CN109593880B - Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof - Google Patents

Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof Download PDF

Info

Publication number
CN109593880B
CN109593880B CN201910117975.5A CN201910117975A CN109593880B CN 109593880 B CN109593880 B CN 109593880B CN 201910117975 A CN201910117975 A CN 201910117975A CN 109593880 B CN109593880 B CN 109593880B
Authority
CN
China
Prior art keywords
seq
molecular marker
primer
rice
sogatella furcifera
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910117975.5A
Other languages
Chinese (zh)
Other versions
CN109593880A (en
Inventor
万建民
刘裕强
范德佳
杨明
江玲
刘世家
何俊
王益华
赵志刚
张文伟
陈亮明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201910117975.5A priority Critical patent/CN109593880B/en
Publication of CN109593880A publication Critical patent/CN109593880A/en
Application granted granted Critical
Publication of CN109593880B publication Critical patent/CN109593880B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a molecular marking method of a rice variety anti-sogatella furcifera gene qWBPH3.2, which comprises the following steps of using a molecular marking C3-2122 primer: SEQ ID NO.1/SEQ ID NO.2 or with the molecular marker C3-2233 primer: SEQ ID NO.3/SEQ ID NO.4 or with the molecular marker C3-W2 primer: SEQ ID NO.5/SEQ ID NO.6 or with the molecular marker C3-W4 primer: the DNA of the rice or breeding material is amplified by SEQ ID NO.7/SEQ ID NO.8, if a molecular marker C3-2122 primer can amplify a 202bp amplified fragment, or a molecular marker C3-2233 primer can amplify a 229bp amplified fragment, or a molecular marker C3-W2 primer amplifies an 866bp fragment which can be cut into two fragments of 268bp and 598bp by restriction endonuclease Hap II, or a molecular marker C3-W4 primer amplifies an 954bp fragment which can be cut into two fragments of 264bp and 690bp by restriction endonuclease HindIII, the existence of the gene qWBPH3.2 resisting the Nilaparvata albidus of the rice variety is marked. The method can predict the resistance level of the rice to the sogatella furcifera and greatly improve the selection efficiency of the anti-sogatella furcifera strain in breeding.

Description

Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof
Technical Field
The invention belongs to the field of molecular genetics, and particularly relates to a molecular marker of a rice anti-sogatella furcifera gene qWBPH3.2 and application thereof.
Background
Rice is one of the most important grain crops in the world, and the continuous and stable increase of the rice yield is an important guarantee for the grain safety in the world. However, rice production is threatened by various pests and diseases, wherein the sogatella furcifera is a homoptera plant hopper pest which is seasonally migratory in flight, mainly gathers in the lower part of a rice plant, and damages rice by piercing and absorbing phloem nutrient substances. In severe cases, the basal tissues of rice are necrotized, plants are lodging and withered, and the yield is seriously damaged. The sogatella furcifera not only can damage rice plants by directly eating and spawning to cause mechanical damage to the plants, but also can be a main propagation medium of virus diseases such as southern rice black-streaked dwarf virus and the like, thereby causing serious threat to the rice. People have long relied on pesticides to control the white flies. However, excessive use of agricultural chemicals not only causes environmental pollution and kills natural enemies, but also causes the formation of resistance to pests, which reduces the efficiency of agricultural chemicals, increases the amount of agricultural chemicals used, and forms a vicious circle.
The popularization and application of the rice variety resisting the sogatella furcifera is one of the most effective measures for comprehensively treating the insect, can inhibit the growth, development and propagation of the insect and does not increase the production cost of farmers. On the basis of screening of sogatella furcifera resistance sources, researchers obtain certain achievements in the aspects of breeding new rice varieties, rice pest resistance mechanisms and the like, and identify some sogatella furcifera resistant genes/QTLs.
The international rice institute and other domestic and foreign research institutions have conducted screening of the resistant source of sogatella furcifera from the 70 s of the 20 th century. Through a large amount of screening work, researchers have found and named 15 genes from tens of thousands of rice germplasm resources (Wbph1, Wbph2, Wbph3, Wbph4, Wbph5, Wbph6, Wbph7(t), Wbph8(t), WbphM1, WbphM2, WbphAR, WbphN, WbphO, Ovc, qWL 6). Only 7 of these genes are located on the chromosome by marker linkage. Based on the resistance source screening of sogatella furcifera, resistance breeding research is developed by breeding experts, and a batch of new rice varieties which resist the sogatella furcifera and resist various plant diseases and insect pests are cultivated by means of genetic improvement, thereby playing an important role in promoting the sustainable development of rice production. However, due to the high reproduction rate of sogatella furcifera and the rapid population evolution caused by the selective pressure of the environment, breeding practice needs to continuously discover new resistance sources for resisting sogatella furcifera and breed new and updated resistant varieties.
Gene polymerization breeding by using a molecular marker-assisted selection technology becomes an important way for obtaining lasting resistance of crops. Molecular markers closely linked to resistance traits are a prerequisite for molecular marker assisted selection and aggregation of multiple genes. The application of molecular markers in rice breeding for selection has the advantages of high specificity, economy, high efficiency and short period, and is not influenced by gene expression difference and environmental condition diversity. Therefore, on the basis of finding out the molecular marker which is closely linked or coseparated with the insect-resistant gene, the polymerization of the insect-resistant gene or QTL can be purposefully carried out by means of the molecular marker auxiliary selection technology, and the durable resistant variety can be bred.
Disclosure of Invention
The invention aims to provide a molecular marker of a rice variety IR54751 anti-sogatella furcifera gene qWBPH3.2 and application thereof, and the molecular marker linked with the anti-sogatella furcifera gene is detected, so that the sogatella furcifera resistance of a rice plant can be predicted, and the breeding progress of the anti-sogatella furcifera rice variety is accelerated.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
the invention provides a molecular marking method of rice anti-sogatella furcifera gene qWBPH3.2, which comprises the following steps of using molecular marking C3-2122 primers: SEQ ID NO.1/SEQ ID NO.2 or with the molecular marker C3-2233 primer: SEQ ID NO.3/SEQ ID NO.4 or with the molecular marker C3-W2 primer: SEQ ID NO.5/SEQ ID NO.6 or with the molecular marker C3-W4 primer: the DNA of the rice or breeding material is amplified by SEQ ID NO.7/SEQ ID NO.8, if a 202bp amplified fragment can be amplified by using a molecular marker C3-2122 primer, or a 229bp amplified fragment can be amplified by using a molecular marker C3-2233 primer, or a 866bp fragment amplified by using a molecular marker C3-W2 primer can be cut into two fragments of 268bp and 598bp by restriction endonuclease Hap II, or a 954bp fragment amplified by using a molecular marker C3-W4 primer can be cut into two fragments of 264bp and 690bp by using restriction endonuclease HindIII, the existence of the gene qWBPH3.2 for resisting the white-backed planthopper of the rice variety is marked.
The invention also provides a molecular marker C3-2122 primer of the sogatella furcifera gene qWBPH3.2, which comprises the following steps:
front primer sequence CACGGGAAGGAGAGGAAGAG (shown as SEQ ID NO. 1)
The rear primer sequence AGGAGTTTGGCAAGTCATTTGG (shown as SEQ ID NO. 2).
The invention also provides a molecular marker C3-2233 primer of the sogatella furcifera resistant gene qWBPH3.2, which comprises the following components in percentage by weight:
front primer sequence AGGTACTTGCTTCTACTTCAC (shown as SEQ ID NO. 3)
The rear primer sequence GTACACAAATCTAGGTGATCCA (shown in SEQ ID NO. 4).
The invention also provides a molecular marker C3-W2 primer of the sogatella furcifera resistant gene qWBPH3.2:
front primer sequence GTGTGGATGATAAGCGGGTG (shown as SEQ ID NO. 5)
The rear primer sequence GGTGAGGGAGGGAAAGAAGAG (shown in SEQ ID NO. 6).
The invention also provides a molecular marker C3-W4 primer of the sogatella furcifera resistant gene qWBPH3.2:
front primer sequence ACTTCTTTGTTTGTATCGGGAG (shown as SEQ ID NO. 7)
The rear primer sequence CCACCAACTATGATTAGCGT (shown in SEQ ID NO. 8).
The invention also provides a molecular marking method of the sogatella furcifera resistant gene qWBPH3.2, and application of the molecular marker C3-2122, the molecular marker C3-2233, the molecular marker C3-W2 or the molecular marker C3-W4 in rice breeding.
The invention also provides a molecular marker method of the sogatella furcifera resistant gene qWBPH3.2, and application of the molecular marker C3-2122, the molecular marker C3-2233, the molecular marker C3-W2 or the molecular marker C3-W4 in identification of plant varieties or strains resistant to sogatella furcifera.
The invention relates to an application of identifying plant varieties or strains resisting sogatella furcifera, in particular to a method for identifying the plant varieties or strains resisting sogatella furcifera by using molecular marker C3-2122 primers: SEQ ID NO.1/SEQ ID NO.2 or with the molecular marker C3-2233 primer: SEQ ID NO.3/SEQ ID NO.4 or with the molecular marker C3-W2 primer: SEQ ID NO.5/SEQ ID NO.6 or with the molecular marker C3-W4 primer: the DNA of the rice or breeding material is amplified by SEQ ID NO.7/SEQ ID NO.8, if a 202bp amplified fragment can be amplified by using a molecular marker C3-2122 primer, or a 229bp amplified fragment can be amplified by using a molecular marker C3-2233 primer, or a 866bp fragment amplified by using a molecular marker C3-W2 primer can be cut into two fragments of 268bp and 598bp by restriction endonuclease hapII, or a 954bp fragment amplified by using a molecular marker C3-W4 primer can be cut into two fragments of 264bp and 690bp by using restriction endonuclease HindIII, the rice or the breeding material to be identified is marked to be a white-backed planthopper resistant variety or strain.
The invention also provides a molecular marker method of the sogatella furcifera resistant gene qWBPH3.2, and application of the molecular marker C3-2122, the molecular marker C3-2233, the molecular marker C3-W2 or the molecular marker C3-W4 in screening plant varieties or strains resistant to sogatella furcifera.
The application of screening plant varieties or strains resisting sogatella furcifera is realized by using molecular marker C3-2122 primers: SEQ ID NO.1/SEQ ID NO.2 or with the molecular marker C3-2233 primer: SEQ ID NO.3/SEQ ID NO.4 or with the molecular marker C3-W2 primer: SEQ ID NO.5/SEQ ID NO.6 or with the molecular marker C3-W4 primer: the DNA of the rice or breeding material is amplified by SEQ ID NO.7/SEQ ID NO.8, if a molecular marker C3-2122 primer can amplify a 202bp amplified fragment, or a molecular marker C3-2233 primer can amplify a 229bp amplified fragment, or a molecular marker C3-W2 primer amplifies an 866bp fragment which can be cut into two fragments of 268bp and 598bp by restriction endonuclease Hap II, or a molecular marker C3-W4 primer amplifies an 954bp fragment which can be cut into two fragments of 264bp and 690bp by restriction endonuclease HindIII, the rice or breeding material to be screened is marked to be a white-backed planthopper resistant variety or strain.
The molecular marker of the sogatella furcifera resistant gene qWBPH3.2 and the application thereof can be suitable for all progeny strains of rice varieties IR 54751.
The molecular marker of the rice variety sogatella furcifera resistant gene qWBPH3.2 and the application thereof provided by the invention have the following advantages:
1) the qWBPH3.2 gene positioned by the molecular marker provided by the invention has definite position and convenient identification. By detecting the molecular markers linked with the gene for resisting sogatella furcifera, the sogatella furcifera resistance of the rice plant can be predicted; the genotype detection of the rice variety or strain can be carried out, whether the variety or strain has the resistance of sogatella furcifera can be judged, and then the insect-resistant variety or strain is rapidly screened for rice breeding. The detection of the gene locus is convenient and quick and is not influenced by the environment;
2) the auxiliary breeding selection target is clear, and the cost is saved. In a traditional breeding method, parents with insect-resistant genes are first collected and crossed with cultivars in a series, and the resistance to white-backed flies is selected individually. The phenotype identification of the rice anti-sogatella furcifera is complex, and the reliability of the phenotype identification result is low. By detecting the gene locus for resisting sogatella furcifera, the single plant resisting sogatella furcifera can be identified in the seedling stage, other plants are eliminated, the production cost is saved, and the selection efficiency of the material for resisting sogatella furcifera is greatly improved.
Drawings
Figure 1 location of the gene qwbph3.2 against sogatella furcifera on chromosome.
FIG. 2 Individual selection was performed using the qWBPH3.2 locus closely linked molecular marker C3-2122. M is Marker; p1 is an insect-resistant parent IR 54751; p2 is a susceptible insect parent 02428; 1-5 is an insect-resistant single plant; 6-10 is a susceptible single plant; 11-16 are anti-single plants.
FIG. 3 Individual selection using the qWBPH3.2 locus closely linked molecular marker C3-2233. M is Marker; p1 is an insect-resistant parent IR 54751; p2 is a susceptible insect parent 02428; 1-5 is an insect-resistant single plant; 6-10 is a susceptible single plant; 11-16 are anti-single plants.
FIG. 4 Individual selection was performed using the qWBPH3.2 locus closely linked molecular markers C3-W2. M is Marker; p1 is an insect-resistant parent IR 54751; p2 is a susceptible insect parent 02428; 1 and 2 are insect-resistant single plants; 3-5 is an anti-single plant; 6 and 7 are susceptible individuals.
FIG. 5 Individual selection was performed using the qWBPH3.2 locus closely linked molecular markers C3-W4. M is Marker; p1 is an insect-resistant parent IR 54751; p2 is a susceptible insect parent 02428; 1 and 2 are insect-resistant single plants; 3-5 is an anti-single plant; 6 and 7 are susceptible individuals.
Detailed Description
The invention will be better understood from the following examples. However, the examples are described only for illustrating the present invention and should not be construed as limiting the invention described in detail in the claims.
The test methods in the following examples are conventional methods unless otherwise specified. The test materials and reagents used in the following examples were purchased from conventional biochemical reagents, unless otherwise specified.
Example 1
R54751/02428F2Population construction and phenotypic identification
The rice variety IR54751 is high in resistance to sogatella furcifera and the rice variety 02428 is high in sensitivity to sogatella furcifera, and the two varieties are used as male parent and female parent respectively and hybridized to produce F1，F1Selfing to produce F2And (4) a group. Due to the size limitation of artificial indoor insect identification, 118F were selected in this study2Selfing the single plant after planting to obtain F2:3Family members. The resistance grade of sogatella furcifera is identified by a seedling stage group identification method for each family, and the process is repeated for 3 times.
The evaluation of the anti-sogatella furcifera phenotype at the rice seedling stage adopts an improved standard seedling stage group identification method. 3 times of each family, 30-35 seeds are repeated, the seeds exposed to the white are sown in plastic round bowls with the diameter of 8cm and filled with nutrient soil after seed soaking and germination accelerating, and the seeds are randomly distributed in a turnover box. When the seedlings grow to the stage of one leaf and one heart (about one week after sowing), weak seedlings and young seedlings are eliminated to ensure the consistency of the seedlings for the test. Inoculating 20 heads of the two-year, three-year old nymphs of the Sogatella furcifera per plant, and counting the death rate of each variety (family) after the pest control 02428 is completely dead. The resistance rating of the test material was assessed by reference to the IRRI criteria (table 1).
TABLE 1 evaluation criteria for resistance to Sogatella furcifera at seedling stage of International Rice institute
Figure BDA0001970875970000051
(II) IR54751/02428F2Molecular marker analysis of populations
The total DNA of the selected individual plant is extracted as a template, and the specific method is as follows:
firstly, taking about 0.2g of young and tender rice leaves, placing the young and tender rice leaves in a 2mL Eppendorf tube, placing a steel ball in the tube, freezing the Eppendorf tube filled with the sample in liquid nitrogen for 5min, and placing the tube on a 2000 model GENO/GRINDER instrument to crush the sample for 1 min.
② adding 600 μ L CTAB solution (containing 100mM Tris-HCl (pH 8.0), 20mM EDTA (pH 8.0), 1.4M NaCl,0.2g/ml CTAB), water bathing at 65 ℃ for 30min, shaking once every 5 min.
③ 600. mu.L of chloroform isoamyl alcohol (V: V ═ 24:1) was added thereto, and the mixture was inverted 4 to 5 times.
Fourthly, placing the EP tube into a centrifuge, and centrifuging for 5min at 12000 rpm.
Fifthly, sucking 200 mu L of supernatant into a 1.5mL EP tube, adding 0.6 times of isopropanol, slightly reversing and uniformly mixing, and placing the sample in a refrigerator at the temperature of-20 ℃ for 30 min.
Sixthly, centrifuging at 12000rpm for 5min, collecting the precipitate, and slowly pouring out the supernatant.
Seventhly, 300 mu L of 70% ethanol is added into the EP tube with the sediment, the sediment is washed for 5min, the mixture is centrifuged at 12000rpm for 5min, and the supernatant is carefully removed.
Drying the precipitate on an ultra-clean workbench, adding 200 mu L of TE solution, and storing the solution serving as mother solution in a refrigerator at the temperature of-20 ℃.
The method of SSR marker analysis is as follows:
diluting the extracted DNA to about 20 ng/. mu.L, and performing PCR amplification as a template;
PCR reaction (10. mu.L): 1. mu.L of DNA (20 ng/. mu.L), 1. mu.L of upstream primer (2 pmol/. mu.L), 1. mu.L of downstream primer (2 pmol/. mu.L), 10xBuffer (MgCl)2Plus)1μL，dNTP(10mM)0.2μL，rTaq(5U/μL)0.1μL，ddH2O5.7. mu.L, 10. mu.L total.
PCR reaction procedure: denaturation at 94.0 deg.C for 5 min; denaturation at 94.0 deg.C for 30S, annealing at 55 deg.C for 30S, and extension at 72 deg.C for 40S, and circulating for 35 times; extending for 10min at 72 ℃; storing at 10 deg.C. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler.
And (3) detecting a PCR product: and analyzing the amplification product by 8% non-denaturing polyacrylamide gel electrophoresis, and comparing the molecular weight of the amplification product by taking DNA marker I as a control, wherein silver staining is performed for color development. The amplified DNA bands were observed using a light box and the results were recorded.
The method of CAPS marker analysis is as follows:
diluting the extracted DNA to about 20 ng/. mu.L, and performing PCR amplification as a template;
PCR reaction (30. mu.L): 3 μ L of DNA (20 ng/. mu.L), 3 μ L of forward primer (2 pmol/. mu.L), 3 μ L of reverse primer (2 pmol/. mu.L), 10xBuffer (MgCl)2Plus)3μL，dNTP(10mM)0.5μL，，rTaq(5U/μL)0.3μL，ddH2O17.2. mu.L, 30. mu.L total.
PCR reaction procedure: denaturation at 94.0 deg.C for 5 min; denaturation at 94.0 deg.C for 30S, annealing at 55 deg.C for 30S, and extension at 72 deg.C for 1min, and circulating for 35 times; extending for 10min at 72 ℃; storing at 10 deg.C. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler.
And (3) PCR product purification: sucking 30 mu L of PCR product into a 1.5mL centrifuge tube, adding 3 mu L of 3mol/L sodium acetate and 20 mu L isopropanol, standing at room temperature for 30min, 12000r/min, centrifuging at 4 ℃ for 20min, discarding supernatant, washing with 70% precooled ethanol, and naturally drying.
And (3) enzyme digestion reaction: the method is carried out in a 10 mu L reaction system which comprises 1 mu L10 Xenzyme digestion buffer solution and 4U restriction enzyme Hap II or Hind III, the purified PCR product is supplemented to 10 mu L with sterile water, and enzymolysis is carried out for 2h at 37 ℃.
PCR and enzyme digestion product detection: the amplified or digested products were analyzed by 1% agarose gel electrophoresis using DL2000DNA Marker for molecular weight comparison of molecular products. The PCR or cleavage products were stained with ethidium bromide and the results were examined in a GelDoc gel imaging System (Bio-Rad).
(III) results and analysis:
IR54751/02428F constructed by QTL IciMapping 4.1 software2Genetic map of chromosome 3 of population, combining 118F2:3Pedigree phenotype, a sogatella furcifera resistant QTL is detected on No.3 chromosome of rice and is named as qWBPH3.2. The LOD value of the QTL is 10.3, and the contribution rate is 23.3%.
For fine positioning of the QTL, two primers C3-1856 and C3-2265 on both sides of the QTL are used for pairing BC1F2742 individual plants and BC in the population2F21178 individuals from the population were genotyped and a total of 74 crossover individuals were screened. The 74 crossover individuals were identified for resistance to sogatella furcifera by seedling stage group identification, and the phenotype of the crossover individual was verified by identifying the progeny segregating families of the crossover individual. In addition, 12 InDel markers polymorphic between IR54751 and 02428 were developed based on the sequences of Nipponbare (Nipponbare) and 93-11, and qWBPH3.2 was located between the third chromosomal long-arm molecular markers C3-2122 and C3-2233, as shown in FIG. 1.
The molecular markers C3-2122 and C3-2233 are closely linked to qWBPH3.2, and the band patterns of the two markers are shown in FIGS. 2 and 3. To further improve the selection efficiency, we designed two CAPS markers co-separated with qwbph3.2, namely C3-W2 and C3-W4, whose band patterns are shown in fig. 4 and 5. To verify the selection efficiency of the molecular markers of the invention, we used C3-2122, C3-2233, C3-W2 and C3-W4 to select from 127 IR54751/02428F2:3Screening 15 families containing qWBPH3.2 and 15 families without the gene in the population for white bloodThe detection result of the resistance of the bemisia tabaci shows that the average seedling death rate of the family containing qWBPH3.2 is 15.59%, the average seedling death rate of the family not containing the gene is 82.10%, and the two have very significant difference (P)<0.01), showing that the markers can accurately screen the rice variety or family containing the gene qWBPH3.2 resisting the sogatella furcifera.
Molecular marker C3-2122 primer:
front primer sequence CACGGGAAGGAGAGGAAGAG (shown as SEQ ID NO. 1)
The rear primer sequence AGGAGTTTGGCAAGTCATTTGG (shown as SEQ ID NO. 2).
Molecular marker C3-2233 primer:
front primer sequence AGGTACTTGCTTCTACTTCAC (shown as SEQ ID NO. 3)
The rear primer sequence GTACACAAATCTAGGTGATCCA (shown in SEQ ID NO. 4).
Molecular marker C3-W2 primer:
front primer sequence GTGTGGATGATAAGCGGGTG (shown as SEQ ID NO. 5)
The rear primer sequence GGTGAGGGAGGGAAAGAAGAG (shown in SEQ ID NO. 6).
Molecular marker C3-W4 primer:
front primer sequence ACTTCTTTGTTTGTATCGGGAG (shown as SEQ ID NO. 7)
The rear primer sequence CCACCAACTATGATTAGCGT (shown in SEQ ID NO. 8).
Using molecular marker C3-2122 primer: SEQ ID NO.1/SEQ ID NO.2 or with the molecular marker C3-2233 primer: SEQ ID NO.3/SEQ ID NO.4 or with the molecular marker C3-W2 primer: SEQ ID NO.5/SEQ ID NO.6 or with the molecular marker C3-W4 primer: the DNA of the rice or breeding material is amplified by SEQ ID NO.7/SEQ ID NO.8, if a 202bp amplified fragment can be amplified by using a molecular marker C3-2122 primer, or a 229bp amplified fragment can be amplified by using a molecular marker C3-2233 primer, or a 866bp fragment amplified by using a molecular marker C3-W2 primer can be cut into two fragments of 268bp and 598bp by restriction endonuclease hapII, or a 954bp fragment amplified by using a molecular marker C3-W4 primer can be cut into two fragments of 264bp and 690bp by using restriction endonuclease HindIII, the rice or the breeding material to be identified is marked to be a white-backed planthopper resistant variety or strain.
The gene qWBPH3.2 resisting the sogatella furcifera and the development of the linked molecular marker thereof identified by the invention can be used for guiding the breeding work of rice varieties resisting the sogatella furcifera, and the molecular marker linked with the gene is used for screening insect-resistant varieties, so that different insect-resistant main gene loci can be rapidly aggregated in the same plant, thereby greatly improving the breeding efficiency.
Sequence listing
<110> Nanjing university of agriculture
<120> molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cacgggaagg agaggaagag 20
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aggagtttgg caagtcattt gg 22
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aggtacttgc ttctacttca c 21
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gtacacaaat ctaggtgatc ca 22
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gtgtggatga taagcgggtg 20
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggtgagggag ggaaagaaga g 21
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
acttctttgt ttgtatcggg ag 22
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ccaccaacta tgattagcgt 20

Claims (3)

1. A method for breeding rice, which is characterized in that a molecular marker C3-2122 primer: SEQ ID No.1 and SEQ ID No.2 or with the molecular marker C3-2233 primer: SEQ ID NO.3 and SEQ ID NO.4 or with the molecular marker C3-W2 primer: SEQ ID NO.5 and SEQ ID NO.6 or with the molecular marker C3-W4 primer: the DNA of the rice breeding material is amplified by SEQ ID NO.7 and SEQ ID NO.8, if the molecular marker C3-2122 primer can amplify a 202bp amplified fragment, or the molecular marker C3-2233 primer can amplify a 229bp amplified fragment, or the molecular marker C3-W2 primer can amplify a 866bp fragment which is cut into two fragments of 268bp and 598bp by restriction endonuclease Hap II, or the molecular marker C3-W4 primer can amplify a 954bp fragment which is cut into two fragments of 264bp and 690bp by restriction endonuclease HindIII, the DNA marks the rice variety anti-white-back planthopper geneqWBPH3.2Is present.
2. A method for identifying a plant variety or line resistant to sogatella furcifera, characterized in that the molecular marker C3-2122 primer: SEQ ID No.1 and SEQ ID No.2 or with the molecular marker C3-2233 primer: SEQ ID NO.3 and SEQ ID NO.4 or with the molecular marker C3-W2 primer: SEQ ID NO.5 and SEQ ID NO.6 or with the molecular marker C3-W4 primer: the DNA of the rice breeding material is amplified by SEQ ID NO.7 and SEQ ID NO.8, if a molecular marker C3-2122 primer can amplify a 202bp amplified fragment, or a molecular marker C3-2233 primer can amplify a 229bp amplified fragment, or a molecular marker C3-W2 primer amplifies an 866bp fragment which can be cut into two fragments of 268bp and 598bp by restriction endonuclease Hap II, or a molecular marker C3-W4 primer amplifies an 954bp fragment which can be cut into two fragments of 264bp and 690bp by restriction endonuclease HindIII, the rice breeding material to be identified is marked to be a white-backed planthopper resistant variety or strain.
3. A method for screening plant varieties or lines resistant to sogatella furcifera is characterized in that a molecular marker C3-2122 primer is used for: SEQ ID No.1 and SEQ ID No.2 or with the molecular marker C3-2233 primer: SEQ ID NO.3 and SEQ ID NO.4 or with the molecular marker C3-W2 primer: SEQ ID NO.5 and SEQ ID NO.6 or with the molecular marker C3-W4 primer: the DNA of the rice breeding material is amplified by SEQ ID NO.7 and SEQ ID NO.8, if a molecular marker C3-2122 primer can amplify a 202bp amplified fragment, or a molecular marker C3-2233 primer can amplify a 229bp amplified fragment, or a molecular marker C3-W2 primer amplifies an 866bp fragment which can be cut into two fragments of 268bp and 598bp by restriction endonuclease Hap II, or a molecular marker C3-W4 primer amplifies an 954bp fragment which can be cut into two fragments of 264bp and 690bp by restriction endonuclease HindIII, the rice breeding material to be screened is marked to be a white-backed planthopper resistant variety or strain.
CN201910117975.5A 2019-02-15 2019-02-15 Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof Active CN109593880B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910117975.5A CN109593880B (en) 2019-02-15 2019-02-15 Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910117975.5A CN109593880B (en) 2019-02-15 2019-02-15 Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof

Publications (2)

Publication Number Publication Date
CN109593880A CN109593880A (en) 2019-04-09
CN109593880B true CN109593880B (en) 2021-09-14

Family

ID=65967429

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910117975.5A Active CN109593880B (en) 2019-02-15 2019-02-15 Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof

Country Status (1)

Country Link
CN (1) CN109593880B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112375840B (en) * 2020-12-09 2023-04-18 浙江师范大学 Major QTL for regulating and controlling resistance of rice sogatella furcifera, molecular marker and application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Current Rice Genome Pseudomolecules Release;MSU Rice Genome Annotation Project Team;《Rice Genome Annotation Project》;20111031;1-2 *
identification and fine mapping of qWBPH11 conferring resistance to whitebacked planthopper（Sogatella furcifera Horvath）in rice （Oryza sativa L.）;fan dj等;《molecular breeding》;20180731;第38卷;第96篇，1-9 *
Quantitative trait loci identification, fine mapping and gene expression profiling for ovicidal response to whitebacked planthopper (Sogatella furcifera Horvath) in rice (Oryza sativa L.);YANG YL等;《BMC plant biology》;20141231;第14卷;第145篇，1-16 *
Sogawa K等.Prevalence of whitebacked planthoppers in Chinese hybrid rice and whitebacked planthopper resistance in Chinese japonica rice. In: Heong KL, Hardy B (eds) Planthoppers: new threats to the sustainability of intensive rice production systems in Asia.《International Rice Research Institute, Los Baños》.2009,257–280. *

Also Published As

Publication number Publication date
CN109593880A (en) 2019-04-09

Similar Documents

Publication Publication Date Title
Yang et al. Resistance in Lycopersicon esculentum intraspecific crosses to race T1 strains of Xanthomonas campestris pv. vesicatoria causing bacterial spot of tomato
KR101360811B1 (en) Improved pepper plant
Ji et al. Pyramiding blast, bacterial blight and brown planthopper resistance genes in rice restorer lines
US20220087187A1 (en) Methods for Producing Corn Plants with Northern Leaf Blight Resistance and Compositions Thereof
CN110777214B (en) SSR (simple sequence repeat) marker closely linked with corn seed storage resistance and application thereof in molecular marker-assisted breeding
Kubo et al. Effect of cleistogamy on Fusarium head blight resistance in wheat
Kumar et al. Introgression of durable blast resistance gene Pi-54 into indica rice cv. samba mahsuri, through Marker Assisted Backcross Breeding
CN109593880B (en) Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof
CN110512021B (en) Molecular marker closely linked with wheat stem basal rot resistance QTL and application thereof
Kumar et al. Marker-assisted introgression of Pi-1 gene conferring resistance to rice blast pathogen pyricularia oryzae in the background of Samba Mahsuri
CN111621589B (en) Molecular marker of brown planthopper resistant gene qBPH6 of rice and application thereof
CN111034612A (en) Breeding method of scab and clavispora leaf spot resistant dense thorn type cucumber hybrid
CN111073991A (en) Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application
CN114277175B (en) Rapid and efficient wheat scab-resistant molecular design breeding method
CN108165649B (en) Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof
Priya et al. Identification of the RAPD marker linked to powdery mildew resistant gene (s) in black gram by using bulk segregant analysis
CN107779522B (en) Specific codominant molecular marker of brown planthopper resistant gene Bph15 of rice and application thereof
Asare et al. Identification of New Sources of Rust Resistance in Cowpea (Vigna Unguiculata L. Walp) Germplasm Using Simple Sequence Repeat Markers
CN104328168B (en) Molecular marker of rice brown planthopper major gene qBph30(t) and application thereof
Suleimanova et al. Molecular screening for Fusarium oxysporum resistance genes in chickpea
CN114931092B (en) Wheat scab resistant molecular breeding method capable of polymerizing multiple traits and facilitating allelic variation
CN111073990B (en) Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof
Kiran et al. Introgression of Pi 54 gene through marker assisted backcross breeding for development of blast resistant genetic stocks in rice
CN117187427A (en) Molecular marker of rice anti-Laodelphax striatellus gene qSBPH6 and application thereof
CN109338005B (en) High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant