KR101479673B1 - A method for identifying rice varieties using microsatellites markers - Google Patents

Abstract

The present invention relates to a marker for identifying rice varieties exhibiting polymorphism in rice varieties distributed in Korea, a rice cultivar identification method, and a kit including the marker. Specifically, the present invention can identify a variety of rice cultivars cultivated in Korea by selecting a combination of supersatellite markers having high polymorphism for 300 rice varieties distributed in Korea. The molecular markers for identifying rice varieties used in the method of the present invention can identify 300 varieties of rice grown in the country. Accordingly, the present invention can be very usefully used in various fields such as identification of genuineness of rice varieties, determination of hybridization in propagation and production of seeds, selection of control varieties at breeder protection application, and confirmation of infringement.

Description

[0001] The present invention relates to a method for identifying rice varieties using microsatellite markers,

The present invention relates to a molecular marker showing a polymorphism in rice cultivars cultivated in a domestic seed company, a supersatellite marker, a method of identifying rice varieties using the marker, and a kit containing the marker.

The UPOV provides guidelines for the selection of genetic analysis methods, selection of DNA markers, DNA isolation methods, and database construction in order to obtain reliable analysis results between laboratories and researchers on the use of molecular markers . This guideline is based on the assumption that the use of molecular markers is not only highly reproducible between labs and researchers but also has a bellicarity and that the utilized molecular markers are evenly distributed on the chromosome and that the same results should be obtained even when using various analyzers . Most suitable for this requirement is SSR (Simple Sequence Repeat) analysis method which confirms the polymorphism between the analytical materials by utilizing the difference of repetitive nucleotide sequences present on the chromosome. In fact, in Europe, a database of profiles of 500 varieties of potatoes, roses, tomatoes, and other crops under the auspices of the European Variety Protection Office (CPVO) has been established and reported. In China and Japan, SSR analysis technology for rice, corn, raspberry, strawberry, and other crops has been used for databases such as breeder protection rights and protection of agricultural products. On the other hand, in Korea, the use of molecular markers capable of identifying varieties of crops such as radish, Chinese cabbage, watermelon, melon, cucumber, rice and the like, which are highly important in the seed market or are likely to cause conflict in the seed market, We have constructed or are in the process of constructing a database of DNA profiles for 100 ~ 500 varieties per plant. In fact, we use the DNA profile database for each varieties to select the control varieties for varietal protection varieties and to verify the discriminability, uniformity and stability of varietal protection cultivation In recent years, gene analysis technology has been actively used to confirm the characteristics of varieties that are registered as varieties. In addition, breed identification molecular markers are being actively used as a means to mediate the occurrence of seed disputes related to breed authenticity between farmers, seed companies and seed companies.

The cultivation area of rice in Korea is 849,172ha as of 2012, and the production amount is 373,000 tons, which is gradually decreasing compared to the past. However, due to the growing interest of the public health in recent years, the special importance of processing specialties is expected to grow in importance in the future. 346 varieties of domestic rice varieties have been registered and distributed in Korea.

In 1998, a high-density genetic map consisting of 2,275 RFLP markers was generated for the F2 group, in which the Japonica breed Nipponbare and the Indica breed Kasalath were crossed (Harushima et al., 1998), 2005 In the year, the sequence information of rice was completely deciphered by the International Rice Genome Sequencing Project consisting of 10 countries including Korea and Japan. In addition, identification of 51 varieties of Japonica paddy (Ji, HS et al., 1998 Korean J. Breed. 30, 350-360) was reported using six supersatellite markers and RAPD, SSR, STS (Jeong OY et al., 1998, J. Breed. 30, 136-137). In this study, the identification of 40 different rice varieties using different markers and the advantages and disadvantages of each method were compared. In recent years, SNP markers suitable for identification of rice varieties have been developed to establish identification systems for 30 domestic and overseas rice varieties (No. 2007-0100535). However, since these SNP markers are dominant markers, And limited varieties were used for genetic analysis.

Accordingly, the present inventors selected a supersaturate marker exhibiting polymorphism for 300 rice cultivars cultivated at home and abroad, amplified the rice genomic DNA using a primer, and confirmed the produced amplification product, Polymorphic Information Content) value, the supersatur- ity marker is suitable for identification of rice varieties. Therefore, it can be practically used for scientific verification of hybridization of species and species, and selection of control varieties for breed protection application. Thereby completing the invention.

It is an object of the present invention to provide a supersatellite marker having high polymorphism for 300 rice varieties distributed in Korea, Japan and China.

It is still another object of the present invention to provide a method of identifying rice varieties using the supersaturate marker.

It is another object of the present invention to provide a method of identifying rice varieties which makes it possible to predict the genetic similarity of rice cultivars cultivated at home and abroad at the level of DNA, thereby making it possible to directly utilize it for selection of a control cultivar when applying for breed protection.

In order to achieve the above object, the present invention provides a method for producing rice varieties, which comprises a set of at least one primer set of 26 pairs of oligonucleotides comprising oligonucleotides of SEQ ID NOS: 1 to 52, Lt; RTI ID = 0.0 > a < / RTI >

The present invention also relates to a method for amplifying a nucleic acid using genomic DNA derived from rice as a template and using at least one primer set among 26 pairs of primer sets comprising an oligonucleotide of SEQ ID NOS: 1 to 52 as a primer; And determining a rice variety from the amplification product.

The invention also provides a kit for identifying a rice variety, comprising at least one primer set of 26 pairs of primer sets comprising oligonucleotides of SEQ ID NOS: 1-52.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a primer set for identifying rice varieties, comprising at least one primer set among 26 pairs of primer sets including oligonucleotides of SEQ ID NOS: 1 to 52, which polymorphism is exhibited for rice varieties distributed in the country to provide.

The primer set is a supersatellite marker showing high polymorphism for 300 rice cultivars cultivated at home and abroad and can specifically discriminate the rice varieties distributed in the country. The markers of the present invention are SSR (simple sequence repeat) markers exhibiting high polymorphism for 300 rice cultivars cultivated in Korea and distributed to farm households. Specifically, the markers of the present invention showed high polymorphism in 300 rice cultivars described in Table 2 below.

A marker of the invention may comprise, for example, an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 1 and an HVSSR01-32 primer set consisting of an oligonucleotide comprising 10 or more contiguous nucleotides derived from SEQ ID NO: ; An HVSSR01-71 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 3 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 4; An HVSSR01-84 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 5 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 6; An HVSSR02-12 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 7 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 8; An HVSSR02-62 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 9 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 10; An HVSSR02-86 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 11 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 12; An HVSSR03-62 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 13 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 14; An HVSSR03-68 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 15 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 16; An HVSSR04-17 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 17 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 18; An HVSSR05-43 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 19 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 20; An HVSSR05-49 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 21 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 22; An HVSSR05-57 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 23 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 24; An HVSSR05-63 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 25 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 26; An HVSSR06-03 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 27 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 28; An HVSSR06-19 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 29 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 30; An HVSSR06-29 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 31 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 32; An HVSSR06-56 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 33 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 34; An HVSSR06-63 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 35 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 36; An HVSSR06-75 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 37 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 38; An RM418 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 39 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 40; An HVSSR08-19 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 41 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 42; An HVSSR08-35 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 43 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 44; An HVSSR09-40 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 45 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 46; An HVSSR10-08 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 47 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 48; An HVSSR10-35 primer set consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 49 and an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 50; One or more primers selected from the group consisting of an oligonucleotide comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 51 and an HVSSR11-23 primer set consisting of oligonucleotides comprising 10 or more consecutive nucleotides derived from SEQ ID NO: 52 / RTI > The length of the continuous nucleotides may be, for example, 10 to 20, 10 to 19, 10 to 18, 10 to 17, 10 to 16, 10 to 15, 10 to 14, 10 to 13, 10 to 12, Lt; / RTI > nucleotides.

The marker of the present invention may comprise, for example, one or more primer sets selected from the group consisting of 26 pairs of primer sets comprising the oligonucleotides of SEQ ID NOS: 1 to 52 described in Table 1 below. Preferably, the marker of the present invention may include all of the 26 pairs of primer sets including oligonucleotides of SEQ ID NOS: 1 to 52 listed in Table 1 below.

SEQ ID NO: Supersatellite marking factor The base sequence (5 'to 3') of the primer Fluorescent staining One HvSSR01-32
Forward: AAACTGGAGATGAACTCGAA VIC
2 Reverse: GTAACGAACTAGAGCATGGG 3 HvSSR01-71
Forward: TCATCTTACCTTCCCTTGTG PET
4 Reverse direction: GAGAGCTAACCATGAGCAAC 5 HvSSR01-84
Forward: TCTCTCGTCGATCTTAGCAG FAM
6 Reverse: TCGTTAATGAAGTCGTTCGT 7 HvSSR02-12
Forward: TCTCCAATTCTCCATCAAAC VIC
8 Reverse: CTTGCTTGAGCGAGTCTAAT 9 HvSSR02-62
Forward: GGTCGTCACTCGTCAGTAGT NED
10 Reverse: ACGAAACAACACACAGCATA 11 HvSSR02-86
Forward: CTGCATCAATATAATTGCGA FAM
12 Reverse: GCTACTTACACCACCACCAT 13 HvSSR03-62
Forward: ACATGGCCTTGTAGTAGACG PET
14 Reverse: GAAGGAATCCAATGTGTGTT 15 HvSSR03-68
Forward: CTCTATCAATACAAAGGCGG FAM
16 Reverse: CCTGTACTTGCTTTAATCGG 17 HvSSR04-17
Forward: GCTGATCAGTGCTGTAACAA VIC
18 Reverse: TAGAGATCGGCCAGAGATTA 19 HvSSR05-43
Forward: GTGCATTTGCAACTTAAACA FAM
20 Reverse: GGGAGATCAAGAAGAGGTTT 21 HvSSR05-49
Forward: GCTTAGTACTTGCGGCTAAA VIC
22 Reverse direction: CCATCTTACATGTCCTCACC 23 HvSSR05-57
Forward: GACCTCTCCTCGCCCTAC NED
24 Reverse direction: CAGAGAGCACTTCCTGAATC 25 HvSSR05-63
Forward: GTTATGCGCTTCTGCTTATT PET
26 Reverse direction: AGTTGGCTTCTGGATTACAA 27 HvSSR06-03
Forward: CTAGGGAATCAGCGGTTAG FAM
28 Reverse: GCTCTCTTGTCCTTCTTCTTC 29 HvSSR06-19
Forward: CACTGACAAAGCTTCCGTAT VIC
30 Reverse: ATAGTTGCGGAGTGGATAGA 31 HvSSR06-29
Forward: GCGATTCAAAGTGACTGATT NED
32 Reverse: CGCATGTGCAATATGCTA 33 HvSSR06-56
Forward: GAACTAATCTGCTGACCTGG PET
34 Reverse: CCTATACTGGTAATGGCAGC 35 HvSSR06-63
Forward: GTGTGGCAATTTAACATCCT FAM
36 Reverse: TTGTTGCTTGTTCTTCACTG 37 HvSSR06-75
Forward: TTTAGAGATCATGCCGAGTT VIC
38 Reverse: GACGGAGGGAATAACACTTT 39 RM418
Forward: TCGCGTATCGTCATGCATAG NED
40 Reverse direction: GAGCACATATGCCACGTACG 41 HvSSR08-19
Forward: CATCTCTTGAGAAATCTGCC NED
42 Reverse direction: TGTGCATTTCGTCTTTCATA 43 HvSSR08-35
Forward: CTGCAACGTTTATAGCTCAA VIC
44 Reverse direction: TGTTTGTGAACAGATCGTGA 45 HvSSR09-40
Forward: AACTTAAATCCAAACAGGCA FAM
46 Reverse: GATCTTTAGTCCCGGATTCT 47 HvSSR10-08
Forward: CAAGAAAGCCGAGTTAAAGA NED
48 Reverse direction: TCCTCCAAAGATGGTATGAC 49 HvSSR10-35
Forward: AGCTTGTTGGCAGTTTGTAT FAM
50 Reverse: ACACTAAGTGGGCAAATCAG 51 HvSSR11-23
Forward: GGTTCCCAATGCAGTATAGA VIC
52 Reverse direction: CACTAACGACCAAGGTAAGG

In addition, the present invention provides a kit for identifying a rice variety comprising the primer set of SEQ ID NOS: 1 to 52. The kit of the present invention comprises at least one of the primer sets of the present invention, a DNA polymerase and a PCR buffer. In addition, components necessary for conducting electrophoresis to confirm whether the PCR product is amplified can be further included in the kit of the present invention.

Also, the present invention provides a method for amplifying nucleic acid, comprising: amplifying a nucleic acid using genomic DNA derived from rice as a template and using at least one primer set among 26 pairs of primer sets comprising oligonucleotides of SEQ ID NOS: 1 to 52; And determining the rice varieties from the resulting amplification products.

In the method for identifying rice varieties of the present invention, the genomic DNA can be obtained by using a conventional method of collecting DNA from seeds of rice and whole plants of rice. For example, the genomic DNA may be derived from the seeds of rice plants or leaves, stems and fruit of young plants. Preferably, the genomic DNA can be harvested from leaves of young plants of rice after seeding or rice leaves, especially seeds, of rice or after seeding.

In the rice variety identification method of the present invention, PCR (polymerase chain reaction) is preferably used for amplification of genomic DNA. Methods for performing general PCR are well known in the art. Specifically, the PCR reaction can be carried out using a PCR reaction solution containing various components known to be necessary for the PCR reaction in the art. For example, the PCR reaction solution includes genomic DNA derived from rice to be analyzed, a marker of the present invention, an appropriate amount of DNA polymerase (for example, Taq polymerase), dNTP mixture, PCR buffer solution and water to be analyzed. The PCR buffer may contain KCl, Tris-HCl and MgCl _2.

The detection of the amplification product obtained in the rice seedling identification method of the present invention may be carried out, for example, by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement. Preferably, the detection of the obtained amplification product can be performed by using an automatic base sequence analyzer to confirm the size of an allele (band) by a computer program.

The step of determining the rice cultivar from the amplification product obtained in the rice cultivar identification method of the present invention can be carried out by, for example, displaying the presence or absence of the amplification product by the primer set of the present invention in a known rice cultivar and comparing it with the obtained amplification product And determining the rice variety by analysis. The step of displaying the presence or absence of the amplification products may be carried out by, for example, arranging the sizes of the alleles derived from known rice varieties using a primer set of the present invention in advance in one table, and then, when present according to the presence or absence of the alleles, Quot; 1 "when it is not present and" 0 " Therefore, it is possible to isolate genomic DNA from the rice for which the breed is to be identified, amplify it using the primer set of the present invention, analyze the size of the amplified product, and identify all the varieties through a statistical program.

By using only the markers for identifying rice varieties of the present invention, it is possible to identify 300 rice varieties which are cultivated in Korea. Therefore, it can be used for various fields such as identification of genuineness of rice varieties, scientific verification of hybridization of rice species and supply species, infringement of breed protection rights, and selection of control varieties when breed protection application is made.

FIGS. 1A to 1F show the genetic similarity of rice varieties and breeds by encoding the rice varieties analyzed by the marker according to the present invention and using the NTSYSPC computer program.
FIGS. 2A to 2C show the presence or absence of a band according to the size (bp) of the allele gene when amplified using 26 primer sets of the present invention in 300 rice cultivars cultivated at home and abroad. Quot; 1 ", and when there is no band, it is represented by " 0 ".

Hereinafter, the present invention will be described in more detail by way of examples. However, the present invention is not limited by the following examples.

Example  1: for rice variety identification Marker  evaluation

(1) Rice sample

In the present invention, 300 rice varieties listed in Table 2 below were used for selection of rice primer-identifying primer sets and rice varietal discrimination test.

Serial number Breed name Fosterer Serial number Breed name Fosterer Serial number Breed name Fosterer One A flat Atomic Energy Research Institute 101 Sampyeong Rural Development Administration 201 tune Kim Byeong Geun 2 Ore Atomic Energy Research Institute 102 Taebong Rural Development Administration 202 Red light Kim Byeong Geun 3 Palgong Rural Development Administration 103 Fang Rural Development Administration 203 Cheongpoong Chung-cheong bukdo 4 Sangnam Field Rural Development Administration 104 Gongbong Rural Development Administration 204 Shinto black rice Jeollabuk do 5 East Sea Rural Development Administration 105 Red pearl Rural Development Administration 205 Antagonist Broadcasting and Telecommunications University 6 Yeongnam Rural Development Administration 106 Hojin Rural Development Administration 206 Super Jamie Broadcasting and Telecommunications University 7 Hwa Young Rural Development Administration 107 Bay Rural Development Administration 207 Big-eyed sperm Broadcasting and Telecommunications University 8 Resident Rural Development Administration 108 Black Rural Development Administration 208 Dreamy 2 Kyungpook National University 9 aggro Rural Development Administration 109 Junnam Rural Development Administration 209 A supper Gangwon-do 10 three hundred Rural Development Administration 110 Hyeonseong Rural Development Administration 210 1010 Gangwon-do 11 Sangsan Rural Development Administration 111 Zhongshan Rural Development Administration 211 Plow Rural Development Administration 12 Neutralization Rural Development Administration 112 Goami Rural Development Administration 212 SeoNin 15 Seoul National University 13 South river Rural Development Administration 113 Original Atomic Energy Research Institute 213 Gold Rural Development Administration 14 Japan Rural Development Administration 114 Cone Atomic Energy Research Institute 214 1007 Rural Development Administration 15 Wind Rural Development Administration 115 Black eye Atomic Energy Research Institute 215 Young man Rural Development Administration 16 Kumo 1 Rural Development Administration 116 Bloom Atomic Energy Research Institute 216 World delicacy Rural Development Administration 17 Angel Rural Development Administration 117 New reclamation Rural Development Administration 217 curfew Rural Development Administration 18 Daesan Rural Development Administration 118 Dongjin 1 Rural Development Administration 218 Youngho delicacy Rural Development Administration 19 Kimo 2 Rural Development Administration 119 Late Rural Development Administration 219 The Rural Development Administration 20 Nam River Rural Development Administration 120 New residence Rural Development Administration 220 Bright Rural Development Administration 21 Arangissa Rural Development Administration 121 Son Rural Development Administration 221 1008 Rural Development Administration 22 territorial waters Rural Development Administration 122 full moon Rural Development Administration 222 1009 Rural Development Administration 23 Resident Rural Development Administration 123 Young Rural Development Administration 223 progress Rural Development Administration 24 easting Rural Development Administration 124 Stone Rural Development Administration 224 Dasan 2 Rural Development Administration 25 Freshness Rural Development Administration 125 Samdeok Rural Development Administration 225 Tho Rural Development Administration 26 Daekung Rural Development Administration 126 Mummies Rural Development Administration 226 faint light Rural Development Administration 27 Union Rural Development Administration 127 No Rural Development Administration 227 Chae Hae Jin Rural Development Administration 28 Tamjin Rural Development Administration 128 Namil Rural Development Administration 228 signature Rural Development Administration 29 Development Rural Development Administration 129 Taesung Rural Development Administration 229 1001 Rural Development Administration 30 Namwon Rural Development Administration 130 Grandfather Rural Development Administration 230 A delightful delicacy Rural Development Administration 31 Longevity Rural Development Administration 131 Manho Rural Development Administration 231 A red spot Rural Development Administration 32 Neon Rural Development Administration 132 epistle Rural Development Administration 232 Sheep Rural Development Administration 33 basin Rural Development Administration 133 Flour Rural Development Administration 233 1011 Rural Development Administration 34 Reclamation Rural Development Administration 134 picture gallery Rural Development Administration 234 Lust Rural Development Administration 35 Geumnam Rural Development Administration 135 SeoNin 9 Seoul National University 235 Monthly Rural Development Administration 36 brewing Rural Development Administration 136 SeoNyon 12 Seoul National University 236 Goodwill Rural Development Administration 37 Uno Rural Development Administration 137 Samkwang Rural Development Administration 237 Criticism Rural Development Administration 38 Fancy Rural Development Administration 138 Joan Rural Development Administration 238 Cheong Bak Rural Development Administration 39 3,000 Rural Development Administration 139 Black light Rural Development Administration 239 Whitish Rural Development Administration 40 During Rural Development Administration 140 reputation Rural Development Administration 240 Beauty Rural Development Administration 41 South pyeong Rural Development Administration 141 Book Review Rural Development Administration 241 1013 Rural Development Administration 42 Black Rural Development Administration 142 equability Rural Development Administration 242 Sucess Rural Development Administration 43 The Rural Development Administration 143 want Atomic Energy Research Institute 243 Delicious delicacy Gangwon-do 44 Slavery Rural Development Administration 144 Mangrove Rural Development Administration 244 1015 Rural Development Administration 45 Mars Rural Development Administration 145 Cheongho Rural Development Administration 245 1014 Rural Development Administration 46 Twilight Rural Development Administration 146 Bail Rural Development Administration 246 Health Promotion Rural Development Administration 47 Hwaseong Rural Development Administration 147 One heart Rural Development Administration 247 Hanam 2 Rural Development Administration 48 Delicacy Rural Development Administration 148 zest Rural Development Administration 248 Shin Baek Rural Development Administration 49 Clarity Rural Development Administration 149 Hacking Rural Development Administration 249 Truth Cho Yoo-hyun 50 Chang'an Rural Development Administration 150 Early Morning Rural Development Administration 250 SeoNon 16 Seoul National University 51 Obon Rural Development Administration 151 delicate Rural Development Administration 251 1012 Rural Development Administration 52 course Rural Development Administration 152 High quality Rural Development Administration 252 Dimming Rural Development Administration 53 West Coast Rural Development Administration 153 Gender Ryang Sang-ge 253 Shinnuri Rural Development Administration 54 Genuine work Rural Development Administration 154 Yolk Yeungnam University 254 cloisonne Rural Development Administration 55 Anjung Rural Development Administration 155 Gold tower Yeungnam University 255 Munch Rural Development Administration 56 banality Rural Development Administration 156 Black scissors Konkuk University 256 Koshihikari Japan introduced species 57 Jinbool Rural Development Administration 157 Incarnation 1 Rural Development Administration 257 Nipponbare Japan introduced species 58 Anger Rural Development Administration 158 Shin Woon Bong 1 Rural Development Administration 258 Golden Purple Rural Development Administration 59 In vitro Rural Development Administration 159 Onnuri Rural Development Administration 259 Hong Jin-ju Rural Development Administration 60 In the air Rural Development Administration 160 meet Rural Development Administration 260 Hardcore Rural Development Administration 61 Conflict 1 Rural Development Administration 161 Ode 1 Rural Development Administration 261 snowstorm Rural Development Administration 62 Anecdote Rural Development Administration 162 Xi'an 1 Rural Development Administration 262 Borami Rural Development Administration 63 Flavor 1 Rural Development Administration 163 1 Rural Development Administration 263 Super Jamie 2 Broadcasting and Telecommunications University 64 Juan Rural Development Administration 164 Flavor 1 Rural Development Administration 264 Flower garden 6 Chungnam National University 65 Alternatives Rural Development Administration 165 Jinpo 3 Rural Development Administration 265 Current 1 Cho Yoo-hyun 66 Fertile Rural Development Administration 166 Shin Myung Jeollabuk do 266 Hwa Young's delicacy Gyeongsangbuk-do 67 Ansan Rural Development Administration 167 Bribe Konkuk University 267 SeoNyon 17 Seoul National University 68 Daejin Rural Development Administration 168 Green Rural Development Administration 268 Taste Gyeonggi-do 69 letterweight Rural Development Administration 169 Dasan 1 Rural Development Administration 269 Sulmei Rural Development Administration 70 Flavor 2 Rural Development Administration 170 The Golden Nurse Rural Development Administration 270 Joe's black rice Rural Development Administration 71 East Rural Development Administration 171 Tribute Rural Development Administration 271 1016 Rural Development Administration 72 Black pearl Rural Development Administration 172 A wave of sunshine Rural Development Administration 272 Oriental black rice Rural Development Administration 73 Tree Rural Development Administration 173 East Sea delicacy Rural Development Administration 273 1017 Rural Development Administration 74 Anonymity Rural Development Administration 174 Mountain delicacy Rural Development Administration 274 1018 Rural Development Administration 75 Sura Rural Development Administration 175 Junnam Nursery Rural Development Administration 275 Regeneration Gold Rural Development Administration 76 Gwangan Rural Development Administration 176 Horse horse Rural Development Administration 276 Two rings Gangwon-do 77 know Rural Development Administration 177 Big Island Rural Development Administration 277 1021 Gangwon-do 78 Dongdu Rural Development Administration 178 Damie Rural Development Administration 278 Gunpowder Rural Development Administration 79 Aesthetic Rural Development Administration 179 Blue Rural Development Administration 279 Sodami Rural Development Administration 80 Consultation Rural Development Administration 180 Cheongdam Rural Development Administration 280 Receiving Rural Development Administration 81 Shore Rural Development Administration 181 plain Rural Development Administration 281 Hopeful Rural Development Administration 82 Advance Rural Development Administration 182 A white paper Rural Development Administration 282 Ishikari Japan introduced species 83 Sponge Rural Development Administration 183 Wife 2 Rural Development Administration 283 Choking Japan introduced species 84 Chung Ho Rural Development Administration 184 Goami 3 Rural Development Administration 284 Hwacheon Japan introduced species 85 Manan Rural Development Administration 185 Han Rural Development Administration 285 White bean paste Japan introduced species 86 Anhydrous Rural Development Administration 186 1004 Rural Development Administration 286 Pyongyang 21 Japan introduced species 87 Sweet rice Rural Development Administration 187 New concentration Jeollabuk do 287 Asamura Japan introduced species 88 New chuck Rural Development Administration 188 Origin Atomic Energy Research Institute 288 Kusa Hona Japan introduced species 89 curio Rural Development Administration 189 jewelry Rural Development Administration 289 Manyo moo Japan introduced species 90 ZhongAn Rural Development Administration 190 Cheongbak Rural Development Administration 290 Chukushia Japan introduced species 91 Anseong Rural Development Administration 191 Herald Rural Development Administration 291 Yumetoi Japan introduced species 92 Snowmobile Rural Development Administration 192 Inochinoichi Takashi Mai 292 Hoshi Utah Japan introduced species 93 Consumption Rural Development Administration 193 Dragan Rural Development Administration 293 Sarikin Japan introduced species 94 Shindongjin Rural Development Administration 194 Cheongcheong Delicacy Rural Development Administration 294 Benny Roman Japan introduced species 95 beauty Rural Development Administration 195 Jewelry Inspector Rural Development Administration 295 Guang Lua 4 Chinese introduced species 96 sentence Rural Development Administration 196 High ami Rural Development Administration 296 Joo Yun Noo Chinese introduced species 97 Sujin Rural Development Administration 197 Seonong 14 Seoul National University 297 Naturalized sulfur Chinese introduced species 98 SeoNin 6 Seoul National University 198 Flower garden 4 Chungnam National University 298 Stowage 18 Chinese introduced species 99 Venus Kim Young Ha 199 Flower Garden 5 Chungnam National University 299 Luchuan Zao 1 Chinese introduced species 100 Rawhouse Atomic Energy Research Institute 200 Dream 1 Kyungpook National University 300 Rish Nuo Chinese introduced species

(2) Extraction of genomic DNA

The disclosed three rice seedlings described in Table 2 were used as a genomic DNA separation material. Three seeds of rice seeds were ground with 2 tungsten beads in a 2 ml tube, and genomic DNA was isolated using a NucleoSpin® Plant II (Macherey-Nagel Cat. 740 770.250) kit. The extracted genomic DNA was electrophoresed on a 1.0% agarose gel to confirm the DNA concentration. After quantification, the DNA was diluted to a concentration of 10 ng per μl and used for PCR analysis.

(3) Selection of SSR primer set for breed identification

In order to select the effective molecular markers for the identification of rice varieties, it is necessary to select 'Myeongseong', ' And 'high' varieties were amplified using 660 SSR primer sets. The difference in alleles of each sample was analyzed using a capillary electrophoresis apparatus (HDA-GT12TM System, eGEnE, Inc.) and a computer program (Biocalculator 2.0), and then 26 markers with high band polymorphism Respectively. Fluorescently labeled oligonucleotides were prepared with one of the fluorogenic materials FAM, VIC, NED and PET as forward primers in order to carry out a precise analysis with an automatic sequencer for the molecular markers of these 26 markers.

(4) PCR amplification and electrophoresis

PCR was performed using the prepared genomic DNA and the prepared marker as a material. 20 ng of the above prepared rice genomic DNA, 0.1 μM of the above marker, 2.0 μl of dNTP mixture (2.5 mM), 1 μl of Taq polymerase (Takara CAT.RR011A), 2.5 μl of 10 × PCR buffer KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl ₂ ) was added to distilled water to adjust the total volume to 25 μl. PCR amplification (C1000, BioRad, USA) was performed by denaturing the genomic DNA at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and elongation at 72 ° C for 45 seconds for 40 times Lt; / RTI > The PCR product was reacted at 72 ° C for 10 minutes for final elongation. The annealing temperatures for each primer set are shown in Table 3 below. After completion of the PCR, amplification was confirmed by electrophoresis on 2.8% agarose gel. The amplified samples were stored at -20 ° C for the next experiment. Amplified samples were diluted to 150 μl of ultrapure water at an appropriate concentration, and then 3 μl of the diluted PCR product was diluted with 10 μl of deionized formamide, a size marker (LIZ 500 size standard) was mixed well and denatured at 94 ° C for 2 minutes. The denatured gene amplification product was electrophoresed using an automatic base sequence analyzer (Genetic Analyzer 3130XL, Applied Biosystem). The allele size of each species was measured accurately using GeneMapper3.7 computer program (Applied Biosystem).

(5) Identification of rice varieties of markers according to the present invention

Identification of the rice varieties of the marker according to the present invention was examined using the allele gene size confirmed by the automatic nucleotide sequencer. Polymorphism information content (PIC) values were calculated using the following equation (1). In the following equation, Pij is the frequency of the jth common band pattern among the bands of the marker i (Anderson et al., 1993, Genome 36: 181-186).

<Formula 1>

As a result, annealing temperature (° C), amplification product size (bp), number of alleles and PIC value according to each marker are shown in Table 3 below.

Serial number SSR marker name Annealing temperature (캜)  The size of the allele (bp) Number of alleles PIC value One HVSSR01-32 55 237-269 9 0.786 2 HVSSR01-71 55 155-204 15 0.872 3 HVSSR01-84 55 191-245 16 0.831 4 HVSSR02-12 55 298-330 13 0.665 5 HVSSR02-62 55 335-384 16 0.776 6 HVSSR02-86 55 209-312 18 0.864 7 HVSSR03-62 55 259-319 18 0.863 8 HVSSR03-68 55 190-231 13 0.707 9 HVSSR04-17 55 315-366 11 0.569 10 HVSSR05-43 55 231-292 10 0.708 11 HVSSR05-49 55 152-198 10 0.711 12 HVSSR05-57 55 219-257 11 0.739 13 HVSSR05-63 55 171-221 10 0.601 14 HVSSR06-03 55 167-217 9 0.682 15 HVSSR06-19 55 297-335 9 0.635 16 HVSSR06-29 55 346-384 12 0.786 17 HVSSR06-56 55 309-345 13 0.758 18 HVSSR06-63 55 259-317 12 0.681 19 HVSSR06-75 55 158-196 12 0.711 20 RM418 55 257-319 14 0.849 21 HVSSR08-19 55 169-242 15 0.708 22 HVSSR08-35 55 320-373 16 0.877 23 HVSSR09-40 55 269-297 15 0.842 24 HVSSR10-08 55 317-369 10 0.807 25 HVSSR10-35 55 196-212 15 0.744 26 HVSSR11-23 55 125-141 9 0.760 sum 331.00 15.504 Average 12.73 0.738

As shown in Table 3 above, except for one marker (HVSSR04-17) used in the present invention, all of the markers exhibit a high PIC value of 0.6 or more, indicating that rice varieties can be sufficiently discriminated.

In addition, NTSYS pc (version 2.10b) (Rohlf, 2000, Numerical Taxonomy and Multivariate Analysis System-Version 2.10b. Applied Biostatistics Inc., New York.) Computer according to the presence or absence of band depending on the allele gene size And genetic similarity values were calculated according to Jaccard's method (Sneath and Sokal 1973, Numerical taxonomy: The Principles and Practice of Numerical Classification, WH Freeman, San Francisco). A dendrogram was constructed by using the genetic similarity method and analyzed by UPGMA (Sneath and Sokal, 1973) method. The results are shown in FIGS. 1A to 1F. 1A to 1F, it can be seen that the primer set of the present invention enables identification of 300 rice varieties distributed in the country.

Example  2: Identification of rice varieties

(1) Using the marker of the present invention to prepare a variety identification list

Genomic DNA was extracted from each of the 300 rice cultivars cultivated in Korea according to the method (2) of Example 1 above. PCR was carried out according to the method (4) of Example 1 using 26 markers of the present invention as a primer set. From the PCR result, the presence or absence of bands was determined for the marker according to the present invention. When the bands were present, they were coded as a score of 1, and when there were no bands, they were coded as 0, so that each of 300 rice varieties The breed identification table was prepared. The results are shown in Figs. As shown in FIGS. 2A to 2An, rice species showed different band sizes depending on the number of alleles according to the marker of the present invention. For example, in Table 2, a 'gem' varieties of 52 rice varieties have one 250 bp allele when amplified with the molecular marker HvSSR1-32.

(2) Identification of rice varieties

Three rice seedlings and two tungsten beads were ground in a 2 ml tube and the genomic DNA was isolated using a NucleoSpin® Plant II (Macherey-Nagel Cat. 740 770.250) kit. The extracted genomic DNA was electrophoresed on a 1.0% agarose gel to confirm the DNA concentration. After quantification, the DNA was diluted to a concentration of 10 ng per μl.

Using the primer set of each of the 26 markers of the present invention, the extracted genomic DNA was amplified by PCR and electrophoresed. PCR amplification and electrophoresis were carried out in the same manner as described in Example 1 above. The presence or absence of bands in each electrophoresis result was compared with the results in Figs. 2a to 2an. The rice that was intended to identify the varieties showed the same band type as that of 'one' varieties, so it was identified as 'one' varieties.

<110> Korea Seed and Variery Service <120> A method for identifying rice varieties using microsatellites          markers <130> PN099693 <160> 52 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR01-32_F <400> 1 aaactggaga tgaactcgaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR01-32_R <400> 2 gtaacgaact agagcatggg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR01-71_F <400> 3 tcatcttacc ttcccttgtg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR01-71_R <400> 4 gagagctaac catgagcaac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR01-84_F <400> 5 tctctcgtcg atcttagcag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR01-84_R <400> 6 tcgttaatga agtcgttcgt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR02-12_F <400> 7 tctccaattc tccatcaaac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR02-12_R <400> 8 cttgcttgag cgagtctaat 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR02-62_F <400> 9 ggtcgtcact cgtcagtagt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR02-62_R <400> 10 acgaaacaac acacagcata 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR02-86_F <400> 11 ctgcatcaat ataattgcga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR02-86_R <400> 12 gctacttaca ccaccaccat 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR03-62_F <400> 13 acatggcctt gtagtagacg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR03-62_R <400> 14 gaaggaatcc aatgtgtgtt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR03-68_F <400> 15 ctctatcaat acaaaggcgg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR03-68_R <400> 16 cctgtacttg ctttaatcgg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR04-17_F <400> 17 gctgatcagt gctgtaacaa 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR04-17_R <400> 18 tagagatcgg ccagagatta 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR05-43_F <400> 19 gtgcatttgc aacttaaaca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR05-43_R <400> 20 gggagatcaa gaagaggttt 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR05-49_F <400> 21 gcttagtact tgcggctaaa 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR05-49_R <400> 22 ccatcttaca tgtcctcacc 20 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HvSSR05-57_F <400> 23 gacctctcct cgccctac 18 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR05-57_R <400> 24 cagagagcac ttcctgaatc 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR05-63_F <400> 25 gttatgcgct tctgcttatt 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR05-63_R <400> 26 agttggcttc tggattacaa 20 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-03_F <400> 27 ctagggaatc agcggttag 19 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-03_R <400> 28 gctctcttgt ccttcttctt c 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-19_F <400> 29 cactgacaaa gcttccgtat 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-19_R <400> 30 atagttgcgg agtggataga 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-29_F <400> 31 gcgattcaaa gtgactgatt 20 <210> 32 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-29_R <400> 32 cgcatgtgca atatgcta 18 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-56_F <400> 33 gaactaatct gctgacctgg 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-56_R <400> 34 cctatactgg taatggcagc 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-63_F <400> 35 gtgtggcaat ttaacatcct 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-63_R <400> 36 ttgttgcttg ttcttcactg 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-75_F <400> 37 tttagagatc atgccgagtt 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR06-75_R <400> 38 gacggaggga ataacacttt 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RM418_F <400> 39 tcgcgtatcg tcatgcatag 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RM418_R <400> 40 gagcacatat gccacgtacg 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR08-19_F <400> 41 catctcttga gaaatctgcc 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR08-19_R <400> 42 tgtgcatttc gtctttcata 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR08-35_F <400> 43 ctgcaacgtt tatagctcaa 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR08-35_R <400> 44 tgtttgtgaa cagatcgtga 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR09-40_F <400> 45 aacttaaatc caaacaggca 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR09-40_R <400> 46 gatctttagt cccggattct 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR10-08_F <400> 47 caagaaagcc gagttaaaga 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR10-08_R <400> 48 tcctccaaag atggtatgac 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR10-35_F <400> 49 agcttgttgg cagtttgtat 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR10-35_R <400> 50 acactaagtg ggcaaatcag 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR11-23_F <400> 51 ggttcccaat gcagtataga 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HvSSR11-23_R <400> 52 cactaacgac caaggtaagg 20

Claims (6)

A HVSSR01-32 primer set consisting of the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2;
A HVSSR01-71 primer set consisting of the oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4;
A HVSSR01-84 primer set consisting of the oligonucleotides of SEQ ID NO: 5 and SEQ ID NO: 6;
A HVSSR02-12 primer set consisting of oligonucleotides of SEQ ID NO: 7 and SEQ ID NO: 8;
A HVSSR02-62 primer set consisting of oligonucleotides of SEQ ID NO: 9 and SEQ ID NO: 10;
A HVSSR02-86 primer set consisting of oligonucleotides of SEQ ID NO: 11 and SEQ ID NO: 12;
A HVSSR03-62 primer set consisting of the oligonucleotides of SEQ ID NO: 13 and SEQ ID NO: 14;
A HVSSR03-68 primer set consisting of oligonucleotides of SEQ ID NO: 15 and SEQ ID NO: 16;
A HVSSR04-17 primer set consisting of oligonucleotides of SEQ ID NO: 17 and SEQ ID NO: 18;
A HVSSR05-43 primer set consisting of oligonucleotides of SEQ ID NO: 19 and SEQ ID NO: 20;
A HVSSR05-49 primer set consisting of oligonucleotides of SEQ ID NO: 21 and SEQ ID NO: 22;
A HVSSR05-57 primer set consisting of oligonucleotides of SEQ ID NO: 23 and SEQ ID NO: 24;
A HVSSR05-63 primer set consisting of oligonucleotides of SEQ ID NO: 25 and SEQ ID NO: 26;
A HVSSR06-03 primer set consisting of oligonucleotides of SEQ ID NO: 27 and SEQ ID NO: 28;
29 and SEQ ID NO: 30;
A HVSSR06-29 primer set consisting of oligonucleotides of SEQ ID NO: 31 and SEQ ID NO: 32;
A HVSSR06-56 primer set consisting of oligonucleotides of SEQ ID NO: 33 and SEQ ID NO: 34;
A HVSSR06-63 primer set consisting of oligonucleotides of SEQ ID NO: 35 and SEQ ID NO: 36;
A HVSSR06-75 primer set consisting of oligonucleotides of SEQ ID NO: 37 and SEQ ID NO: 38;
An RM418 primer set consisting of oligonucleotides of SEQ ID NO: 39 and SEQ ID NO: 40;
A HVSSR08-19 primer set consisting of oligonucleotides of SEQ ID NO: 41 and SEQ ID NO: 42;
A HVSSR08-35 primer set consisting of oligonucleotides of SEQ ID NO: 43 and SEQ ID NO: 44;
A HVSSR09-40 primer set consisting of oligonucleotides of SEQ ID NO: 45 and SEQ ID NO: 46;
A HVSSR10-08 primer set consisting of oligonucleotides of SEQ ID NO: 47 and SEQ ID NO: 48;
A HVSSR10-35 primer set consisting of oligonucleotides of SEQ ID NO: 49 and SEQ ID NO: 50; And
A primer set for identification of a rice variety, comprising a set of HVSSR11-23 primers consisting of oligonucleotides of SEQ ID NO: 51 and SEQ ID NO: 52. A kit for identifying rice varieties, comprising a rice set identification primer set, a DNA polymerase and a PCR buffer solution according to claim 1. Amplifying a nucleic acid using a genome DNA derived from rice as a template and using a rice primer set for identifying rice varieties as a primer; And
And determining the rice varieties from the resulting amplification products. [4] The method according to claim 3, wherein the genomic DNA is derived from the seeds of the rice or the leaves, stem and fruit of the young plant. The method according to claim 3, wherein the detection of the obtained amplification product is performed by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. [Claim 4] The method according to claim 3, wherein the step of determining the rice cultivar from the obtained amplification product indicates the presence or absence of the amplification product by the rice cultivar discriminating primer set of claim 1 for the known rice varieties, A method of identifying a rice variety, comprising determining a rice variety.

Images