CN108165649B - Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof - Google Patents
Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof Download PDFInfo
- Publication number
- CN108165649B CN108165649B CN201810072490.4A CN201810072490A CN108165649B CN 108165649 B CN108165649 B CN 108165649B CN 201810072490 A CN201810072490 A CN 201810072490A CN 108165649 B CN108165649 B CN 108165649B
- Authority
- CN
- China
- Prior art keywords
- rice
- brown planthopper
- resistant
- primer
- insect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a molecular marker of a rice brown planthopper resistant major gene qBph4(t) and application thereof. According to the invention, the genotype of each individual F2 plant obtained by hybridizing the insect-resistant variety ARC5984 (male parent) and 9311 (female parent) of rice is combined with the resistance level of brown planthopper resistance of the F2:3 family to carry out genetic linkage analysis, so that the major resistance gene qBph4(t) carried by the insect-resistant variety ARC5984 is identified and positioned in the 6cM interval between the molecular markers RM5635 and RM5742, and is closely linked with the molecular marker RM 5635. The molecular marker linked with the gene also has RM 5757. The molecular marker can effectively detect whether the major resistance gene locus is contained in an insect-resistant variety ARC5984 and derivatives thereof, greatly improves the selection efficiency of brown planthopper-resistant rice plants, and obtains a brown planthopper-resistant rice variety containing qBph4 (t).
Description
Technical Field
The invention relates to the field of molecular genetics, in particular to a molecular marker of a brown planthopper resistant major gene qBph4(t) of rice and application thereof.
Background
Rice is one of the most important food crops in the world and is always attacked by various pests, so that the production of the rice is seriously threatened. Brown planthopper belongs to a special feeding pest, absorbs phloem juice of a plant by a needle, causes yellow leaves or withering of rice plants, and finally causes yield reduction or absolute harvest. According to the records of Chinese agricultural yearbook, rice planthopper (mainly brown planthopper) is generated from the sixties of the last century to the present, the area of damage of the rice planthopper is more than 50% of the total area of rice planting, and serious loss is caused to rice production in China. Since the harm of brown planthopper is mostly generated in the mature and grain filling stage of rice, the pollution to the environment and paddy is also a very serious problem when a large amount of insecticide is used. The cultivation of the anti-brown planthopper rice variety by using the anti-brown planthopper gene is the most economic and effective method in the comprehensive prevention and control of brown planthopper.
Since the beginning of the seventies of the last century, the research on brown planthopper-resistant genes of rice has identified and located 32 major insect-resistant genes from cultivated rice and various wild rice. A plurality of brown planthopper-resistant genes such as Bph1, Bph2 and Bph3 which are researched in an early stage are bred into insect-resistant varieties and popularized and planted in some rice planting areas. However, due to the emergence of the neotype of brown planthopper, the resistant varieties of brown planthopper gradually lose resistance or are at risk of resistance loss. For example, the insect-resistant variety with Bph1 loses resistance quickly after being popularized and planted for several years, and the variety carrying the Bph 1and Bph2 has stronger and more durable resistance. Therefore, there is an urgent need for insect-resistant varieties carrying new and multiple resistance genes in rice production.
Due to the complexity of insect resistance identification, it is often difficult to efficiently introduce and aggregate different insect-resistant genes using conventional breeding approaches. On the basis of finding out the molecular Marker which is closely linked or co-separated with the insect-resistant gene, the invention can purposefully conduct the introduction and the polymerization of the insect-resistant gene by means of a Marker-assisted selection (MAS) technology, select and breed the durable resistant variety, delay the degradation period of the insect-resistant variety and prevent the occurrence of new biotypes of brown planthopper.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, provides a molecular marker of a rice brown planthopper-resistant major gene qBph4(t) and application thereof, and can predict the brown planthopper resistance of rice plants and accelerate the breeding progress of brown planthopper-resistant rice varieties by detecting the molecular marker closely linked with brown planthopper-resistant major gene loci.
One of the purposes of the invention is to provide molecular markers of a rice brown planthopper-resistant major gene qBph4(t), and by detecting the molecular markers which are closely linked with the brown planthopper-resistant major gene, the resistance of a rice plant to brown planthopper can be predicted, and the selection progress of a brown planthopper-resistant rice variety is accelerated.
The molecular marker of the rice brown planthopper resistant major gene qBph4(t) provided by the invention is obtained by PCR amplification of one of the following primer pairs:
(1) the labeling primer RM5635 is used,
forward primer sequence: TCGCGTCGTAGCTGAACACTGC
Reverse primer sequence: TAGCTTGCTCTCCCTCTGCTTGC, respectively;
(2) the primer RM5742 is marked, and the primer RM5742,
forward primer sequence: GATCCTCAAACGGCCTCTGC
Reverse primer sequence: CCTTCAAAGTTTACTCACGCTCTGC, respectively;
(3) the primer RM5757 is marked, and the primer RM5757 is marked,
forward primer sequence: GCTGATGCGGAACAAGGAGACC the flow of the air in the air conditioner,
reverse primer sequence: GATCAGATCACCACCCGAATGAGC, respectively;
wherein the amplification lengths of the labeled primers (1) - (3) are 170bp, 190bp and 180bp respectively.
The other purpose of the invention is to provide a method for screening brown planthopper resistant rice by molecular marking of the brown planthopper resistant major gene qBph4(t) of the rice, which comprises the steps of amplifying the genomic DNA of the rice leaf to be detected by the primer pair, and detecting an amplification product, wherein if a 170bp fragment can be amplified by using a primer RM5635, a 190bp fragment can be amplified by using a primer RM5742, or a 180bp fragment can be amplified by using a primer RM5757, the existence of the brown planthopper resistant major gene qBph4(t) of the rice to be detected is marked. The gene locus is located in the region between molecular markers RM5635 and RM5742 of the 4 th chromosome long arm of the rice genome. The present invention screened individuals of family F2:3 of ARC5984 and 9311 with RM5635 and RM5742 to obtain individuals with recombination between these two molecular markers. After analyzing the genotype and insect-resistant grade of the recombinant individual, the molecular markers RM5635 and RM5742 are closest to the major gene qBph4(t) for resisting the brown planthopper; meanwhile, the molecular markers RM5635, RM5742 and RM5757 can also be used for screening brown planthopper resistant rice varieties containing qBph4(t) genes.
The process of screening the molecular marker primer is as follows:
(1) recent brown planthopper resistance identification shows that the farmer variety ARC5984 has high resistance to brown planthopper populations collected in rice fields in the Nanning area. Based on the new resistance source, the invention screens and develops SSR molecular markers which are closely linked with resistance genes and are based on PCR technology. According to SSR molecular markers published by a Gramene website (http:// www.gramene.org /) and according to a relatively uniform genetic distance, selecting a certain number of molecular markers for the positioning research of resistance genes, and selecting a certain number of molecular markers according to the relatively uniform genetic distance for synthesis.
(2) The high-susceptibility brown planthopper indica rice line 9311 is used as a female parent, an anti-brown planthopper variety ARC5984 is used as a male parent, a hybrid is prepared, and a 9311/ARC5984F2 separation population is constructed for molecular marker analysis; each F2 individual plant is selfed to obtain corresponding F2:3 family for identifying the insect resistance in seedling stage.
(3) Genomic DNA from each individual of the parental populations ARC5984 and 9311and F2 was extracted by the CTAB method (Murray & Thompson, 1980Rapid isolation of high-molecular-weight plant DNA. nucleic Acids Res 8: 4321-4325). And (2) carrying out polymorphism screening on the amphiphilic parents by using the alternative marker obtained by the method (1), carrying out PCR reaction on a BIOER (polymerase chain reaction) amplification instrument, carrying out electrophoretic analysis on an amplification product on 6% non-denaturing polyacrylamide gel, and recording and selecting the SSR marker with polymorphism between parents for subsequent analysis.
(4) The insect resistance identification is carried out by adopting the seedling stage insect inoculation, and the brown planthopper insect source used in the experiment is a population which is collected from the suburban rice field in south China Guangxi in 2016 and propagated on an insect-susceptible variety TN1 plant. 2-3 stage brown planthopper nymphs were inoculated at 8 heads/shoot in rice grown to two leaf-one stage (about 11 days), and when the control susceptible variety TN1 died all, resistance evaluations were performed on each individual at levels 0, 1, 3, 5, 7, 9 (Qia et al 2010high-resolution mapping of the brown planthopper resistance gene Bph6in and characteristics resistance in the 9311and Nipponbare neutral background population. the term apple 121: 1601-.
(5) According to F2: and (3) selecting leaf genome DNAs of 10 extreme insect-resistant individuals and 10 extreme susceptible individuals respectively according to the average insect-resistant level of the 3 lines, and mixing the leaf genome DNAs in an equal amount to construct an anti-susceptible DNA pool. Meanwhile, SSR primers with polymorphism between parents are utilized to respectively screen the resistance pool and the sensing pool and obtain molecular markers with polymorphism between the resistance pool and the sensing pool, and the polymorphism markers indicate that the resistance traits are possibly linked. Then, according to the chromosome where the linkage marker is located, each individual strain of the F2 segregation population is amplified by selecting a primer having polymorphism between parents on the chromosome, and the PCR program is the same as above, thereby obtaining the genotype data of the population. According to the linkage exchange rule, the software JoinMap 3.0 is used for constructing a partial genetic map of the rice from the group genotype data and obtaining the genetic distance of each molecular marker. And finally, combining the molecular marker genotype data of each individual plant of the F2 population and the corresponding insect-resistant level identified by the resistance of the brown planthopper, and performing QTL locus scanning on the target chromosome by using a MapQTL 5.0 software composite interval mapping method.
(6) According to the result of primary QTL identification, the invention screens single strains of F2:3 family groups of ARC5984 and ARC 9311 by using RM5635 and RM5742, extracts DNA, amplifies PCR of SSR and performs electrophoretic analysis in the same way as (2), and obtains the single strains with recombination between molecular markers RM5635 and RM 5742. Combining the genotype of the recombinant single plant and the insect-resistant grade of the corresponding family to obtain the molecular marker co-separated from the major gene qBph4(t) for resisting brown planthopper.
The invention has the beneficial effects that:
1. the SSR molecular marker is used for the first time to finely position the brown planthopper resistant major gene qBph4(t) in the rice variety ARC 5984.
2. The main effect gene locus positioned by the molecular marker of the invention has definite position and convenient identification. Through detecting the molecular marker closely linked with the gene locus, the resistance of the rice plant to the brown planthopper can be predicted, and the method is used for detecting the genotype of the rice variety or variety to judge whether the variety or variety has the brown planthopper resistance, and further quickly screening the insect-resistant variety or variety for rice breeding. The detection is convenient and quick, and is not influenced by the environment.
3. The auxiliary breeding selection target is clear, and the cost is saved. In the traditional breeding method, parents with insect-resistant genes and cultivars are firstly collected to carry out a series of hybridization, and the rice cultivars are identified and selected for the brown planthopper resistance, so the operation is very complicated and is influenced by the environment. In addition, before insect-resistant identification, firstly, insect sources are obtained and bred to brown planthopper groups, and meanwhile, the insect sources are required to be inoculated and the seedling ages of rice seedlings are required to be synchronous, which brings troubles to breeding work, and if the relationship among the insect sources, the seedlings and the environment cannot be effectively processed, the reliability of the brown planthopper-resistant phenotype identification result is very low. Therefore, the insect-resistant breeding is time-consuming, difficult and high in cost. However, by detecting the major gene locus of the brown planthopper resistance, a single plant with high brown planthopper resistance can be identified in the seedling stage, other plants are eliminated, the production cost is saved, the selection efficiency of brown planthopper resistant rice is greatly improved, and the breeding period of rice varieties is greatly shortened.
Drawings
FIG. 1 shows the location of major gene qBph4(t) against Nilaparvata lugens in chromosome 4 of rice variety ARC 5984;
FIG. 2 shows the detection band pattern of the non-denaturing polyacrylamide gel electrophoresis of the amplified product of the molecular marker RM5635 in different rice materials.
Detailed Description
Example 1 acquisition of molecular markers
9311/ARC5984F2 population construction and phenotypic identification
(1) Early insect resistance identification experiments show that the farmer variety ARC5984 has high resistance to brown planthopper populations collected from rice fields in suburb southern nings. In order to search for simple and effective molecular markers which are closely linked with qBph4(t), the method takes an insect susceptible variety 9311 as a female parent and an anti-brown planthopper rice variety ARC5984 as a male parent for hybridization respectively, and obtained F1 is selfed again, so that an F2 segregating population is constructed; each F2 individual was selfed to obtain the corresponding F2:3 line.
(2) And (3) performing insect resistance identification on the parent and the F2:3 family by adopting seedling stage inoculation treatment. To ensure consistent growth of the parent and each family in the F2:3 population, all test materials were separately presoaked prior to sowing. 60 seeds of each family (variety) are sowed in an iron tray which is 45cm long, 35cm wide and 8cm high and is filled with nutrient soil 5cm thick. Each disc was seeded with 2 replicates per material, with 2 replicates each of the randomly seeded parent and TN1 (sensory control). Thinning seedlings after 7 days of sowing, and eliminating weak seedlings. When the seedlings grow to the stage of two leaves and one core, 2-3-year brown planthopper nymphs are inoculated according to the proportion of 8 heads per seedling, and finally, a nylon gauze is covered. When all of the insect-susceptible varieties TN1 died, the resistance evaluation of 0, 1, 3, 5, 7 or 9 grades was carried out for each individual by the method of Qia et al (Qiau et al, 2010high-resolution mapping of the brown planter resistance gene Bph6in rice and characteristics resistance in the 9311and Nipponbare near social background application. Theor application Gene 121:1601-1611), the resistance grade of the family was calculated by weighted average for each family of parent material and population, the above-mentioned resistance identification was repeated twice, and the average was taken as the resistance grade to estimate the genotype of the individual.
Table 1: grading standard for identifying brown planthopper resistance of rice
Molecular marker analysis of the (di) 9311/ARC5984F2 population
(1) Genomic DNA from leaves of each individual of the parent and F2 population was extracted by the CTAB method (Murray & Thompson, 1980Rapid isolation of high-molecular-weight plant DNA. nucleic Acids Res 8: 4321-4325).
(2) A certain number of molecular markers were selected according to the SSR markers published by the Gramene website (http:// www.gramene.org /) according to a more uniform genetic distance.
(3) The analysis of molecular markers was performed by the method of Qiongfu (Qiongfu, rice brown planthopper resistance gene mapping and genetic effect analysis, Wuhan university, doctor's paper). Reaction system components: DNA template 0.5. mu.l, primer 0.3. mu.l at 10. mu.M, dNTP0.2. mu.l at 10mM, PCR Buffer (Mg 2+) 1. mu.l, Taq DNA polymerase (5U/. mu.l) 0.1. mu.l, ddH2O to make up 10. mu.l. The length of the amplification product of the SSR primer used in the experiment is generally between 100-300bp, and the PCR reaction program is as follows: 94 ℃ for 4min, 94 ℃ for 30sec, 60 ℃ for 30sec, 72 ℃ for 45sec, 34 cycles, 72 ℃ for 10 min.
The conditions used for different primers may vary, mainly due to the different annealing temperatures, and sometimes it is necessary to adjust the appropriate annealing temperature for each pair of primers, and the specific temperature can be set by referring to the values published in the GRAMENE website and given by the primer design software.
The amplified products were separated on a 6% native PAGE gel and the amplified DNA bands were recorded by silver staining (Zhu et al,2004Identification and characterization of a new blast resistance gene located on rice chromosome 1through linkage and differential analysis. Phytopathy 94: 515) for example. Primers with polymorphisms between parents were analyzed in the F2 population to obtain population genotype data.
(4) According to the insect-resistant grade of the F2 individual plant, leaf genome DNAs of 10 extreme insect-resistant individual plants and 10 extreme susceptible individual plants are respectively selected to be mixed in equal amount to construct an anti-susceptible pool. Meanwhile, primers with polymorphism among parents are utilized to respectively screen anti-infection DNA pools and sense DNA pools and obtain molecular markers with polymorphism, and the polymorphism markers indicate that the molecular markers are probably linked with resistance. Then, based on the chromosome where the linkage marker is located, primers with polymorphisms between parents on the chromosome are selected to screen each individual of the F2 segregating population, and the PCR procedure is the same as above, to obtain population genotype data. According to the linkage exchange rule, the software JoinMap 3.0 is used for constructing a partial genetic map of the rice from the group genotype data and obtaining the genetic distance of each molecular marker. And finally, combining the molecular marker genotype data of each individual plant of the F2 population and the corresponding insect-resistant level identified by the resistance of the brown planthopper, and performing QTL locus scanning on the target chromosome by using a MapQTL 5.0 software composite interval mapping method.
(III) results and analysis
The seedling stage group method inoculation identification result shows that the average pest resistance grades of ARC5984 and ARC 9311 are 2.7 and 8.7 respectively, which shows that ARC5984 is highly resistant to brown planthopper and ARC 9311 is highly susceptible to brown planthopper. The average pest-resistant level frequency distribution of 230F 2:3 families on the brown planthopper is in a continuous distribution, the minimum value is 2.4, and the maximum value is 9.0. The family F2:3 is divided into three phenotypes, namely insect resistance, infection resistance separation and insect infection, according to the insect resistance level of the brown planthopper, and the genotypes of the corresponding F2 single plants are respectively marked as three phenotypes, namely RR (homozygous insect resistance), Rr (heterozygous insect resistance) and RR (homozygous insect infection). The isolation of the F2 population against brown planthopper corresponds to a ratio of 1:2: 1(χ c2 ═ 1.2 < χ 20.05,2 ═ 5.99) (table 2)
TABLE 29311/ARC 5984F2 segregation ratio of 230 strains of the population to Nilaparvata lugens resistant segregation
RR, homozygous insect-resistant; rr hybrid resistance to insects; rr, homozygous susceptible insects; 1RR:2RR:1RR suitability test value χ 2 ═ 1.00, χ 20.05,2 ═ 5.99; insect resistance grade value: RS, Resistance Score (insect-resistant grade)
The SSR markers with polymorphism among parents are used for analyzing the genotype of F2 single strains, and QTL scanning is carried out by combining the resistance values of the single strains.
As shown in figure 1, the major gene qBph4(t) of the rice variety ARC5984 resistant to brown planthopper is located on chromosome 4. The values in parentheses on the abscissa indicate the genetic distance (cM) between the markers, and the results indicated that a QTL site was present between the long arms RM5635 and RM5742 of chromosome 4, the LOD value was 59, and the resistance contribution rate was 72%. And (3) detecting the genotype of the recombinant single strain by using the SSR marker between the two markers, and finally positioning qBph4(t) between RM5635 and RM5742 by combining the insect-resistant identification result of the recombinant single strain. The genetic distance between RM5635 and RM5742 is only 6cm, so that the molecular marker has high efficiency in identifying the existence of qBph4(t) resistance gene, and the breeding progress of the brown planthopper resistant rice variety is greatly improved.
Example 2 validation of molecular markers
1. Materials and methods
1.1 materials
Negative varieties: 4 parts of pest-susceptible variety 9311, Nipponbare, Taizhonghai No. 1and white R54 which are conventional rice materials stored in the laboratory; the 9311 × ARC5984 cross combines 20 parts of insect-susceptible families in offspring.
Positive variety: the number of insect-resistant families in the filial combination offspring of the high insect-resistant varieties ARC5984 and 9311 × ARC5984 is 30.
Molecular marker primer: RM 5635; RM 5742; RM 5757.
1.2 methods
Extracting genome DNA of rice sample leaf by CTAB extraction method, amplifying the sample DNA by primer RM5635, separating the amplified product by 6% non-denaturing PAGE gel, and recording the amplified DNA band by silver staining and developing. (method same as example 1)
2. As a result:
the genomic DNAs of 54 different samples, such as rice variety 9311and ARC5984, were amplified by PCR using the above-described method. The results show that in the positive sample, 170bp fragments can be amplified by using the primer RM5635, 190bp fragments can be amplified by using the primer RM5742, or 180bp fragments can be amplified by using the primer RM5757, but in the negative sample, the fragments cannot be amplified. Therefore, the molecular marking method provided by the invention can accurately screen out the sample containing the brown planthopper resistant major gene, thereby greatly improving the selection efficiency of the insect-resistant rice material.
As shown in FIG. 2, a non-denaturing polyacrylamide gel electrophoresis detection strip pattern of an amplification product of a molecular marker RM5635 in different rice materials, wherein M is 2000bp marker, and one marker on the smallest surface is 100 bp; lanes 1-21 are 9311and ARC5984 hybrid progeny individuals. S1 is white R54 (negative variety); s2, 9311 (susceptible variety, negative variety); r is a high insect-resistant variety ARC5984 (positive variety); arrows indicate bands of differences between resistant and susceptible parents. A band of 170bp on the same horizontal line with the high insect-resistant variety ARC5984 (positive variety) R exists in the positive samples; and none of the bands were present in the negative samples.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Claims (3)
1. The application of the molecular marker of the major gene qBph4(t) for resisting brown planthopper in breeding brown planthopper-resistant rice is characterized in that the molecular marker is obtained by PCR amplification of one of the following primer pairs:
(1) the labeling primer RM5635 is used,
forward primer sequence: TCGCGTCGTAGCTGAACACTGC
Reverse primer sequence: TAGCTTGCTCTCCCTCTGCTTGC, respectively;
(2) the primer RM5742 is marked, and the primer RM5742,
forward primer sequence: GATCCTCAAACGGCCTCTGC
Reverse primer sequence: CCTTCAAAGTTTACTCACGCTCTGC, respectively;
(3) the primer RM5757 is marked, and the primer RM5757 is marked,
forward primer sequence: GCTGATGCGGAACAAGGAGACC the flow of the air in the air conditioner,
reverse primer sequence: GATCAGATCACCACCCGAATGAGC, respectively;
the amplification lengths of the marker primers (1) - (3) are 170bp, 190bp and 180bp respectively, and the high-susceptibility brown planthopper indica rice line 9311 is used as a female parent and the brown planthopper resistant variety ARC5984 is used as a male parent.
2. A method for screening brown planthopper resistant rice is characterized in that genomic DNA of leaf blades of rice to be detected is amplified by using one of the primer pairs in claim 1, and if a 170bp fragment can be amplified by using the primer RM5635, a 190bp fragment can be amplified by using the primer RM5742, or a 180bp fragment can be amplified by using the primer RM5757, the rice to be detected is marked as resistant rice carrying a brown planthopper resistant major gene qBph4 (t).
3. The method for screening brown planthopper-resistant rice as claimed in claim 2, wherein said PCR amplification reaction system comprises 10 μ L reaction system, 0.5 μ L DNA template, 0.3 μ L10 μ M primer, 0.2 μ L10 mM dNTP, 1 μ L10 XPCR Buffer, 0.1 μ L5U/. mu.l Taq DNA polymerase, and ddH2O to make up to 10 μ L; the PCR amplification procedure was: pre-denaturation at 94 ℃ for 4min, annealing at 94 ℃ for 30s, annealing at 62 ℃ for 30s, extension at 72 ℃ for 45s, 34 cycles, and extension at 72 ℃ for 10 min; wherein, the 10 XPCR Buffer contains Mg2+。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810072490.4A CN108165649B (en) | 2018-01-25 | 2018-01-25 | Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810072490.4A CN108165649B (en) | 2018-01-25 | 2018-01-25 | Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108165649A CN108165649A (en) | 2018-06-15 |
| CN108165649B true CN108165649B (en) | 2021-08-13 |
Family
ID=62515572
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810072490.4A Active CN108165649B (en) | 2018-01-25 | 2018-01-25 | Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108165649B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923356B (en) * | 2019-12-30 | 2022-08-12 | 广西大学 | Molecular marker primer of rice gall midge-resistant major gene Gm5, and marking method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012075125A1 (en) * | 2010-11-30 | 2012-06-07 | Syngenta Participations Ag | Methods for increasing genetic gain in a breeding population |
-
2018
- 2018-01-25 CN CN201810072490.4A patent/CN108165649B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012075125A1 (en) * | 2010-11-30 | 2012-06-07 | Syngenta Participations Ag | Methods for increasing genetic gain in a breeding population |
Non-Patent Citations (3)
| Title |
|---|
| "The map-based sequence of the rice genome";International Rice Genome Sequencing Project;《nature》;20050811;第436卷(第11期);补充材料表18 * |
| "普通野生稻转育后代稻褐飞虱抗性基因的初步定位";张志伟等;《华中农业大学学报》;20160331;第35卷(第2期);摘要，第11页右栏第3段 * |
| International Rice Genome Sequencing Project."The map-based sequence of the rice genome".《nature》.2005,第436卷(第11期),补充材料表18. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108165649A (en) | 2018-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102329743B1 (en) | Methods and compositions for peronospora resistance in spinach | |
| CN102181440B (en) | Molecular marker of brown planthopper-resistant major gene bph7 of rice and application thereof | |
| CN105087553B (en) | The molecular labeling of rice brown planthopper resistant QBph3 and QBph4 gene | |
| CA2684271A1 (en) | Methods and compositions for selecting soybean plants resistant to phytophthora root rot | |
| CN101914531A (en) | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof | |
| CN106811462B (en) | Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof | |
| CN113273489B (en) | Molecular marker-assisted breeding method for high-yield wheat with resistance to gibberellic disease | |
| WO2008003783A2 (en) | Resistance to powdery mildew and absence of necrosis in cucumis sativus | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN108165649B (en) | Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof | |
| KR20220007592A (en) | Powdery Mildew Resistant Capsicum Plants | |
| CN111034612A (en) | Breeding method of scab and clavispora leaf spot resistant dense thorn type cucumber hybrid | |
| Jayawardana et al. | Evaluation of DNA markers linked to blast resistant genes, Pikh, Pit (p), and Pita, for parental selection in Sri Lankan rice breeding | |
| AU2021102921A4 (en) | Molecular marker for rapidly detecting high-yield gene of elytrigia elongata and application | |
| JP2008237175A (en) | Creation method of blast neck rot resisting gramineae plant | |
| US11807863B2 (en) | Resistance to cucumber green mottle mosaic virus in Cucumis sativus | |
| CN109593880B (en) | Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof | |
| CN109486996B (en) | Recombinant nucleotide segment Rec78801 and Rec78802 and its detection primer and application | |
| CN107779522B (en) | Specific codominant molecular marker of brown planthopper resistant gene Bph15 of rice and application thereof | |
| CN104328168B (en) | Molecular marker of rice brown planthopper major gene qBph30(t) and application thereof | |
| CN111073990B (en) | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof | |
| CN110923356B (en) | Molecular marker primer of rice gall midge-resistant major gene Gm5, and marking method and application thereof | |
| Kumar et al. | Marker assisted introgression of broad-spectrum blast resistance gene Pi2 into an elite rice cultivar, Samba Mahsuri | |
| US10662486B2 (en) | Molecular markers associated with soybean tolerance to low iron growth conditions | |
| US20230193310A1 (en) | Lettuce plants having resistance to downy mildew |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |