CN109338005B - High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof - Google Patents
High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof Download PDFInfo
- Publication number
- CN109338005B CN109338005B CN201811375763.9A CN201811375763A CN109338005B CN 109338005 B CN109338005 B CN 109338005B CN 201811375763 A CN201811375763 A CN 201811375763A CN 109338005 B CN109338005 B CN 109338005B
- Authority
- CN
- China
- Prior art keywords
- wheat
- sbwm1
- soil
- kasp
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the field of crop molecular breeding, and particularly provides 1 group of wheat soil-borne mosaic disease resistant genesSbwm1The high-flux KASP detection marker and the application thereof in breeding are used for quickly, efficiently and high-flux detecting the gene resisting wheat soil-borne mosaic diseaseSbwm1The Single Nucleotide Polymorphism (SNP) marker of (1) can be efficiently detectedSbwm1The distribution condition in the Chinese wheat variety can be screenedSbwm1The genetic wheat germplasm resource is efficiently applied to the molecular marker-assisted breeding for resisting the soil-borne mosaic disease of the wheat, the resistance of the soil-borne mosaic disease of the wheat is improved, and a new wheat variety resisting the soil-borne mosaic disease is bred.
Description
Technical Field
The invention relates to the technical field of crop molecular markers, in particular to a high-throughput detection marker for a wheat soil-borne mosaic disease resistant gene and application thereof.
Background
Wheat (A), (B)Triticum aestivumL.) is one of the most important food crops in the world, and about 40% of the population worldwide takes wheat as the staple food, and the sowing area and the yield of the wheat are the first in the world. In China, the perennial planting area of wheat is more than 2400 million hectares, the total yield is more than 1.2 hundred million tons, and the wheat accounts for about 20 percent of the yield of grain crops. Therefore, continuously improving the capability of wheat for resisting various diseases and ensuring high and stable yield of wheat is an important factor which is related to the continuous improvement of food safety in China and the living standard of people.
The soil-borne mosaic virus disease of wheat is caused by soil-borne mosaic virus of wheat (A)Soil-borne wheat mosaic virusSBWMV) occurs in different winter wheat producing areas throughout the world and causes severe losses. The disease is serious in the Huang-Huai-winter wheat area and the middle and lower reaches of Yangtze river wheat production area in the winter wheat area of China.
The virus causing the wheat soil-borne mosaic virus belongs to the genus Furovirus and is composed of polymyxa graminis (A) which inhabits in soilPolymyxa graminis) Carrying and infecting the root of wheat. In the germination process of wheat after sowing in autumn, the cereal polymyxa carrying the SBWMV and the dormant spores thereof move in soil along with water until the germinated roots are infected, and then are transported upwards along xylem, so that leaf infection is caused. Since the virus proliferates in the diseased strain after the invasion, the root cells contain a large amount of virus particles. When the root is caughtThe virus particles are combined in the protoplasts of zoospores and resting spores when raw polymyxa graminis forms zoosporangia and resting spores. When these spores are released into the soil or enter the soil along with the residual roots of diseased plants and invade the roots of young seedlings of wheat seedlings again, the viruses are brought into the host. The affected wheat generally has disease symptoms in early spring, which is mainly characterized in that when wheat seedlings turn green and stand up in early spring, a plurality of green-removing streaks appear on leaves, and diseased plants are generally shorter than normal plants. The new leaves of the diseased plant show green-fading stripes at the early stage of disease incidence, and are alternated with green tissues to form floral leaf symptoms; the later stage disease spots are spread and increased, which can cause the yellowing and withering of the whole diseased leaves, the dwarfing and yellowing of plants with serious disease, few tillers and ears and the reduction of thousand-grain weight. According to statistics, the yield loss caused by the wheat soil-borne mosaic virus disease can be varied from 10% to 30%, and the yield loss of severely infected plots can reach more than 80%.
The wheat soil-borne mosaic virus is mainly spread by the propagation of diseased soil, diseased root stubbles and flowing water in diseased fields. Because the virus exists in the soil, the virus is mainly carried by mechanical farming agricultural equipment, levels the land, is filled with diseased soil, transplants the seedlings with the pathogenic soil and the like to move the diseased soil; carrying the zoospores with toxic mediators along with irrigation water; the seeds are carried with disease residues. The small-area lesion is usually found first, and then the area is gradually enlarged. The propagation medium polymyxa graminearum has thick-wall dormant spores, has strong stress resistance, can survive in soil for a long time, has infectivity after carried viruses for ten years, and is difficult to control by a chemical control method; the control of disease by crop rotation, delayed sowing, and treatment of diseased soil is also very limited. Therefore, identifying and utilizing the disease-resistant gene to cultivate disease-resistant varieties is the most economic and effective way to prevent and treat the diseases.
The genetic basic research on the resistance of the soil-borne mosaic disease of the wheat shows that 1 to 3 genes in different materials determine the resistance of the soil-borne mosaic disease of the wheat, and Bass et al, (2006) a gene for resisting the soil-borne mosaic disease of the cereal crop is positioned on the long arm of a 5D chromosome of the wheat by utilizing a molecular marker technology for the first timeSbwm1Narasimophorhy et al (2006) mapping via Quantitative Trait Loci (QTL)The method locates a major QTL for resisting soil-borne mosaic disease at the same position of the long arm of the 5D chromosome of wheatQSbv.ksu-5DThis QTL was later confirmed by other studies. The position of the QTL andSbwm1the genes are identical and are the same gene.
Wheat soil-borne mosaic disease resistant geneSbwm1Effective use has been difficult, mainly due to the lack of efficient molecular markers for high throughput.
Disclosure of Invention
Aiming at the blank existing in the prior art, the invention provides a group of high-throughput wheat SBWMV-resistant molecular markers with important utilization value in breeding, and the gene for resisting soil-borne mosaic disease can be quickly, efficiently and high-throughput detectedSbwm1Can be used to detectSbwm1The distribution in the wheat germplasm resources is selected to haveSbwm1The wheat germplasm is applied to wheat anti-SBWMV molecular marker-assisted selective breeding, improves the wheat anti-SBWMV breeding efficiency, and containsSbwm1A new wheat variety of gene SBWMV resistance.
Through genotyping and identifying soil-borne mosaic disease resistance of 205 wheat varieties by using a wheat 90K wheat chip and through whole genome association analysis, 35 SNPs are identified to be remarkably related to SBWMV resistance, and the markers are concentrated on a wheat 5D chromosome and are positioned at the early stageSbwm1The genes are located in the same region. To further determine these SNP markersSbwm1The genetic distance of (a). We further transformed these SNP markers into KASP markers and mapped two F6 recombinant inbred populations, Wesley/OK03825-5403-6 and Deliver/OK03825-5403-6, identified as located inSbwm12 KASP detection markers Sbwm 1-BS 00079676_51-KASP, Sbwm 1-Sbwm 1 which are positioned at two sides and linked with the two sides and can be used for marker-assisted breedingwsnp_CAP11_c209_198467-KASP. To further confirm the effectiveness of the two markers, 159 wheat varieties (or lines) are further verified, and the soil-borne mosaic disease resistance of the wheat varieties can be completely determined by finding that the two markers are used together through marker detection and disease resistance identification.
384 wheat varieties from Huang-Huai-Mai district of China are paired by utilizing the two markersThe detection shows that the 2 KASP markers can be efficiently screened to containSbwm1The germplasm material can be widely applied toSbwm1The marker assisted breeding uses KASP marker for marker assisted selection in breeding group, improves the breeding efficiency of wheat resistant SBWMV, and the breeding containsSbwm1A new wheat variety of gene SBWMV resistance.
The invention adopts the following technical scheme to realize the purpose:
the invention provides a group of detection markers of a wheat soil-borne mosaic disease resistant gene Sbwm1, wherein the markers are closely linked with the wheat soil-borne mosaic disease resistant gene Sbwm1 and are respectively positioned at two sides of the gene Sbwm 1; the markers are all separated from the gene Sbwm1 by less than or equal to 2.7 cM;
the markers are KASP high-throughput SNP markers, each marker comprises 2 forward primers and 1 reverse primer;
the primer sequences marked Sbwm 1-BS 00079676-51-KASP were as follows:
Sbwm1- BS00079676_51-KASP-FAM_A-R:
5 'GGGTACTCTCGTCTTCCTGCATA 3', the nucleotide sequence of which is shown in SEQ ID NO: 1;
Sbwm1- BS00079676_51-KASP-HEX_G-S:
5 'GGGTACTCTCGTCTTCCTGCATG 3', the nucleotide sequence of which is shown in SEQ ID NO. 2;
Sbwm1- BS00079676_51-KASP-R:
5 'CAGTACAAAGCGCAACCTCA 3', the nucleotide sequence of which is shown in SEQ ID NO. 3;
the primer sequences for the markers Sbwm 1-wsnp _ CAP11_ c209_198467-KASP were as follows:
Sbwm1- wsnp_CAP11_c209_198467-KASP-FAM_A-R：
5 'CACGCCATTAGCAGACGTACGTA 3', the nucleotide sequence of which is shown in SEQ ID NO. 4;
Sbwm1- wsnp_CAP11_c209_198467-KASP-HEX_G-S：
5 'ACGCCATTAGCAGACGTACGTG 3', the nucleotide sequence of which is shown in SEQ ID NO: 5;
Sbwm1- wsnp_CAP11_c209_198467-KASP-KASP-R：
5 'GGGGAGTTCCCGTGTATATGTAAATAAAT 3', the nucleotide sequence of which is shown in SEQ ID NO 6.
Preferably, the marker provided by the invention is located on the 5D chromosome from 546,086,597 bp to 547,273,657 bp.
Preferably, the genetic distance of the marker provided by the invention in a linkage map in a Wesley/OK03825-5403-6 population is 5.1cM, and the geneSbwm1Between the markers; the markers Sbwm 1-BS 00079676_51-KASP and Sbwm 1-wsnp _ CAP11_ c209_198467-KASP and the genesSbwm1Are 2.4cM, 2.7cM, respectively.
In another preferred embodiment, the genetic distance of the marker provided by the invention in the linkage map of the Deliver/OK03825-5403-6 population is 3.4cM, and the geneSbwm1Between the markers; the markers Sbwm 1-BS 00079676_51-KASP and Sbwm 1-wsnp _ CAP11_ c209_198467-KASP and the genesSbwm1Are 1.7cM, respectively.
The marker provided by the invention can be applied to the molecular marker-assisted molecular breeding of the soil-borne mosaic disease resistance of wheat.
After obtaining the above primers, the inventors further provide a specific detection method as follows:
1. extracting the genomic DNA of the wheat to be detected by using a CTAB method;
2. PCR amplification is carried out on a Q-Cycler 96 PCR instrument (Hain Life science UK, UK) by utilizing the marker synthesized by the design and the genome DNA extracted in the previous step, and fluorescence signal detection is carried out on an ABI Quant study 12K Flex real-time fluorescence quantitative PCR system (Life Technologies Corporation USA);
the criterion for the decision is determined by the color of the dots and the position of the cluster on the horizontal or vertical axis: the signal is red, is gathered near the horizontal axis and is gathered together with the anti-SBWMV contrast, and is judged as the anti-SBWMV genotype; the signal is blue, and is gathered together with the longitudinal axis and the SBWMV, so that the SBWMV-sensitive genotype is judged;
3. analyzing the above to obtainSbwm1Distribution in wheat.
The specific method comprises the following steps:
extracting the genomic DNA of the wheat to be detected by using a CTAB method:
(a) placing young and tender leaves of wheat in a 96-hole deep-hole plate, freezing by using liquid nitrogen, and grinding into powder on a tissue grinder; (b) adding 600 μ L CTAB extractive solution into 96-well deep-well plate, placing in 65 deg.C water bath for 60min, and gently shaking for 5-8 times to fully crack DNA; (c) adding 600 μ L chloroform isoamyl alcohol (volume ratio 24: 1) and shaking for 10 min; (d) centrifuging at 3000g for 10min, and placing 500 μ L of supernatant in another new clean 96-well deep-well plate (note corresponding serial number); (e) after adding 500. mu.L of isopropanol (frozen at-20 ℃ C. in advance) and 60. mu.L of 3M sodium acetate (pH = 5.2) and shaking gently, generation of white DNA floc was observed, and the DNA yield was increased by leaving at-20 ℃ for 20 min. (f) Centrifuging at 3000g for 10min, pouring out supernatant, washing precipitate with 70% ethanol (frozen in refrigerator at-20 deg.C in advance) for 2-3 times, and air drying until no alcohol smell is obtained; (g) adding 300 mu L of dd water to dissolve the DNA, and storing the DNA in a refrigerator at the temperature of 20 ℃ below zero for later use;
primer dilution and assay primer mixing:
three primers labeled for each KASP assay were diluted to 100 μ M with ultrapure water and the volume ratio of the forward primer FAM: forward primer HEX: reverse primer: ultrapure water = 6: 6: 15: 23, mixing, uniformly mixing and storing to-20 ℃ for later use;
the PCR amplification system and procedure used were as follows:
6 mu L PCR system preparation
The system was prepared on ice according to the following table, 3. mu.L (about 20 ng/. mu.L) of template DNA, 2 × Master mix 3. mu.L (LGC Group UK), and 0.0825. mu.L of KASP assay primer (synthesized by Shanghai Biotech).
TABLE 1 PCR System
| Medicine and food additive | Volume of |
| Template DNA | 3 mu L (15-20 ng/mu L) |
| 2x Master Mix | 3μL |
| KASP assay primer | 0.0825μL |
| Sum of | 6.0825μL |
The PCR procedure was as follows:
pre-denaturation at 1.94 ℃ for 15 min;
denaturation at 2.95 ℃ for 20 s;
annealing at 3.65 deg.C for 30s (0.7 deg.C per cycle), and repeating steps 2-3 for 10 times;
denaturation at 4.95 ℃ for 20 s;
annealing at 5.58 ℃ for 30s, and circulating the step 4-5 for 35 times;
storing at 6.10 deg.C.
Has the advantages that: the invention provides a gene for quickly, efficiently and high-flux detecting wheat soil-borne mosaic disease resistanceSbwm1The molecular marker of (1) and a corresponding detection method, which can detectSbwm1Distribution in wheat is helpful for screening wheat withSbwm1The wheat germplasm resource selects the germplasm resource with resistant loci as a breeding parent, is applied to wheat anti-SBWMV molecular marker-assisted breeding, improves the wheat anti-SBWMV breeding efficiency, and breeds a new wheat variety resistant to SBWMV.
Drawings
Fig. 1 is a manhattan plot of a whole genome association analysis, with the dots above the top line of 5D indicating SNPs significantly associated with soil-borne leaf disease resistance.
FIG. 2 is a linkage map of the soil-borne mosaic disease resistance gene Sbwm1, with the left panel showing the linkage map in the Wesley/OK03825-5403-6 population and the right panel showing the linkage map in the Deliver/OK03825-5403-6 population.
FIG. 3 is a graph showing the result of SNP detection in Sbwm 1-BS 00079676_51-KASP, wherein the circles near the horizontal axis represent the genotypes of Sbwm 1-BS 00079676_51-KASP-FAM _ A-R (A) (anti-SBWMV) and the circles near the vertical axis represent the genotypes of Sbwm 1-BS 00079676_51-KASP-HEX _ G-S (G) (SBWMV); ■ represents ddH2O blank control.
Detailed Description
Example 1 Whole genome Association analysis of genes resistant to soil-borne mosaic disease
NO.1 experimental materials and methods
No.1.1 test Material
The experimental materials used for the whole genome association analysis included 137 durum winter wheat and 68 soft winter wheat varieties. These varieties respond differently to pattern-borne mosaic disease resistance.
1.2 phenotypic characterization
No.1.2 field test
The materials are planted in a soil-borne mosaic disease resistance identification garden of Kansas vertical university in 2009-2010 and 2010-2011 wheat growing seasons respectively, a dibbling mode is adopted, the plant spacing is 7cm, the row width is 23.5cm, and each plant is planted in one row and is repeated in two rows. Disease resistance was investigated at the onset according to the 1-4 scale criteria.
The disease resistance identification standard:
disease grade:
high resistance: no disease spots on leaves and no growth retardation of plants
Resisting: slight scab on leaves, but no growth retardation of plants
Sensing: obvious scab on leaves and certain development retardation of plants
High feeling: severe spots on leaves and slow plant development
1.3 genotyping and correlation analysis
Carrying out genotyping on the population through Infinium iSelect 90K wheat Wheat SNP chips to obtain 21,600 SNP (single nucleotide polymorphism) which can reveal polymorphism in different varieties, and finding 35 genes resisting soil-borne mosaic disease through whole genome association analysisSignificantly associated SNPs: (P < 10-7) (FIG. 1). Based on the wheat reference genomic sequence IWGSC RefSeq v1.0, in which 33 SNPs were derived from the high-confidence annotated genes on 11 5D chromosomes (from TravesCS 5D01G529700 to TravesCS 5D01G532100), there was one SNPExcalibur_c22724_85From the last low confidence annotated gene in 5D, Traes CS5D01G625100LC, the other SNP BS00013935_51 is from intergenic sequences. The number of SNPs in each gene varies from 1 to 12, and these SNPs are distributed in the region of 69Mb on the 5D chromosome, but if we exclude a less relevant SNPSNPBS00013935_51This interval is narrowed to an interval of 546,086,597 to 547,273,657 bp on the 5D chromosome, i.e., 1.18 Mb.
Example 2 linkage mapping of disease resistance genes
No.2.1 test Material
The experimental material adopted by the linkage mapping comprises two Recombinant Inbred Line (RIL) groups Wesley/OK 03825-5403-6F 6 and Deliver/OK 03825-5403-6F 6 which are respectively created by hybridizing 2 soil-borne mosaic disease resistant varieties Wesley and Deliver with an infectious variety OK03825-5403-6, and respectively comprise 180 RILs and 260 RILs.
2.2 phenotypic characterization
The materials are planted in soil-borne mosaic disease resistance identification gardens of Kansassi vertical university in 2013-2014 and 2014-2015 wheat growth seasons respectively, the dibbling mode is adopted, the plant spacing is 7cm, the row width is 23.5cm, and each line is planted in one row and is repeated in two rows. Disease resistance was investigated at the onset according to the 1-4 scale criteria.
The disease resistance identification standard is the same as above.
Linkage mapping of NO.2.3
To demonstrate linkage of SNPs identified by association analysis to disease-resistant genes and mapping the disease-resistant genes, one SNP from each gene was converted to a competitive allele-specific PCR marker (KASP marker), and a total of 12 SNPs were converted to KASP markers, these 12 KASP markers were first used to detect polymorphisms between the three parents Deliver, Wesley, and OK03825-5403-6, and 10 KASP markers revealed polymorphisms between Wesley and OK 08825-5405-6; there are 8 KASP tags in Deliver and OK038Polymorphisms were revealed between 25-5403-6. These polymorphic KASP markers were used to further test the Wesley/OK 03825-5403-6F 6, Deliver/OK 03825-5403-6F 6 RIL populations for genetic mapping of disease resistance genes. Finally, linkage maps of disease-resistant genes are respectively constructed in Wesley/OK03825-5403-6 and Deliver/OK03825-5403-6 populations, and the linkage maps span 11.6 cM and 15.4 cM in the two populations (figure 2). Two common flanking markers of the disease resistance genewsnp_CAP11_c209_198467AndBS0000079676_51 the disease resistance gene is defined in the interval of 5.1cM and 3.4 cM. Since a gene for resistance to soil-borne mosaic disease, Sbwm1, has been located in this interval, we concluded that the gene for resistance to soil-borne mosaic disease in Wesley and Deliver is also Sbwm 1.
Example 3Sbwm1Verification of validity of linkage marker
NO.3.1 Experimental materials and methods
No.3.1 test Material
The experimental material included 159 durum winter wheat varieties and lines. These varieties respond differently to pattern-borne mosaic disease resistance.
No.3.2 phenotypic characterization
The materials are planted in soil-borne mosaic disease resistance identification gardens of Kansassi vertical university in 2010-2011 and 2011-2012 wheat growing seasons respectively, the planting mode is adopted, the plant spacing is 7cm, the line width is 23.5cm, and each line is planted in one line and is repeated in two lines. Disease resistance was investigated at the onset according to the 1-4 scale criteria.
The disease resistance identification standard is the same as above.
No.3.3 results and analysis
Two flanking markers mapped closest to Sbwm1 linkage for further validationwsnp_CAP11_c209_198467AndBS0000079676_51the gene Sbwm1 has a utilization value in the marker-assisted breeding of the soil-borne mosaic disease resistance gene, the disease resistance of 159 wheat varieties is identified in the research, and the two markers are used for detection. As a result, 104 of the 159 varieties were resistant to soil-borne leaf diseases, and 55 were susceptible. Two SNPs identified 4 haplotypes in total. Wherein the T-A haplotype is an anti-disease haplotype and the C-G haplotype is an infectious haplotype. For SNPwsnp_CAP11_c209_198467T appears in 99% of resistant varieties, C in 98.2% of susceptible varieties, for SNPBS00079676_51A and G appear in 95.2 and 96.6% of resistant and susceptible varieties, respectively. Two recombinant haplotypes T-G and C-A appear in 5 and 3 varieties, respectively, all T-G haplotypes are resistant, one of C-A haplotypes is resistant, and the other two are susceptible, indicating that in the two varieties,Sbwm1andBS00079676_51there is recombination between them. Therefore, the two high-throughput KASP markers are used together, so that the disease-resistant genes in different wheat germplasms can be efficiently detected, and the method can be widely applied to breedingSbwm1The marker of (2) assists in the selection.
Example 4 application of two KASP flanking markers in detection of Chinese wheat germplasm
No.4.1 test Material
The experimental material included 400 parts wheat variety and line.
Genotype detection of No.4.2
Extracting DNA from the above materials, and labeling with KASPwsnp_CAP11_c209_198467And SNPBS00079676_51The above materials were genotyped.
No.4.3 results and analysis
After 384 wheat varieties collected and stored in a laboratory are detected by using the molecular marker provided by the invention, 16 parts of SBWMV resistant genotype materials (the genotype is the same as that of the present SBWMV resistant Deliver) and 384 parts of SBWMV sensitive materials (the genotype is the same as that of the present SBWMV sensitive OK 03825) (figure 3) are obtained. According to the result, the gene containing the soil-borne mosaic disease resistance gene can be selectedSbwm1The proper germplasm resource preparation combination is used for wheat SBWMV molecular marker-assisted breeding research.
Example 5 method of detecting disease resistance genes by two KASP flanking markers
NO.5.1 wheat genome DNA extraction
1) Collection of DNA-extracted leaves
And (3) taking young and tender leaves of the wheat in the seedling stage, putting the young and tender leaves into corresponding holes of a 2 mL 96-hole deep-hole plate according to the number, and putting the young and tender leaves on an ice box for low-temperature storage to prevent DNA degradation.
2) Extracting wheat genome DNA by using a CTAB method; storing at-20 ℃ for later use:
the steps are as follows:
(a) placing young and tender leaves of wheat in a 96-hole deep-hole plate, freezing by using liquid nitrogen, and grinding into powder on a tissue grinder; (b) adding 600 μ L CTAB extractive solution into 96-well deep-well plate, placing in 65 deg.C water bath for 60min, and gently shaking for 5-8 times to fully crack DNA; (c) adding 600 μ L chloroform isoamyl alcohol (volume ratio 24: 1) and shaking for 10 min; (d) centrifuging at 3000g for 10min, and placing 500 μ L of supernatant in another new clean 96-well deep-well plate (note corresponding serial number); (e) after adding 500. mu.L of isopropanol (frozen at-20 ℃ C. in advance) and 60. mu.L of 3M sodium acetate (pH = 5.2) and shaking gently, generation of white DNA floc was observed, and the DNA yield was increased by leaving at-20 ℃ for 20 min. (f) Centrifuging at 3000g for 10min, pouring out supernatant, washing precipitate with 70% ethanol (frozen in refrigerator at-20 deg.C in advance) for 2-3 times, and air drying until no alcohol smell is obtained; (g) add 300. mu.L of dd water to dissolve the DNA, and store in a refrigerator at-20 ℃ for use.
Dilution of primer No.5.2 and mixing of assay primer
Three primers labeled for each KASP assay were diluted to 100 μ M with ultrapure water and the volume ratio of the forward primer FAM: forward primer HEX: reverse primer: ultrapure water = 6: 6: 15: 23, mixing, uniformly mixing, and storing to-20 ℃ for later use.
No.5.3 PCR amplification System and procedure
6 mu L PCR system preparation
The system was prepared on ice according to the following table, 3. mu.L (about 20 ng/. mu.L) of template DNA, 2 × Master mix 3. mu.L (LGC Group UK), and 0.0825. mu.L of KASP assay primer (synthesized by Shanghai Biotech).
TABLE 2 PCR System
| Medicine and food additive | Volume of |
| Template DNA | 3 μ L (about 20ng/μ L) |
| 2x Master Mix | 3μL |
| KASP assay primer | 0.0825μL |
| Sum of | 6.0825μL |
The PCR procedure was as follows:
pre-denaturation at 1.94 ℃ for 15 min;
denaturation at 2.94 ℃ for 20 s;
3.65 ℃ for 30s (0.8 ℃ per cycle), and steps 2-3 are cycled 10 times.
Denaturation at 4.94 ℃ for 20 s;
annealing at 5.57 deg.C for 30s, and circulating step 4-5 for 35 times.
Storing at 6.10 deg.C.
No.5.4 analysis of results:
the amplified PCR system was subjected to SNP typing collection using an ABI Quant Studio 12K Flex real-time fluorescent quantitative PCR system, as shown in FIG. 1, in which the horizontal axis represents the anti-SBWMV genotype and the vertical axis represents the sensory SBWMV genotype, and 378 parts of wheat germplasm and variety on the first 384 well plate contained SNP genotyping dataSbwm1The wheat variety had a genotype of 15 parts for C (anti-SBWMV), a genotype of 363 parts for T (SBWMV-sensitive) material, and ■ as a set dd water blank.
Sequence listing
<110> Shandong university of agriculture
<120> high-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gggtactctc gtcttcctgc ata 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gggtactctc gtcttcctgc atg 23
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cacgccatta gcagacgtac gta 23
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
acgccattag cagacgtacg tg 22
<210> 6
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggggagttcc cgtgtatatg taaataaat 29
Claims (4)
1. Wheat soil-borne mosaic disease resistant geneSbwm1The detection label of (1), characterized in that: the marker and the gene for resisting wheat soil-borne mosaic diseaseSbwm1Closely linked, located in a geneSbwm1One side; the markers are Sbwm 1-BS 00079676_51-KASP, Sbwm 1-BS 00079676_51-KASP are 2.4cM and 2.7cM away from Sbwm1 gene in Wesley/OK03825-5403-6 and Deliver/OK03825-5403-6 groups respectively, the markers are KASP high-throughput SNP markers, and the markers comprise 2 forward primers and 1 reverse primer;
the primer sequences marked Sbwm 1-BS 00079676-51-KASP were as follows:
Sbwm1- BS00079676_51-KASP-FAM_A-R:
5 'GGGTACTCTCGTCTTCCTGCATA 3', the nucleotide sequence of which is shown in SEQ ID NO: 1;
Sbwm1- BS00079676_51-KASP-HEX_G-S:
5 'GGGTACTCTCGTCTTCCTGCATG 3', the nucleotide sequence of which is shown in SEQ ID NO. 2;
Sbwm1- BS00079676_51-KASP-R:
5 'CAGTACAAAGCGCAACCTCA 3', the nucleotide sequence of which is shown in SEQ ID NO 3.
2. The gene for resisting wheat soil-borne mosaic disease according to claim 1Sbwm1The detection label of (1), characterized in that: the marker is located on the 5D chromosome from 546,086,597 bp to 547,273,657 bp.
3. The gene for resisting wheat soil-borne mosaic disease according to any one of claims 1-2Sbwm1In detecting a common wheat geneSbwm1In (1)。
4. The gene for resisting wheat soil-borne mosaic disease according to any one of claims 1-2Sbwm1The detection marker of (1) and application of the detection marker in wheat soil-borne mosaic disease resistant molecular marker assisted molecular breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811375763.9A CN109338005B (en) | 2018-11-19 | 2018-11-19 | High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811375763.9A CN109338005B (en) | 2018-11-19 | 2018-11-19 | High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109338005A CN109338005A (en) | 2019-02-15 |
| CN109338005B true CN109338005B (en) | 2022-01-07 |
Family
ID=65315824
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811375763.9A Active CN109338005B (en) | 2018-11-19 | 2018-11-19 | High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109338005B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102807984A (en) * | 2012-07-17 | 2012-12-05 | 南京农业大学 | Molecular marker for wheat yellow mosaic bymovirus resistant major-effect quantitative trait locus (QTL) of Yining wheat and application thereof |
| CN103114145A (en) * | 2013-02-20 | 2013-05-22 | 中国农业科学院油料作物研究所 | Soybean mosaic virus major gene locus and application thereof |
-
2018
- 2018-11-19 CN CN201811375763.9A patent/CN109338005B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102807984A (en) * | 2012-07-17 | 2012-12-05 | 南京农业大学 | Molecular marker for wheat yellow mosaic bymovirus resistant major-effect quantitative trait locus (QTL) of Yining wheat and application thereof |
| CN103114145A (en) * | 2013-02-20 | 2013-05-22 | 中国农业科学院油料作物研究所 | Soybean mosaic virus major gene locus and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Genome-wide association analysis identified SNPs closely;Shubing Liu et al;《Theor Appl Genet》;20140531;第127卷(第5期);第1039-1047页 * |
| Identification of candidate chromosome region of Sbwm1 for Soil-borne wheat mosaic virus resistance in wheat;Shubing Liu et al;《scientific reports》;20200530;第10卷(第1期);第1-11页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109338005A (en) | 2019-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020223625B2 (en) | Methods and compositions for peronospora resistance in spinach | |
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| EP2164970A2 (en) | F. oxysporum f.sp. melonis race 1,2-resistant melons | |
| Ali et al. | Introgression of striga resistance into popular Sudanese sorghum varieties using marker assisted selection | |
| US20240043863A1 (en) | Resistance to cucumber green mottle mosaic virus in cucumis sativus | |
| CN111073991B (en) | Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application | |
| CN103834647B (en) | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof | |
| CN109338005B (en) | High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof | |
| US20140157450A1 (en) | Methods and compositions for watermelon sex expression | |
| CN111621589B (en) | Molecular marker of brown planthopper resistant gene qBPH6 of rice and application thereof | |
| CN104762299B (en) | A kind of rice seedling resistant gene of salt qST2 and its molecule labelling method | |
| CN109593880B (en) | Molecular marker of rice anti-sogatella furcifera gene qWBPH3.2 and application thereof | |
| CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof | |
| Smitchger | Quantitative trait loci associated with lodging, stem strength, yield, and other important agronomic traits in dry field peas | |
| Kang et al. | Genetic diversity and relationships among cabbage (Brassica oleracea var. capitata) landraces in China revealed by AFLP markers | |
| CN111073990B (en) | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof | |
| US11384362B1 (en) | Squash plants with resistance to downy mildew | |
| CN108315474B (en) | Cold-resistant gene qCT3.12 for rice at booting stageFAZMolecular marker and application thereof | |
| Asare et al. | Identification of New Sources of Rust Resistance in Cowpea (Vigna Unguiculata L. Walp) Germplasm Using Simple Sequence Repeat Markers | |
| Singh et al. | Significant role of molecular markers in sugarcane improvement | |
| CN105385772A (en) | Primer used for screening wheat brown leaf rust resisting QTL and application thereof | |
| CN116814846A (en) | Molecular marker linked with salt-tolerant gene qSST4 of Dongxiang ordinary wild rice and application thereof | |
| Ngugi | Marker assisted breeding to transfer Striga resistance in sorghum from a mapped donor source N13 to a farmer preferred Kenyan variety Ochuti | |
| CN114931092A (en) | Wheat scab resistant molecular breeding method for polymerizing multiple characters and facilitating allelic variation | |
| El-Shafy et al. | GENETIC AND MOLECULAR ANALYSES OF SOME COWPEA (Vigna unguicualata walp.) GENOTYPES SELECTED FOR BEAN BEETLS RESISTANCE |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |