CN111073990B - Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof - Google Patents
Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof Download PDFInfo
- Publication number
- CN111073990B CN111073990B CN201910680019.8A CN201910680019A CN111073990B CN 111073990 B CN111073990 B CN 111073990B CN 201910680019 A CN201910680019 A CN 201910680019A CN 111073990 B CN111073990 B CN 111073990B
- Authority
- CN
- China
- Prior art keywords
- rice
- rice blast
- resistance gene
- blast resistance
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the field of crop molecular genetic breeding, and particularly relates to a dominant molecular marker of a rice blast resistance gene Pi67(t) and application thereof. The molecular marker is characterized in that a 141bp insertion exists in a positioning region of a rice blast resistance gene Pi67(t), and the nucleotide sequence is shown as SEQID NO. 1. By detecting the molecular marker, the invention can accurately judge whether the rice sample to be detected carries the rice blast resistance gene Pi67(t), and accelerate the breeding process of rice blast resistance rice varieties.
Description
Technical Field
The invention belongs to the field of crop molecular genetic breeding, and particularly relates to a dominant molecular marker of a rice blast resistance gene Pi67(t) and application thereof.
Background
The rice blast (Pyricularia grisea cav.) is a rice disease caused by Magnaporthe oryzae (Magnaporthe oryzae; vegetative form: Pyricularia) and has a wide distribution range. According to statistics, more than 80 countries occur all over the world, the general popular year can cause 10% -20% of yield reduction, and the serious occurrence reaches 40% -50%. Since the 90 s in the 20 th century, the annual area of rice blast in China is over 380 ten thousand hm2, and the rice loss reaches hundreds of millions of kilograms each year. With the simplification and centralization of variety application and the influence of climate, the damage of rice blast is more and more serious. Although people consume huge energy and material investment in disease control, the disease prevention effect is not satisfactory all the time due to the influence of many factors, and particularly in severe disease-causing years, the production and breeding are often seriously lost. Taking Liaoning province as an example, from the 90 s of the 20 th century, the large-area occurrence of neck blast caused by the disease resistance degradation of several main cultivars including Liaojing 287, Liaosalin 241, Liaojing 454 and Liaoxing 1 has respectively occurred, and the production of northern japonica rice is seriously influenced. The fundamental reason for this phenomenon is that the main cultivar has a narrow spectrum of resistance to rice blast fungi, and the phenomenon of single and centralized planting is common, so that the cultivar's resistance to rice blast is rapidly reduced once the species of rice blast fungi have changed. Therefore, it is especially necessary to breed rice varieties with polygenes or broad-spectrum resistance.
At present, in the process of breeding rice blast resistant varieties, breeders mainly adopt a pedigree method or combine molecular markers to assist in selecting disease resistant individuals. The traditional pedigree method selects and breeds preferentially from separated offspring through double basic combination, the plague-resistant phenotype depends on field natural identification or artificial inoculation identification, the identification difficulty is high, and the accuracy is low. Because the anti-plague genotypes of the parents are not known, a breeder is blindly in parent selection, usually, the breeding is matched in a large amount, offspring is selected in a large amount, the workload is large, and the breeding efficiency is low. When the molecular marker assisted selection is used for breeding for disease resistance, most SSR markers linked with disease resistance genes are selected, so that false positive judgment is easy to cause, and if coseparation markers of different genes can be designed according to sequence differences of the resistance alleles, the plague-resistant genes carried by parents can be firstly detected, and the accuracy of resistant variety selection can be greatly improved in the next generation assisted selection.
Disclosure of Invention
The invention aims to provide a dominant molecular marker of a rice blast resistance gene Pi67(t) and application thereof.
In order to achieve the purpose, the invention adopts the technical scheme that:
a rice blast resistance gene Pi67(t) has a rice blast resistance gene Pi67(t) in the region of 10.18Mb to 11.19Mb on chromosome 12 of rice variety GY 8.
A dominant molecular marker which is related to the rice blast resistance gene Pi67 (t): the molecular marker is that a 141bp insertion site exists in a positioning region of rice blast resistance Pi67(t), and the nucleotide sequence is shown as SEQID NO. 1.
A primer combination for detecting the molecular marker, wherein the primer combination is shown by base sequences in SEQ ID NO.2 and SEQ ID NO. 3; wherein the sequence of the forward primer Pi67(t) -1-F of SEQ ID NO.2 is 5'-TAACTTGTCAACGCATCACC-3', SEQ, and the sequence of the reverse primer Pi67(t) -1-R of SEQ ID NO.3 is 5'-AATTAAAGTTCTCATTCGACCA-3'.
The application of the primer combination in breeding rice varieties carrying rice blast resistance genes Pi67 (t).
Further, the following steps are carried out:
1) crossing and breeding progeny groups by using a rice disease-resistant line GY8 carrying a rice blast-resistant gene Pi67(t) and other rice varieties not carrying the rice blast-resistant gene Pi67 (t);
2) extracting genome DNA of single plants in the obtained population, performing PCR amplification by using the primer combination of claim 3, wherein the length of the amplified product fragment is 1284bp, and the detected rice sample is marked to carry the rice blast resistance gene Pi67 (t).
A method for detecting whether a rice variety carries Pi67(t),
1) extracting the genome DNA of the rice sample;
2) performing PCR amplification on the genomic DNA of the rice sample by using the primer combination according to claim 3;
3) the length of the fragment of the amplified product is 1284bp, which indicates that the sample genome carries the rice blast resistance gene Pi67 (t).
A method for breeding a rice variety carrying a rice blast resistance gene Pi67(t) by utilizing the primer combination,
1) hybridizing a rice disease-resistant strain GY8 carrying a rice blast-resistant gene Pi67(t) with other rice varieties not carrying the rice blast-resistant gene Pi67(t), and breeding progeny groups;
2) extracting genome DNA of single plants in the population by using a CTAB method, and performing PCR amplification by using the primer combination to obtain a product with the fragment length of 1284bp, wherein the product indicates that the detected rice sample carries the rice blast resistance gene Pi67 (t).
The invention has the beneficial effects that:
the invention relates to a method for constructing F8 generation recombinant inbred line RILs group by hybridizing northern japonica rice variety GY8 with Liaoxing No.1, and positioning a broad-spectrum rice blast resistance gene Pi67(t) from GY8 by adopting a chip technology; the invention discloses a molecular marker cosegregating with Pi67(t) and an application method thereof in the breeding process of new rice varieties, which particularly comprises the following steps:
1. the molecular marker co-separated from the rice blast resistance gene Pi67(t) obtained in the invention identifies the rice blast resistance gene as a new gene positioned in a rice variety GY8, the gene is applied to northern japonica rice disease resistance breeding, and the progeny material has strong rice blast resistance. The application of the invention can obviously improve the utilization efficiency of Pi67 (t).
2. The molecular marker provided by the invention is developed based on the second-generation re-sequencing result, and is verified by first-generation sequencing, so that the result is accurate and the specificity is good.
3. The molecular marker provided by the invention is positioned in a positioning region of a disease-resistant gene Pi67(t), the region is near a centromere of chromosome 12, the recombination probability is low, the molecular marker is closely linked with Pi67(t) in the inheritance, and the coseparation degree of the marker and the gene is high.
4. The molecular marker provided by the invention is a dominant marker, has good polymorphism, is convenient for accurate distinction through agarose gel electrophoresis, and has low application cost, simple and convenient operation and high accuracy.
Drawings
FIG. 1 is a diagram showing the location of the locating region of the rice blast resistance gene Pi67(t) and the Indel site on the rice chromosome, which are provided in the examples of the present invention;
FIG. 2 is an electrophoretic bar chart of PCR amplification products of two parents and their progeny using Indel markers provided by the present invention, wherein M represents marker, G represents GY8, and L represents the progeny of the Liaoxing hybridization between GY8 and Liaoxing 1;
FIG. 3 is a photograph showing electrophoresis bands of PCR amplified products of different rice varieties using Indel markers provided in the embodiments of the present invention, where M represents marker and 1-48 represent different rice varieties.
Detailed Description
The following examples are presented to further illustrate embodiments of the present invention, and it should be understood that the embodiments described herein are for purposes of illustration and explanation only and are not intended to limit the invention.
Example 1 localization of Rice blast resistance Gene Pi67(t)
Hybridizing the rice blast resistant rice variety GY8 with the rice blast susceptible rice variety Liaoxing No.1, and separating from the mixture F2The generation begins to construct a recombinant inbred line population RILs by a single seed transmission method, wherein the population comprises 197 strains.
Planting the obtained strains in a rice blast induction nursery of Liaoning province, and continuously investigating resistance of 197 strains and two parents to rice blast in the obtained population for two years; pathogenic reaction type and microspecies determination were evaluated according to the national physiological microspecies combination test group of Pyricularia oryzae (1980) unified standard. The survey record criteria are:
the 8K rice gene chip is used for detecting the genotypes of two parents and 197 strains, and 559 SNPs with differences among the parents are found on 12 chromosomes of rice. And then the QTL IiMapping software is utilized to position the rice blast resistance gene carried by GY8 to be within the range of 7.8M-13.2M of chromosome 12. A backcross population is constructed by backcrossing a strain carrying a positioning region in a recombinant inbred line population and a susceptible parent Liaoxing No.1, recombinants are screened from the backcross population, the positioning region is narrowed to a range of 10.18Mb-11.19Mb of a chromosome 12 by combining the phenotype of the recombinants, and a rice blast resistant gene carried by GY8 is named as Pi67(t) as shown in figure 1.
Example 2 development of molecular marker cosegregating with Rice blast resistance Gene Pi67(t)
The rice strain GY8 carrying the rice blast resistance gene Pi67(t) and the rice strain Liaoxing No.1 not carrying the gene are subjected to re-sequencing by a second-generation re-sequencing technology to obtain sequencing data with the average coverage depth of more than 30 x. By aligning the sequences of the two varieties, a 141bp insertion site exists in the positioning region of the rice blast resistance gene Pi67(t) of the two rice varieties, and the positions of the rice blast resistance gene Pi67(t) and the Indel site on the chromosome are shown in a figure 1.
As can be seen from FIG. 1, in the case where the rice blast resistance gene Pi67(t) is located on chromosome 12 of rice within the range of 10.18Mb to 11.19Mb, the Indel site is located at 10.93 Mb; GY8 carrying the rice blast resistant gene Pi67(t) had an insertion of 141bp compared to Liaoxing No.1 which did not carry the gene Pi67 (t). Namely the molecular marker coseparated with the rice blast resistant gene Pi67(t) shown in SEQ ID NO. 1.
SEQ ID NO.1
GAGCCCAAGGGACATGTCTCAGCAACATACGGACGCGACGAGGATGAACGTGCTTGCTCGTCTCATTTCCCAGGTCCGTCGTTCGATCGGTAACTTGTCAACGCATCACCGATCCGTGATGGGGCTGCCGTGGACACCCTT
And designing a pair of primer combinations according to the sequences at the two ends of the Indel site, wherein the primer combinations consist of a DNA sequence shown as SEQ ID NO.2 and a DNA sequence shown as SEQ ID NO. 3. The sequence of the forward primer Pi67(t) -1-F of SEQ ID NO.2 is 5'-TAACTTGTCAACGCATCACC-3', SEQ, and the sequence of the reverse primer Pi67(t) -1-R of SEQ ID NO.3 is 5'-AATTAAAGTTCTCATTCGACCA-3'.
The obtained primer pairs are used for carrying out PCR amplification on the genomic DNA of the rice variety GY8 and Liaoxing No.1 respectively.
The reaction system is as follows: 2 XTaq PCR Master Mix (Edela PC0902) 10. mu.L, 10. mu.M primers 0.5. mu.L each, 100. mu.g/mL template DNA 1. mu.L, ddH2O 8μL。
The PCR reaction program is: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 56 deg.C for 30s, extension at 72 deg.C for 45s, 30 cycles, extension at 72 deg.C for 10min, and storage at 4 deg.C.
As can be seen from the PCR amplification products, the amplification product of GY8 carrying the rice blast resistant gene Pi67(t) is 1284bp, while Liaoxing No.1 carrying no gene Pi67(t) has no amplification product, and the primer can well distinguish disease-resistant and disease-susceptible genotypes.
Example 3 verification of molecular markers cosegregating with Rice blast resistance Gene Pi67(t)
Taking a donor variety GY8 and an susceptible variety Liaoxing 1 of the rice blast resistant gene Pi67(t) as parents to construct F2And the group is artificially inoculated to the single plant in the group in the seedling stage by using the mixed bacteria of the rice blast germs prevailing in the Liaoning area, and the resistance of the group to the rice blast is identified. And using a primer combination of SEQ ID NO: 2/SEQ ID NO: 3 pairs of F2And (4) identifying the genotype of each plant of the population.
The specific test is as follows:
an F2 group is constructed as a test material by taking a donor variety GY8 and an susceptible variety Liaoxing 1 of a rice blast resistant gene Pi67(t) as parents and is planted in a greenhouse. Respectively transplanting rice blast germs ZA1, ZA9, ZB1 and ZF1 which are popular in Liaoning area on oatmeal tomato juice agar medium, culturing for 7d at 25-27 ℃, wiping off aerial hyphae with sterilized cotton swab after hyphae overgrow, and performing moisture preservation culture, wherein the rice blast germs can produce a large amount of spores. When 7 varieties of rice seedlings grow to 5 leaves and 1 heart, cleaning the conidia subjected to propagation culture by 120ml of sterile water, filtering the mixture by using double-layer gauze, filling the mixture into a triangular flask, preparing spore suspension (the concentration of the spores is about 20 under the microscope vision field of 120 times), mixing the 5 rice blast germ microspores, preparing mixed germ spore suspension, and performing spray inoculation on a test material. After inoculation, black plastic film is used for shading and moisture preservation for 12 hours. The inoculation 10d after investigation, the investigation method referred to example 1. Simultaneous extraction of F2Genomic DNA of the population of plants, with primer combinations of SEQ ID NO: 2/SEQ ID NO: 3, carrying out PCR amplification, wherein the PCR reaction program comprises the following steps: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 56 deg.C for 30s, extension at 72 deg.C for 45s, 30 cycles, extension at 72 deg.C for 10min, and storage at 4 deg.C. The amplification products were electrophoresed in 1.5% agarose gel and the results of the assay were recorded using a gel imaging system, the amplification results are shown in FIG. 2. As shown in the figure, the results of inoculation identification and gene amplification show that F2 generation partial strains, F, of which 1-19 is GY8 and Liaoxing 1 are hybridized2In the population, individuals with 1 fragment of 1284bp length in the amplified products have disease resistance to rice blast, and individuals without amplified products have disease resistance to rice blastIt is manifested as an infection. The results of the examples show that the primer combinations of SEQ ID NO: 2/SEQ ID NO: 3, the plant carrying the rice blast resistance gene Pi67(t) can be accurately screened, and the screening efficiency reaches 100 percent.
Example 4 detection of Rice variety carrying anti-Rice blast Gene Pi67(t) Using molecular marker Pi67(t) -1
Using 48 rice varieties including rice blast resistance gene Pi67(t) donor variety GY8 as test materials, normally planting in the field, extracting DNA at the seedling stage by the method described in example 3, and using SEQ ID NO: 2 and SEQ ID NO: PCR amplification was carried out using primers 3, and the amplification results are shown in FIG. 3, in which 16 rice varieties such as No.3, etc., in addition to the rice blast resistance gene Pi67(t) donor variety GY8 (No. 2), amplified specific products consistent with the donor variety and the single gene line. Based on the results of the molecular marker identification, it was confirmed that these 16 varieties carried the rice blast resistance gene Pi67 (t).
The marker can be effectively used for identifying whether the rice variety carries the rice blast resistance gene Pi67 (t).
Example 5 application of molecular marker closely linked to Rice blast resistance Gene Pi67(t)
A breeding population is constructed by hybridizing an infected rice variety Liaoxing No.1 with GY8 carrying a rice blast resistance gene Pi67(t), and primer combinations of SEQ ID NO: 2/SEQ ID NO: 3 PCR amplification of the genomic DNA of the progeny plants was carried out in the same manner as in example 3. If the amplified product is a 1284bp fragment, the single strain carries the rice blast resistance gene Pi67 (t). And then screening the plant type and yield character of the plant carrying Pi67(t), and breeding the rice line which not only carries the rice blast resistance gene, but also has good plant type and yield character. The results of the examples show that the application of the molecular marker can quickly and accurately identify the rice plant carrying the Pi67(t) gene from the progeny material, and accelerate the process of breeding rice blast-resistant varieties.
Sequence listing
<110> Liaoning province research institute of rice
<120> dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 141
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gagcccaagg gacatgtctc agcaacatac ggacgcgacg aggatgaacg tgcttgctcg 60
tctcatttcc caggtccgtc gttcgatcgg taacttgtca acgcatcacc gatccgtgat 120
ggggctgccg tggacaccct t 141
Claims (6)
1. A dominant molecular marker closely linked to a rice blast resistance gene Pi67(t), characterized in that: the molecular marker is a 141bp insertion existing in a rice blast-resistant gene Pi67(t) positioning region, and the nucleotide sequence is shown as SEQID NO. 1;
the location region of the rice blast resistance gene Pi67(t) is 10.18Mb-11.19Mb of chromosome 12 of rice variety GY 8.
2. A primer combination for detecting the molecular marker of claim 1, wherein: in the primer combination, the sequence of the forward primer Pi67(t) -1-F is 5'-TAACTTGTCAACGCATCACC-3', and the sequence of the reverse primer Pi67(t) -1-R is 5'-AATTAAAGTTCTCATTCGACCA-3'.
3. Use of a primer combination according to claim 2, wherein: the primer combination is applied to breeding of rice varieties carrying rice blast resistance genes Pi67 (t).
4. Use of a primer combination according to claim 3, wherein:
1) crossing and breeding progeny groups by using a rice disease-resistant line GY8 carrying a rice blast-resistant gene Pi67(t) and other rice varieties not carrying the rice blast-resistant gene Pi67 (t);
2) extracting genome DNA of single plants in the obtained population, performing PCR amplification by using the primer combination of claim 2, wherein the length of the amplified product fragment is 1284bp, and the detected rice sample is marked to carry the rice blast resistance gene Pi67 (t).
5. A method for detecting whether a rice variety carries Pi67(t) is characterized in that:
1) extracting the genome DNA of the rice sample variety;
2) performing PCR amplification on the genomic DNA of the rice sample by using the primer combination of claim 2;
3) the length of the amplified product fragment is 1284bp, which marks that the rice variety carries the rice blast resistance gene Pi67 (t).
6. A method for breeding a rice variety carrying a rice blast resistance gene Pi67(t) by using the primer combination of claim 2, which is characterized in that:
1) hybridizing a rice disease-resistant strain GY8 carrying a rice blast-resistant gene Pi67(t) with other rice varieties not carrying the rice blast-resistant gene Pi67(t), and breeding progeny groups;
2) extracting genome DNA of single plants in the population by using a CTAB method, and performing PCR amplification by using the primer combination of claim 2, wherein the obtained product has a fragment length of 1284bp, and the obtained product indicates that the rice sample to be detected carries the rice blast resistance gene Pi67 (t).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910680019.8A CN111073990B (en) | 2019-07-26 | 2019-07-26 | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910680019.8A CN111073990B (en) | 2019-07-26 | 2019-07-26 | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111073990A CN111073990A (en) | 2020-04-28 |
| CN111073990B true CN111073990B (en) | 2021-02-19 |
Family
ID=70310114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910680019.8A Active CN111073990B (en) | 2019-07-26 | 2019-07-26 | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111073990B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146695B (en) * | 2013-03-01 | 2014-12-10 | 福建省农业科学院生物技术研究所 | Functional molecular marker for rice anti-blast gene Pi9 and application thereof |
| CN104073487B (en) * | 2014-07-03 | 2016-04-13 | 福建省农业科学院生物技术研究所 | The molecule marker of rice blast resistant gene Pi2 and application thereof |
-
2019
- 2019-07-26 CN CN201910680019.8A patent/CN111073990B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111073990A (en) | 2020-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10064351B2 (en) | F. oxysporum F.sp. melonis race 1,2-resistant melons | |
| WO2011072478A1 (en) | Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof | |
| CN102925436A (en) | Cotton highly-verticillium wilt resistant major QTL (quantitative trait locus) and SSR molecular marker thereof | |
| CN106811462B (en) | Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof | |
| JP5653957B2 (en) | Markers for resistance to smut of sugarcane plants and their use | |
| CN106555001A (en) | A kind of molecular labeling of rice blast resistant gene and its application | |
| CN105123507A (en) | Scab-resistant gene Fhb7 short-segment translocation line derived from elytrigia elongata and application thereof | |
| CN111073991B (en) | Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| Jayawardana et al. | Evaluation of DNA markers linked to blast resistant genes, Pikh, Pit (p), and Pita, for parental selection in Sri Lankan rice breeding | |
| CN102517396B (en) | Molecular breeding method for breeding new anti-verticillium cotton seed | |
| US20230227839A1 (en) | Novel disease resistant melon plants | |
| CN111073990B (en) | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| CN109006456A (en) | A kind of selection of pimento genic male sterility dual purpose | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof | |
| CN108165649B (en) | Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof | |
| JP6299030B2 (en) | PRSV-resistant cucumber plant and method for producing cucumber plant exhibiting PRSV resistance and ZYMV resistance | |
| CN106636425B (en) | Molecular marker of rice purple leaf gene P L1 and identification method and application thereof | |
| CN109880929A (en) | The molecular labeling of the main effect QTL site Apam-1 of adjusting and controlling rice bacterial brown streak resistance and its application | |
| US11384362B1 (en) | Squash plants with resistance to downy mildew | |
| CN114931092B (en) | Wheat scab resistant molecular breeding method capable of polymerizing multiple traits and facilitating allelic variation | |
| Yan | Towards efficient improvement of greenhouse grown roses: genetic analysis of vigour and powdery mildew resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |