CN108315474B - Cold-resistant gene qCT3.12 for rice at booting stageFAZMolecular marker and application thereof - Google Patents
Cold-resistant gene qCT3.12 for rice at booting stageFAZMolecular marker and application thereof Download PDFInfo
- Publication number
- CN108315474B CN108315474B CN201810407803.7A CN201810407803A CN108315474B CN 108315474 B CN108315474 B CN 108315474B CN 201810407803 A CN201810407803 A CN 201810407803A CN 108315474 B CN108315474 B CN 108315474B
- Authority
- CN
- China
- Prior art keywords
- cold
- rice
- resistant
- booting stage
- marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 29
- 235000009566 rice Nutrition 0.000 title claims abstract description 29
- 239000003550 marker Substances 0.000 title claims description 15
- 108090000623 proteins and genes Proteins 0.000 title abstract description 37
- 240000007594 Oryza sativa Species 0.000 title 1
- 241000209094 Oryza Species 0.000 claims abstract description 28
- 238000009395 breeding Methods 0.000 claims abstract description 18
- 230000001488 breeding effect Effects 0.000 claims abstract description 17
- 239000000463 material Substances 0.000 claims abstract description 12
- 238000000034 method Methods 0.000 claims abstract description 12
- 240000002582 Oryza sativa Indica Group Species 0.000 claims abstract description 6
- 230000002441 reversible effect Effects 0.000 claims abstract description 6
- 239000008280 blood Substances 0.000 claims abstract description 4
- 210000004369 blood Anatomy 0.000 claims abstract description 4
- 239000002773 nucleotide Substances 0.000 claims abstract description 4
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 4
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 230000003321 amplification Effects 0.000 claims description 4
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 4
- 238000001514 detection method Methods 0.000 claims description 3
- 239000012634 fragment Substances 0.000 claims description 2
- 239000003147 molecular marker Substances 0.000 abstract description 14
- 238000009396 hybridization Methods 0.000 abstract description 2
- 230000009466 transformation Effects 0.000 abstract description 2
- 241000196324 Embryophyta Species 0.000 description 9
- 108700028369 Alleles Proteins 0.000 description 8
- 230000002068 genetic effect Effects 0.000 description 8
- 230000035882 stress Effects 0.000 description 7
- 230000002349 favourable effect Effects 0.000 description 5
- 102100031059 Cancer/testis antigen 55 Human genes 0.000 description 4
- 102100037981 Dickkopf-like protein 1 Human genes 0.000 description 4
- 101000922015 Homo sapiens Cancer/testis antigen 55 Proteins 0.000 description 4
- 101000951345 Homo sapiens Dickkopf-like protein 1 Proteins 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 238000011156 evaluation Methods 0.000 description 4
- 230000004807 localization Effects 0.000 description 4
- 238000012216 screening Methods 0.000 description 4
- 238000005204 segregation Methods 0.000 description 4
- 238000012360 testing method Methods 0.000 description 4
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 230000002595 cold damage Effects 0.000 description 3
- 230000008645 cold stress Effects 0.000 description 3
- 238000010276 construction Methods 0.000 description 3
- 230000004069 differentiation Effects 0.000 description 3
- 210000005069 ears Anatomy 0.000 description 3
- 238000003205 genotyping method Methods 0.000 description 3
- 238000003973 irrigation Methods 0.000 description 3
- 230000002262 irrigation Effects 0.000 description 3
- 239000000047 product Substances 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 238000009394 selective breeding Methods 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 235000020681 well water Nutrition 0.000 description 3
- 239000002349 well water Substances 0.000 description 3
- 101150066838 12 gene Proteins 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 2
- 244000184734 Pyrus japonica Species 0.000 description 2
- 230000036579 abiotic stress Effects 0.000 description 2
- 239000007795 chemical reaction product Substances 0.000 description 2
- 101150006264 ctb-1 gene Proteins 0.000 description 2
- 238000001502 gel electrophoresis Methods 0.000 description 2
- 238000013507 mapping Methods 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- IJGRMHOSHXDMSA-UHFFFAOYSA-N nitrogen Substances N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- 229920002401 polyacrylamide Polymers 0.000 description 2
- 238000006116 polymerization reaction Methods 0.000 description 2
- 230000000306 recurrent effect Effects 0.000 description 2
- 230000001850 reproductive effect Effects 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 239000004743 Polypropylene Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000006353 environmental stress Effects 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 1
- -1 polypropylene Polymers 0.000 description 1
- 229920001155 polypropylene Polymers 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 150000003839 salts Chemical class 0.000 description 1
- 230000007226 seed germination Effects 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a cold-resistant gene qCT3.12 for rice at booting stageFAZThe molecular marker of (1) is a 95bp nucleotide sequence amplified by adopting a primer pair RM227 and using a breeding material genome DNA with indica rice variety Fengdai blood margin as a template; the forward primer sequence of the primer pair RM227 is shown as SEQ ID No.1, and the reverse primer sequence of the primer pair RM227 is shown as SEQ ID No. 2. The molecular marker can be used for genotype selection of a breeding group in the booting stage, effectively identifies cold-resistant individuals with the gene, facilitates timely hybridization and transformation, and accelerates the breeding process.
Description
Technical Field
The invention belongs to the field of molecular biology, and particularly relates to a cold-resistant gene qCT3.12 for rice at a booting stageFAZThe molecular marker of (1).
Background
Cold damage is one of the most important abiotic stress factors causing the loss of rice yield and limiting the rice planting distribution. At present, the cold damage frequently occurs, and the loss caused by the cold damage in China is up to 300-. Molecular genetic studies have shown that resistance of rice to low temperatures is a quantitative trait controlled by multiple genes. In comparison with the seed germination stage, seedling stage, and the like, cold resistance of rice at the booting stage (reproductive stage) is very important. To date, 108 cold-tolerant QTLs at the booting stage (reproductive stage) have been identified with an interpretable phenotypic variation rate from 0.8% to 37.8%. Of the 108 QTLs, only a few of qCT8, qCTB7, qCTB3, qCT-3-2, qLTB3 and qCTB10-2 were finely localized, and only two genes Ctb1 and CTB4a were cloned. The alleles promoting the cold tolerance of the rice in the booting stage are mainly derived from natural variation, the positioning and cloning of the genes are helpful for people to know the genetic basis of the low-temperature resistance of the rice, but the currently available excellent cold tolerance genes in the booting stage are very deficient. Therefore, it is of great importance to explore excellent cold tolerance alleles.
Linkage mapping based on parental derived populations has been a common strategy for mapping genes over the past decades. However, QTLs located by parents derived from groups can only compare allelic effects between 2 parents at each genetic locus, and cannot identify more optimal favorable alleles in germplasm resources, and more importantly, QTLs located in location groups are difficult to apply in actual breeding groups due to genetic background effects. In recent years, the construction of a genetically related group of high-generation intercross lines (MAGICs) and a group of recombinant inbred lines (NAM) or Backcross Introgression Lines (BIL) constructed by introducing different varieties into the background of the same excellent variety by using a plurality of parents has more and more application examples in the aspects of QTL localization and favorable gene localization. The multi-parent population overcomes the defect that the double-parent population cannot mine favorable alleles, can compare the expression conditions of the QTL in different genetic backgrounds, and can better solve the problem of QTL positioning and disjointed breeding populations.
The research of combining molecular inheritance and molecular breeding by utilizing a large-scale backcross strategy is one of the advantages of the subject group. By the strategy, germplasm resources from different sources are introduced into the background of a good variety, and stress on abiotic stress such as drought, salt, cold and the like is combined to cultivate stress-resistant extreme selection introduction line population for QTL positioning of stress-resistant target characters. On the basis, molecular marker-assisted design and polymerization breeding are carried out according to target selection trait phenotypes and favorable allele information of QTL (quantitative trait loci) carried by the target selection trait phenotypes, polymerization of different drought-resistant genes, salt-tolerant genes, low-nitrogen-resistant genes and drought-resistant and low-nitrogen-resistant genes is realized, and a batch of rice germplasm materials resistant to different abiotic environmental stresses is created. Meanwhile, a method for detecting the QTL of the target character by utilizing the combined segregation of a plurality of extreme selection introgression line groups with the same background and the same target character is developed, so that the false positives are greatly reduced, and the detection efficiency and reliability of the QTL are improved.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: provides a molecular marker of cold-resistant genes of rice in booting stage.
The technical scheme of the invention is as follows: cold-resistant gene qCT3.12 for rice at booting stageFAZThe molecular marker of (1) is a 95bp nucleotide sequence amplified by adopting a primer pair RM227 and using a breeding material genome DNA with indica rice variety Fengdai blood margin as a template; the forward primer sequence of primer pair RM227 is: ACCTTTCGTCATAAAGACGAG (shown in SEQ ID No. 1), and the reverse primer sequence of the primer pair RM227 is: GATTGGAGAGAAAAGAAGCC (shown in SEQ ID No. 2).
Cold-resistant gene qCT3.12 for rice at booting stageFAZThe specific primer pair of the molecular marker of (1), the sequence of the forward primer is shown as SEQ ID No.1, and the sequence of the reverse primer is shown as SEQ ID No. 2.
Cold-resistant gene qCT3.12 for rice at booting stageFAZThe specific primer pair of the molecular marker is used for screening the cold-resistant gene qCT3.12 of the rice at the booting stageFAZThe application of (1).
Cold-resistant gene qCT3.12 in rice booting stageFAZThe molecular marker identification and rice breeding method adopts a primer pair RM227 to perform PCR amplification by taking the genomic DNA of a breeding material with the indica rice variety Fengdai blood margin as a template, detects an amplification product, and marks the existence of a cold-resistant gene qCT3.12 of the breeding material at the booting stage of rice for detection if a 95bp nucleotide fragment can be amplifiedFAZ(ii) a The forward primer sequence of the primer pair RM227 is shown as SEQ ID No.1, and the reverse primer sequence of the primer pair RM227 is shown as SEQ ID No. 2.
The method utilizes northern japonica rice variety super-excellent No.1 as recurrent parent and backcross introgression line random population prepared from 5 donor varieties to obtain cold-resistant introgression line population through cold-resistant screening and progeny verification at booting stage, and combines molecular markers to position cold-resistant gene qCT3.12 expressed at the booting stage on the tail end of the long arm of the 3 rd chromosome of riceFAZAnd identifying a practical economic marker RM227 of PCR closely linked with the cold-resistant gene, and utilizing the marker to effectively carry out molecular assisted selective breeding research of cold resistance of rice at booting stage.
Compared with the prior art, the invention has the following beneficial effects:
1. the invention identifies the cold-tolerant new gene (qCT3.12) of the booting stage on the 3 rd chromosomeFAZ) And a codominant molecular marker for genotyping. Different from the currently reported genes affecting cold tolerance genes qCT8, qCTB7, qCTB3, qCT-3-2, qLTB3, qCTB10-2, Ctb1, CTB4a and the like at the booting stage, qCT3.12FAZThe gene is a new gene locus for controlling the cold resistance of the rice at the booting stage, which is derived from the Fengdong indica rice variety Fengdai in China, and provides a stress resistance gene for improving the cold resistance of the rice at the booting stage by molecular marker-assisted selection.
2. By screening the new gene marker, the stress-resistant breeding material with improved cold resistance in the booting stage can be obtained.
3. The molecular marker can be used for genotype selection of a breeding group in the booting stage, effectively identifies cold-resistant individuals with the gene, facilitates timely hybridization and transformation, and accelerates the breeding process.
Drawings
FIG. 1 population construction for cold-tolerant QTL location and validation at the booting stage;
FIG. 2 shows the cold-tolerant introgression line CT34 (with only qCT3.12) of the backcross progeny of Superpriority No. 1/FengdianFAZ1 cold-resistant gene) with cold-sensitive introductive line CT55 (without any cold-resistant gene)2The banding pattern of PCR amplification products of the colony through SSR marker RM227 in 5 percent polyacrylamide gel electrophoresis and the cold resistance performance of the corresponding single strain (1-42 are randomly selected F2Generating single plants; m is DNA Ladder; CT55 is a cold sensitive lead-in system; CT34 is a cold-resistant introduction system; a is 110bp and b is 95 bp).
Detailed Description
Example 1
Cold tolerant QTL location
1. Construction of test materials and location populations
Firstly, screening 3 indica rice varieties X22, Doddi, Feng dwarf and 2 japonica rice varieties Chhomrong and original japonica No. 7, respectively hybridizing with the superior No.1 japonica rice with high yield, high quality and no cold tolerance in the north of China, backcrossing and single seed transmission selfing to construct 5 BC2F4Random introduction into the population. In the rice farm of agricultural academy of Jilin province in 2008, 450 BC are planted in each group2F4And (3) irrigating the single plant with 20cm deep underground well water at 19 ℃ for 30 days in the young ear differentiation period until all ears are completely extracted, recovering normal water temperature for irrigation, and harvesting 162 cold-resistant single plants in the booting period (shown in figure 1) after the single plant is mature and the setting percentage of the contrast super-excellent No.1 is 24.8% and the setting percentage is higher than 50%. In 2009, 162 cold-resistant individuals were bred into adult lines, and under the same cold stress treatment conditions, the cold resistance was identified, the control super-quality No.1 setting percentage was 35.1%, and the selected setting percentage was over 40% of the cold-resistant individual 132. In 2010, 132 cold-resistant single plants are planted into adult lines, the cold resistance is repeatedly identified under the same cold stress treatment condition, and finally, 84 cold-resistant lines in the booting stage are screened out from 5 families to form a selective breeding group (Table 1).
Table 15 information on the formation of selectively bred colonies and the expression of Cold tolerance (seed set under Cold stress)
2. Genotyping
Genomic DNA was extracted from each individual plant by the DNA extraction method of Temnykh et al (2000). The donor parent and the recurrent parent super-optimal SSR primers with polymorphism between No.1 are used for identifying the genotypes of different cold-resistant strains and random population strains respectively, and the average polymorphic SSR primers of 5 populations are 113. The reaction products were electrophoresed on 5% non-denaturing polyacrylamide and the reading bands were stained with genefander dye. The marker location and genetic distance of each population were referenced to Cornell SSR maps (Grammene, http:// www.gramene.org), the markers covered genome sizes varying from 1,125.0cM for Superus No. 1/Pro-japonica No. 7 to 1649.8cM for Superus No. 1/Chohmong, and the average genetic distance between adjacent markers varied from 15.2 cM to 23.7 cM.
3. Partial segregation analysis positioning QTL
Since 84 lines are composed of 5 different families and there is a difference in polymorphic markers between different families, we first developed a marker-consistent genetic linkage map according to the method of Cui et al (2015). Further, the cold-resistant QTL was located by using the segregation-based localization method provided by Cui et al (2015). The Wald value of 22.2(P is less than or equal to 0.05) is used as a standard for judging whether the QTL exists or not.
The 5 families were collectively located to 17 cold-tolerant QTLs at the booting stage, including 3 detected by the super No. 1/X22 population, 2 detected by the super No. 1/Yuanjing No. 7, 11 detected by the super No. 1/Fengdai, 2 detected by the super No. 1/Choomrong, and 4 detected by the super No. 1/Doddi (Table 2). Of these, qctt 1.3, qctt 6.7 and qctt 9.6 were detected in 2 populations and qctt 6.5 was detected in 3 populations (table 2). qCT3.12 is a newly located 1 major cold tolerance QTL with a large phenotypic effect, and is tightly linked with RM227, and the site is from the abundant allele to improve the cold tolerance of the booting stage.
TABLE 2 localization of major QTL affecting cold tolerance at booting stage using single and combined partial segregation methods
1When P is less than or equal to 0.05 and 0.01, the Wald values are 22.2 and 28.0 respectively. A: x22, B: original japonica No. 7, C: fengshi zhan, D: chhomrong, E: doddi.
(two) qCT3.12FAZIs verified by
1. Test material
Utilizes original super-excellent No. 1/Feng dwarf high generation backcross BC which is not subjected to stress treatment2F460 lines of a random population were used to validate the qct3.12 cold tolerance gene from kupffer.
2. Genotyping
The genome DNA of the super-excellent No. 1/Fengdai random strain is extracted by using a conventional CTAB method. The genotype of the strain was identified using RM227 primer (forward primer sequence: ACCTTTCGTCATAAAGACGAG, reverse primer sequence: GATTGGAGAGAAAAGAAGCC) closely linked to qCT3.12. The template DNA of different strains is amplified by adopting a conventional PCR operation flow of a 20 mu l system, and the separation of PCR products is carried out by 5 percent polypropylene gel electrophoresis.
3. Evaluation of cold-tolerant phenotype at booting stage
60 BC are planted in rice institute of agricultural academy of Jilin province in 20102F4And (4) irrigating the strain with 20cm deep underground well water at 19 ℃ for 30 days in the young ear differentiation period until all ears are completely extracted, recovering normal water temperature for irrigation, counting the maturing rate, and taking the strain maturing rate as an evaluation index.
3. Single marker analysis
According to the genotypes represented by the RM227 marker amplification bands of different strains, 60 strains of each family are divided into two groups, one group is 12 strains with a super-excellent No.1 homozygous genotype, the average maturing rate is 7.7%, the other group is 15 strains with donor Feng-dwarf homozygous genotypes, the average maturing rate is 14.2%, the difference of the average maturing rates of the two groups under cold and dry stress reaches 6.5%, the difference reaches a significant level, and resistance favorable alleles come from donor parents. This indicates that qct3.12 is a truly existing cold tolerant QTL at the booting stage, and also that RM227 is indeed tightly linked to qct3.12.
TABLE 3 utilization of Superquality No. 1/Fengdai BC2F4Random groupBody-verified cold-tolerant QTL (qCT3.12) at booting stage
(III) verification of cold resistance effect by using molecular marker RM227 closely linked with qCT3.12 as auxiliary selection
1. Test material
Cold-tolerant introduction CT34 with superb No.1 background, carrying only qCT3.12FAZ1 cold-resistant QTL is hybridized with cold-sensitive introgression line CT55 (without any cold-resistant QTL, the qCT3.12 allele is identical with that of super-excellent No. 1) of super-excellent No.1 background to construct 240 strains of F2The isolated population was the test material.
DNA extraction, PCR amplification and gel electrophoresis
Referring to the method for extracting the genomic DNA of the strain in the first step and the PCR amplification method, the genomic DNA of 240 strains was extracted and PCR amplification was performed using the close linkage marker RM227 of the qCT3.12 gene, and the reaction product was electrophoresed on 5% non-denatured polyacrylamide and stained with genefinder dye for reading.
3. Evaluation of cold-tolerant phenotype at booting stage
In 2011, 240F plants were planted in the rice institute of agricultural academy in Jilin province2And (3) irrigating the population with 20cm deep underground well water at 19 ℃ for 30 days in the young ear differentiation period until all ears are completely extracted, recovering normal water temperature for irrigation, counting the maturing rate, and taking the strain maturing rate as an evaluation index.
4. Single marker analysis
55 homozygous genotype individuals carrying abundant and short occupation genotypes are selected from the group according to genotypes represented by RM227 marked amplification bands of different individual plants, the average maturing rate is 18.5%, and the variation is 15.1% -20.6%; 62 homozygous genotype individuals with super-excellent No.1 banding patterns have the average setting percentage of 8.7 percent and the variation of 5.2 to 9.9 percent; the average setting percentage of 123 heterozygous genotype individuals is 17.7 percent, and the variation is 14.2 to 20.1 percent. Shows that the homozygous or heterozygous segment with the same size as the Fengdai is amplified according to the RM227 primer, and the single plant can be presumed to carry qCT3.12FAZCold resistant alleleThus, it was shown that the cold tolerance was cold-resistant during the booting stage, whereas it was not cold-resistant (FIG. 2). Table 4 shows the genotypes and cold tolerance (setting percentage) of the individuals corresponding to fig. 2, which indicates that the qtct 3.12 genotype can be well identified and the phenotype of the qtct 3.12 gene can be predicted by RM227 marker genotype identification. Therefore, the marker RM227 closely linked with qCT3.12 can be directly applied to cold-tolerant molecular assisted selective breeding at the booting stage of rice.
TABLE 4 Cold-tolerant introgression lines CT34 (with qCT3.12 only) from the backcross progeny of Superquality No. 1/Fengdai FAZ1 cold-resistant gene) with cold-sensitive introductive line CT55 (without any cold-resistant gene)2The population is assisted by a marker RM227 to identify the cold resistance (setting rate) performance of individuals with different genotypes
Sequence listing
<110> Shenzhen biological breeding innovation research institute of Chinese academy of agricultural sciences
<120> molecular marker of cold-tolerant gene qCT3.12FAZ of rice at booting stage and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
acctttcgtc ataaagacga g 21
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Claims (1)
1. Method for utilizing cold-resistant QTL in booting stage of riceqCT3.12 FAZ The method for identifying and breeding rice by closely linked molecular markers is characterized in that a primer pair RM227 is adopted to perform PCR amplification by taking the genome DNA of a breeding material with indica rice variety Fengdai blood margin as a template, and an amplification product is detected, if a 95bp nucleotide fragment can be amplified, the breeding material for marker detection shows cold tolerance of rice at the booting stage; the forward primer sequence of the primer pair RM227 is shown as SEQ ID No.1, and the reverse primer sequence of the primer pair RM227 is shown as SEQ ID No. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810407803.7A CN108315474B (en) | 2018-05-02 | 2018-05-02 | Cold-resistant gene qCT3.12 for rice at booting stageFAZMolecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810407803.7A CN108315474B (en) | 2018-05-02 | 2018-05-02 | Cold-resistant gene qCT3.12 for rice at booting stageFAZMolecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108315474A CN108315474A (en) | 2018-07-24 |
| CN108315474B true CN108315474B (en) | 2021-08-31 |
Family
ID=62895490
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810407803.7A Active CN108315474B (en) | 2018-05-02 | 2018-05-02 | Cold-resistant gene qCT3.12 for rice at booting stageFAZMolecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108315474B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667515A (en) * | 2013-12-31 | 2014-03-26 | 湖南农业大学 | Molecular marking method for cold-resistant major QTL (Quantitative Trait Locus) at flowering stage of indica rice |
| KR20150056709A (en) * | 2013-11-15 | 2015-05-27 | 공주대학교 산학협력단 | Specific primers for discrimination of seed longevity, and uses thereof |
| CN105505922A (en) * | 2015-12-16 | 2016-04-20 | 中农常乐（深圳）生物育种技术有限公司 | Cold-tolerance gene qCT-3-2HHZ for rice booting stage stable expression and molecular marking method thereof |
-
2018
- 2018-05-02 CN CN201810407803.7A patent/CN108315474B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150056709A (en) * | 2013-11-15 | 2015-05-27 | 공주대학교 산학협력단 | Specific primers for discrimination of seed longevity, and uses thereof |
| CN103667515A (en) * | 2013-12-31 | 2014-03-26 | 湖南农业大学 | Molecular marking method for cold-resistant major QTL (Quantitative Trait Locus) at flowering stage of indica rice |
| CN105505922A (en) * | 2015-12-16 | 2016-04-20 | 中农常乐（深圳）生物育种技术有限公司 | Cold-tolerance gene qCT-3-2HHZ for rice booting stage stable expression and molecular marking method thereof |
Non-Patent Citations (5)
| Title |
|---|
| QTL mapping and development of candidate gene-derived DNA markers associated with seedling cold tolerance in rice (Oryza sativa L.);Kim Suk-Man等;《Molecular genetics and genomics》;20140124;第289卷(第3期);第333-343页 * |
| VcZ280ML3;Ensembl;《Ensembl》;20170930;第1页 * |
| VcZ280ML5;Ensembl;《Ensembl》;20170930;第1页 * |
| VcZ280ML7;Ensembl;《Ensembl》;20170930;第1页 * |
| 寒地粳稻品种骨干亲本遗传演变及耐冷性研究;刘化龙;《中国博士学位论文全文数据库 农业科技辑》;20130115(第1期);第65页表4-2，第81-87页材料与方法 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108315474A (en) | 2018-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10064351B2 (en) | F. oxysporum F.sp. melonis race 1,2-resistant melons | |
| CN110117673A (en) | The molecular labeling of the short bar character site of cabbage type rape and its application | |
| CN110684858B (en) | Molecular marker of rice slender grain type gene and application thereof | |
| CN109486829B (en) | Rice semi-dwarf gene sd1 allele and identification method thereof | |
| CN111341384A (en) | Quantitative Trait Locus (QTL) sites of soybean and screening method thereof | |
| CN102121052B (en) | Specific molecular marker sequence for identifying recessive genic male sterility mutant gene ms 26 and its wild type allele | |
| LI et al. | Molecular improvement of grain weight and yield in rice by using GW6 gene | |
| CN111088258B (en) | Rice photo-thermo-sensitive nuclear male sterility gene tms3650 and molecular marker and application thereof | |
| CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN111676229A (en) | Maize male nuclear sterility gene ms40 and molecular marker and application thereof | |
| US10314253B2 (en) | Methods and compositions for watermelon sex expression | |
| CN108315474B (en) | Cold-resistant gene qCT3.12 for rice at booting stageFAZMolecular marker and application thereof | |
| CN112457385B (en) | Application of gene LJP1 for controlling rice growth period | |
| CN104762299B (en) | A kind of rice seedling resistant gene of salt qST2 and its molecule labelling method | |
| CN111100869B (en) | Molecular marker co-separated from rice photo-thermo-sensitive nuclear male sterility character and application | |
| CN105624277B (en) | Method for obtaining molecular marker closely linked with tobacco plant height development character | |
| CN109197569B (en) | Molecular breeding method for improving stigma exposure rate of three-line sterile line of rice | |
| CN106480061B (en) | Recombinant nucleic acid fragment RecCR023411 and detection method thereof | |
| CN106480054B (en) | Recombinant nucleic acid fragment RecCR020322 and detection method thereof | |
| CN106480047B (en) | Recombinant nucleic acid fragment RecCR020325 and detection method thereof | |
| CN109338001B (en) | Molecular marker for identifying rice semi-dwarf gene sd1 allele and dwarf gene identification method | |
| CN111073990B (en) | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof | |
| CN109338005B (en) | High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof | |
| CN109777883B (en) | Specific primer of codominant molecular marker of tomato yellow leaf curl virus Ty-2 resistance gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190626 Address after: 100081 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Applicant after: INSTITUTE OF CROP SCIENCES, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Applicant after: AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Address before: 100081 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Applicant before: INSTITUTE OF CROP SCIENCES, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Applicant before: SHENZHEN BIOLOGY BREEDING AND INNOVATION INSTITUTE, CHINESE ACADEMY OF AGRICULTURAL SCIENCES |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20180724 Assignee: Zhongnonghaidao (Shenzhen) Biotechnology Co.,Ltd. Assignor: AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Contract record no.: X2022980024192 Denomination of invention: Molecular Markers of Cold Tolerance Gene qCT3.12FAZat Booting Stage in Rice and Their Application Granted publication date: 20210831 License type: Common License Record date: 20221130 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20180724 Assignee: GUANGDONG HUAMAO GAOKE SEED Co.,Ltd. Assignor: AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Contract record no.: X2022980024646 Denomination of invention: Molecular Markers of Cold Tolerance Gene qCT3.12FAZat Booting Stage in Rice and Their Application Granted publication date: 20210831 License type: Common License Record date: 20221205 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20180724 Assignee: Jiangmen Wanfengyuan Planting Co.,Ltd. Assignor: AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Contract record no.: X2022980025384 Denomination of invention: Molecular Markers of Cold Tolerance Gene qCT3.12FAZat Booting Stage in Rice and Their Application Granted publication date: 20210831 License type: Common License Record date: 20221210 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20180724 Assignee: Shenzhen Debao meal management Co.,Ltd. Assignor: AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Contract record no.: X2023980032553 Denomination of invention: Molecular marker and application of cold tolerance gene qCT3.12FAZ in rice at booting stage Granted publication date: 20210831 License type: Common License Record date: 20230222 |