1, it can be seen that the primer set of the present invention enables identification of 58 melon varieties distributed in Korea.

Example  2: Melon variety confirmation

(1) Preparation of breed identification sheet using the marker of the present invention

Genomic DNA was extracted from each of the 58 melon cultivars cultivated in Korea according to the method (2) of Example 1 above. PCR was carried out according to the method (1) of (1) above using 29 markers of the present invention as a primer set. From the PCR result, the presence or absence of the band was determined for the marker according to the present invention. When the band was present, the marker was coded as a score of 1, and when there was no band, the result was encoded as 0, The breed identification sheet for Korea was prepared. The results are shown in Fig. As shown in FIG. 2, melon varieties showed different band sizes depending on the number of alleles according to the marker of the present invention. For example, in Table 2, the 'Super VIP' variety of melon varieties 31 has one allele of 107 bp when amplified with the molecular marker ECM54.

(2) Confirmation of melon variety

The seeds of melon were sown on a 50 - well plug seedling plate and after 3 weeks, leaves of the fleshy region were collected and used as a genomic DNA separation material. Three tungsten beads were placed in a 2 ml tube containing stored melon leaves, rapidly frozen in liquid nitrogen (-196 ° C), and vortexed repeatedly to homogenize the tissue. Genome DNA was isolated using a NucleoSpin ^® Plant II (Macherey-Nagel Cat. 740 770.250) kit. The extracted genomic DNA was electrophoresed on a 1.0% agarose gel to confirm the DNA concentration. After quantification, the DNA was diluted to a concentration of 10 ng per μl.

Each of the 29 markers of the present invention was amplified by PCR using the primer set and the extracted genomic DNA was subjected to electrophoresis. PCR amplification and electrophoresis were carried out in the same manner as described in Example 1 above. The presence or absence of bands in each electrophoresis result was compared with the results in Fig. The melon which wanted to identify the breed was identified as 'Super VIP' because it showed the same band type as 'Super VIP' varieties.

Example  3: For melon F1 seed purity black Marker  Selection

A breed check sheet was prepared according to (1) of Example 2 above for 58 varieties of melon (see Figs. 2A and 2B). The seeds of the 'Super VIP' cultivars among the 58 varieties of melon were ground and DNA was isolated in the same manner as in Example 2 (2). The isolated DNA was amplified using the 29 primers shown in Table 3, and the size and number of alleles were observed. The results are shown in Fig. 2, since the marker ECM54, ECM81, ECM91, ECM124, ECM130, ECM228, CMGAN12, CMTCN18, CMBR120, CM38, CMSS12-4, ECM123, GCM521 show only one allele, It can not be used for testing. However, the two parental alleles of the F1 breed were distinctly differentiated by the markers ECM172, ECM197, CMTCN6, CMTCN50, CMBR7, CMBR25, CMBR40, CMBR64, CMBR79, CMBR83, CMBR95, CMBR97, CMBR98, CM16, CMBR109 and CMBR78 . Therefore, these markers can identify the parents of the melon 'Super VIP' varieties, and can be used as a marker to determine that the F1 breed has been produced by normal mating of the parents.

Example  4: Melon F1 seed purity black

The seeds of the 'auspicious' variety to be tested for purity were isolated according to the procedure described in Example 2 (2) above. The isolated DNA was amplified using the markers ECM172, ECM197, CMTCN, CMTCN50, CMBR7, CMBR25, CMBR40, CMBR64, CMBR79, CMBR83, CMBR95, CMBR97, CMBR98, CM16, CMBR109 and CMBR78 as primers. The amplification conditions were the same as described in (4) of Example 1 above. As a result, there were two allele-specific genes in the breed. Therefore, the seeds of the 'Super VIP' F1 varieties tested could be verified to be purebreds produced from the normal mating of the parents.

<110> Korea Seed & Variety Service <120> A method for identifying melon varieties using microsatellites          markers <130> PN098250 <160> 58 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM54 <400> 1 tcgtgatttt gcgtccagta 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM54 <400> 2 tgcaatcagg aatgaacaac tc 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM81 <400> 3 caaccattcc tcccattcat 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM81 <400> 4 caccacctgt gacattgtac g 21 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM91 <400> 5 gttgaacatg gaagagtctg ct 22 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM91 <400> 6 aaagaaccag ccctatccaa a 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM124 <400> 7 gcgtcctaaa aagggataag g 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM124 <400> 8 attttcacaa aagggggaga g 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM130 <400> 9 gattgggaaa aagggtatgg a 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM130 <400> 10 ctggctcctt cacattgttg t 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM172 <400> 11 ccccttctcc catttctacc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM172 <400> 12 tgagacgtgg cagagaagaa 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM 197 <400> 13 tgtcttcgca tcaatcctac c 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM 197 <400> 14 ttttgaatca cacccttctg c 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM228 <400> 15 tctgatcgga aaacccactt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM228 <400> 16 gccaagaatt ttcccaacat 20 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMTCN6 <400> 17 gcattgctcg atcagtttta c 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMTCN6 <400> 18 actccgtcaa gatcccaaaa 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMGAN12 <400> 19 tttttgtcgt tatatgaggg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMGAN12 <400> 20 gttgcataat gctaatttgg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMTCN18 <400> 21 accaatccat cactctcact 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMTCN18 <400> 22 gaaagaatgg gggaaaagag 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMTCN50 <400> 23 tctacttcca tgaatccatc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMTCN50 <400> 24 tagaatggtt aggaaaccct 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR7 <400> 25 aaaatgaatg ggagtgcgtg 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR7 <400> 26 gccttccttt tcaccatcaa 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR25 <400> 27 tggggttgtc aatacagcaa 20 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR25 <400> 28 ggagtgcgtg gaatgtacg 19 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR40 <400> 29 cgacaatcac gggagagttt 20 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR40 <400> 30 ttgttgcatc aaactaacac aatc 24 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR64 <400> 31 atacagcaga tccacagggg 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR64 <400> 32 atgggagtgt gtgggatgta 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR79 <400> 33 agtgcgtgga atgtacgtga 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR79 <400> 34 ttgccttcct tttcaccatc 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR83 <400> 35 cggacaaatc cctctctgaa 20 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR83 <400> 36 gaacaagcag ccaaagacg 19 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR95 <400> 37 ttgacctttt acggtggtcc 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR95 <400> 38 cggacaaatc cctctctgaa 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR97 <400> 39 cgacaatcac gggagagttt 20 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR97 <400> 40 catattagac ccatatttgt tgcat 25 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR98 <400> 41 atacagcaga tccacagggg 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR98 <400> 42 tgaatgggag tgtgtggaac 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR120 <400> 43 ctggccccct cctaaactaa 20 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR120 <400> 44 caaaaagcat caaaatggtt g 21 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CM38 <400> 45 tagcatctga tcggaaaacc 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CM38 <400> 46 caacttcatc cgccaagaat 20 <210> 47 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMSS12-4 <400> 47 gatgcggtga gaaagagttg agaga 25 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMSS12-4 <400> 48 agagggagag agtttgtaaa aaaat 25 <210> 49 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify ECM123 <400> 49 tctaatggcg gcttcaactt a 21 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify ECM123 <400> 50 ctccttagtg catggcttca c 21 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify GCM521 <400> 51 tggttcaaat cctcagtggt 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify GCM521 <400> 52 caagggattc ttccatttcg 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CM16 <400> 53 tgcctgttgt gattgaggag 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CM16 <400> 54 ttcttcttac ctccgccaaa 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR109 <400> 55 tggaatgtac cgtgatgggt 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR109 <400> 56 atacagcaga tccacagggg 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer to amplify CMBR78 <400> 57 aaaatgaatg ggagtgcgtg 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer to amplify CMBR78 <400> 58 ttgccttcct gttcaccatc 20

Claims (8)

An ECM54 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 1 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 2;
An ECM81 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 3 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 4;
An ECM91 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 5 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 6;
An ECM124 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 7 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 8;
An ECM130 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 9 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 10;
An ECM172 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 11 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 12;
An ECM197 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 13 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 14;
An ECM228 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 15 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 16;
A CMTCN6 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 17 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 18;
A CMGAN12 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 19 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 20;
A CMTCN18 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 21 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 22;
A CMTCN50 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 23 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 24;
A CMBR7 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 25 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 26;
A CMBR25 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 27 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 28;
A CMBR40 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 29 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 30;
A CMBR64 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 31 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 32;
A CMBR79 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 33 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 34;
A CMBR83 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 35 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 36;
A CMBR95 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 37 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 38;
A CMBR97 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 39 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 40;
A CMBR98 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 41 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 42;
A CMBR120 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 43 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 44;
A CM38 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 45 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 46;
A CMSS12-4 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 47 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 48;
An ECM123 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 49 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 50;
A GCM521 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 51 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 52;
A CM16 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 53 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 54;
A CMBR109 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 55 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 56; And
At least one primer set selected from the group consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 57 and a set of CMBR78 primers consisting of oligonucleotides comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 58 Wherein the set of primers for identifying melon varieties is a set of primers. Amplifying a nucleic acid using a genomic DNA derived from melon as a template and using a primer set for confirming the melon variety as set forth in claim 1 as a primer; And
And determining the varieties of melons from the resulting amplification products. 3. The method according to claim 2, comprising detecting the resulting amplification product by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. The method according to claim 2, wherein the genomic DNA is derived from at least one selected from the group consisting of seeds of melon, leaves of melon, stem, and fruit. [Claim 2] The method according to claim 2, wherein the step of determining the melon variety from the obtained amplification products comprises: comparing the amplification product with the obtained amplification product by tabulating the presence or absence of the amplification product by the melon variety confirmation primer set of claim 1 for each melon variety; To identify the melon varieties by identifying the melon varieties. Amplifying the nucleic acid using genomic DNA derived from melon as a template and using at least one of the primers set forth in SEQ ID NOS: 1 to 58 as a primer for identifying melon varieties;
Selecting a primer set which shows a variety specific allele in the obtained amplification product and in which the number of alleles is two;
Amplifying the nucleic acid using a genomic DNA of an F1 breed of melon to be tested for purity as a template and using the obtained selected primer set as a primer; And
Determining the purity of the melon-line hybrid (F1) cultivar, comprising determining that the obtained amplification product has the size of the above-mentioned allele-specific allele gene and that the number of alleles is 2 and that the F1 melon varieties are pure Way. A kit for identifying a melon variety, comprising a primer set for confirming the melon variety of claim 1, a DNA polymerase, and a PCR buffer. A kit for assaying purity of melon-line hybrid (F1) cultivars, comprising a primer set for confirming the melon variety of claim 1, a DNA polymerase and a PCR buffer solution.

Images