KR102150113B1 - SCAR marker for identification of kiwifruit and use thereof - Google Patents

Abstract

The present invention relates to a SCAR (Sequence Characterized Amplified Region) marker for determining kiwi variety and its use, and in more detail, a SCAR primer set for determining kiwi variety, a method for determining kiwi variety using the same, and kiwi variety discrimination including the same It is about the dragon kit.

Description

SCAR marker for identification of kiwifruit and use thereof

The present application relates to a SCAR (Sequence Characterized Amplified Region) marker for cultivar identification of kiwi and its use, and in more detail, a SCAR primer set for kiwi cultivar identification, a kiwi cultivar identification method using the same, and a kiwi cultivar identification kit including the same It is about.

Kiwi is the fruit of the deciduous vine of the family Actinidia (Morton, J. 1987. Kiwifruit. p. 293-300, "Kiwifruit: Actinidia deliciosa In: Fruits of Warm Climates, 1987"), bluefin, or Chinese Also named gooseberry. In Korea, it was first cultivated in 1977, but it is a fruit that is highly dependent on foreign countries, as the production of kiwi in 10 countries including China, Italy and New Zealand accounts for 90% of the world. Therefore, as a result of continuing research to develop independent kiwi varieties in Korea, various domestic varieties such as Jesse Gold, Halla Gold, and Haehyang, which are gold kiwi varieties, were cultivated, and the domestic production increased steadily from 3.6 billion won in 1989 to 46.2 billion won in 2010. It is a trend.

Kiwi is a fruit with a high content of vitamin C, and it contains actinidin, a protein-degrading enzyme, so it not only helps digestion, but also prevents chronic diseases and promotes health, such as phenolic components and flavonoids. Contains a lot of ingredients. In addition, green kiwi (ie, Actinidia deliciosa variety Hayward) has been attracting attention as an effective product in the area of digestion through several studies demonstrating its effectiveness (Stonehouse et al. 2012) and Chinese Patent Application No. 2967263 Reference). It has been disclosed that the effect of removing impurities of green kiwi is mainly due to dietary fiber and actinidine (enzyme) contained in green kiwi (Chang et al., 2010; Rush et al., 2002; Stonehouse et al., 2012; Drummond & Gearry 2013). ). On the other hand, gold kiwi (ie, Actinidia chinensis variety Hort16A) has not been associated with defecation so far (Ferguson 2003; Rush 2002). Gold kiwis have been known to contain little or no actinidine and less dietary fiber when compared to green kiwis. Some varieties of kiwi have been studied for immune effects (Hunter et al. 2012; Skinner 2012), and gold kiwis with low or low impurity removal effects can increase immunity, especially in children where an increase in impurity removal may not be desirable. There were also claims (Adaim 2010). As such, since nutrients and intake effects are different depending on the kiwi variety, it is required to accurately distinguish kiwi varieties.

However, since all domestically grown varieties of fruit trees are supplied in the state of seedlings, it is difficult to distinguish them in morphology, so the demand for the development of molecular labeling technology for the identification of varieties is increasing in leading fruit tree seedling companies. Accordingly, the present inventors attempted to develop a molecular label for discriminating kiwi varieties to prevent cultivar mixing of distributed seedlings and strengthen the protection rights of domestically grown varieties.

An object of the present invention is to develop a molecular label for identifying kiwi varieties, which can be used as a variety authentication technology during distribution of kiwi in Korea for the purpose of preventing variety mixing of distributed seedlings and strengthening protection rights of domestically grown varieties. .

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems that are not mentioned will be clearly understood by those of ordinary skill in the art from the following description.

Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, for a thorough understanding of the invention, various specific details, such as specific forms, compositions and processes, etc. are set forth. However, certain embodiments may be practiced without one or more of these specific details, or with other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in specific details in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, the context of “in one embodiment” or “an embodiment” expressed in various places throughout this specification does not necessarily represent the same embodiment of the invention. Additionally, particular features, shapes, compositions, or properties may be combined in one or more embodiments in any suitable manner. Unless otherwise defined in the specification, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

Unless otherwise defined in the present invention, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

In one embodiment of the present invention, the "Random Amplified Polymorphic DNA (RAPD) method" is a genome that is matched by two nucleotide sequences using a short random primer of usually 9 to 11 bp (base pair). Only the site is amplified. This method is very simple because PCR products are electrophoresed on an agarose gel to analyze the morphology of the fragments, but using it directly as a selection label for breeding is difficult in terms of efficiency and accuracy, so the analysis is simple here. It was used by converting to a DNA marker, a SCAR marker.

In one embodiment of the present invention, the term "Sequence Characterized Amplified Region (SCAR) marker" is produced by analyzing the nucleotide sequence of RAPD or Amplification Fragment Length Polymorphism (AFLP) marker bands, and the ASAP (Allele-Specific Associated Primer) method It is used as a way to check the presence or absence of a band. Since SCAR markers are relatively insensitive to the amplification environment compared to other molecular markers and can easily read the results, they are recognized as an efficient cultivar identification molecular marker with reproducibility, universality, and simplicity. Therefore, it is a more accurate and detailed primer. Can be used. On the other hand, the RAPD method has a disadvantage that it is difficult to expect reproducible experimental results because the results may vary depending on the reaction conditions. DNA markers based on PCR (polymerase chain reaction) methods such as RAPD are known to exhibit multiple polymorphisms in genetic diversity analysis. However, it is known that DNA marker technologies such as AFLP and RFLP are difficult to apply to analysis of kiwi similarity because of a very complex experimental process. Therefore, the inventors of the present application used a SCAR marker for determining kiwi varieties.

In one embodiment of the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

The present invention provides a primer represented by any one of SEQ ID NOs: 1 to 32.

In addition, the present invention provides a kit for determining kiwi variety, comprising a primer represented by any one of SEQ ID NOs: 1 to 32.

In the kit, the primer is a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 5 and 6; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 9 and 10; A primer set consisting of SEQ ID NOs: 11 and 12; A primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 19 and 20; A primer set consisting of SEQ ID NOs: 21 and 22; A primer set consisting of SEQ ID NOs: 23 and 24; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 29 and 30; Or, a primer set consisting of SEQ ID NOs: 31 and 32; It is preferable to include, and more preferably a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 11 and 12; A primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 29 and 30; Or, it includes, but is not limited to, a primer set consisting of SEQ ID NOs: 31 and 32.

The kiwi varieties above are Actinidia arguta , Bulgi, Deliung, First Emperor, Persimmon, Gammok, Golden Ball, Gold One, Gold Rush, Green Mall, Halla Gold, Hayward, Hongyang, Hort16A, Jesse Gold, Jessie Green, Mega Gold, NHK0012, NHK0013, NHK0041, NHK0042, Nokga, Octo Green, Bohwa, Book, Red Vita, Sensation Apple, Skinny Green, Songoku, Sunfl , Sweet gold (Sweetgold) may be any one selected from the group consisting of.

In addition, the present invention comprises the steps of (a) extracting genomic DNA from a sample; (b) amplifying the extracted genomic DNA with the primer of claim 1; And, (c) determining whether the genomic DNA is amplified or not; it provides a method for determining kiwi varieties comprising.

At this time, the primers are a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 5 and 6; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 9 and 10; A primer set consisting of SEQ ID NOs: 11 and 12; A primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 19 and 20; A primer set consisting of SEQ ID NOs: 21 and 22; A primer set consisting of SEQ ID NOs: 23 and 24; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 29 and 30; Or, it is preferable that it is a primer set consisting of SEQ ID NOs: 31 and 32, more preferably a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 11 and 12; A primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 29 and 30; Alternatively, it is a primer set consisting of SEQ ID NOs: 31 and 32, more preferably a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 11 and 12; A primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 29 and 30; And, it is a primer set consisting of SEQ ID NOs: 31 and 32, but is not limited thereto.

In another embodiment of the present invention, the analysis of the amplified product is performed by a DNA chip, electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement method.

Specifically, the method of extracting the genomic DNA of kiwi in step a) may be performed by a conventional method known in the art. For example, CTAB (CetylTrimethylAmmonium Bromide) method, phenol/chloroform extraction method, SDS extraction method, etc. may be used, or a commercially available DNA extraction kit may be used, but may not be limited thereto.

Specifically, in the step (b), the primer set is at least one selected from the group consisting of primer sets each having a nucleic acid sequence of SEQ ID NOs: 1 to 32 that can distinguish 31 kiwi varieties shown in Table 1. It includes. More than one set of primers, which are SCAR markers for determining kiwi varieties, can be used, and when a plurality of molecular markers are used at the same time, varieties can be more accurately identified.

The primer set is most preferably a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 11 and 12; A primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 29 and 30; And, it is a primer set consisting of SEQ ID NOs: 31 and 32, but is not limited thereto.

When DNA is amplified by one of the above primer sets, the variety may be Hongyang, Red Vita, or Skinny Green.

When DNA is amplified by two primer sets of the above primer sets, the variety is Actinidia arguta , persimmon, persimmon, golden ball, green mole, Hort16A, or Sunfl. I can.

When DNA is amplified by three primer sets among the above primer sets, the variety may be Gold One, Halla Gold, Mega Gold, NHK0042, Son Goku, or Sweetgold.

When DNA is amplified by the four primer sets among the primer sets, the variety may be Deliung, Gold Rush, Jesse Green, NHK0012, NHK0013, NHK0041, or Sensation Apple.

When DNA is amplified by five primer sets among the above primer sets, the variety may be a drop, First Emperor, Jessie Gold, Nougat, or Book.

When DNA is amplified by six or more of the above primer sets, the variety may be Hayward, Octogreen, or Bohwa.

In addition, the amplification of genomic DNA in step (b) may be performed by PCR (Polymerase Chain Reaction). PCR may be performed using a PCR reaction mixture containing components known to be necessary for a PCR reaction in the art or using a commercially available kit. The PCR reaction mixture may include genomic DNA extracted from kiwi, the SCAR primer set of the present application, an appropriate amount of DNA polymerase, dNTP, PCR buffer, and water. The PCR buffer solution may include Tris-HCl, MgCl2, KCl, or the like, but may not be limited thereto.

The amplified target sequence may be labeled with a detectable label. For example, the labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but may not be limited thereto. Preferably, the labeling material may be Cy-5 or Cy-3. When amplifying the target sequence, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence may be labeled with a detectable fluorescent labeling material. In addition, when a radioactive material is used for labeling, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution when performing PCR, the amplification product is synthesized, and the radioactive isotope may be incorporated into the amplification product to be radiolabeled. Alternatively, the amplified product may be visualized using a silver dyeing kit (Bioneer, Daejeon, Korea).

Specifically, the analysis of the DNA product amplified in step (c) can be performed by a conventional method known in the art. For example, capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement Alternatively, it may be performed through phosphorescence measurement, but may not be limited thereto.

For example, capillary electrophoresis may be performed to detect an amplification product, and may be performed using an ABi sequencer, but may not be limited thereto. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product. For example, 6% acrylamide gel electrophoresis can be used. For example, 1 to 5%, preferably 1.4% agarose gel electrophoresis can be used. In addition, the fluorescence measurement method is to label Cy-5 or Cy-3 at the 5'-end of the primer and perform PCR, and the target sequence is labeled with a detectable fluorescent labeling material, and the thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution when performing PCR, and then using a radioactivity measuring instrument such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

When the amplified DNA product is analyzed using gel electrophoresis, the amplified product is electrophoresed on an agarose gel or an acrylamide gel, and the band can be identified by ethidium bromide (EtBr), silver staining, etc. have.

The present application may be better understood by the following examples, and the following examples are for illustrative purposes of the present application, and are not intended to limit the scope of protection defined by the appended claims.

Since the SCAR marker for determining kiwi varieties according to the present application can accurately identify more than 31 varieties of kiwi, it can be used as a variety authentication technology for prevention of variety mixing in distribution seedlings and distribution of domestic seedlings. It can be used to strengthen protection rights. In addition, the SCAR marker can be used as a more precise and detailed molecular label because it is not affected by the environment such as reaction conditions compared to other PCR markers.

1 is a schematic diagram showing the development process of the SCAR marker for determining kiwi varieties according to the present application. Specifically, the marker of the present application extracts genomic DNA from Kiwi 31 cultivar, searches for polymorphic sites through analysis using the RAPD method, compares each cultivar to select an effective DNA specific fragment, and then selects the selected DNA specific fragment. It was developed by cloning, sequencing, and synthesizing a primer specific for the label again. The SCAR marker of the present application thus developed is a simple, rapid, reproducible and highly reliable molecular marker.
Figure 2 shows the gel electrophoresis results using a SCAR marker for determining kiwi varieties according to an embodiment of the present application.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

[Example]

Test material and DNA extraction

In this example, 31 varieties as shown in Table 1 were used.

number kind One Actinidia arguta (26-9-8) 2 Drops 3 Deliung 4 Frist Emperor 5 Yellow 6 Dark green 7 Golden Ball 8 Gold One 9 Gold rush 10 Green Mall 11 Halla Gold 12 Hayward 13 Hongyang 14 Hort16A 15 Jesse Gold 16 Jesse Green 17 Mega Gold 18 NHK0012 19 NHK0013 20 NHK0041 21 NHK0042 22 Rust 23 Octogreen 24 Treasure 25 Gemstone 26 Red Vita 27 Sensation Apple 28 Skinny green 29 Songoku 30 Sunfl 31 Sweetgold

Whole DNA isolation

Young leaves of kiwi were collected and genomic DNA was extracted using the DNeasy plant mini kit (Qiagen, Valencia, CA, USA). The extracted DNA was confirmed by electrophoresis on a 0.8% agarose gel, and the amount of DNA was quantified with a NanoDrop spectrophotometer (Thermo Fisher Scientific, MA, USA), and then diluted to a concentration of 5 ng·μL-1 and used for PCR analysis.

RAPD (Random Amplified Polymorphic DNA) analysis

Primers composed of bases prepared by Operon (Operon Technologies, Alameda, CA, USA) and University of British Columbia (UBC, Vancouver, BC, Canada) to select suitable primers for Kiwi RAPD analysis (Operon series; UBC conifer kit) Was tested. Random primers selected in the primer assay were used to select RAPD markers indicating polymorphism between varieties. PCR conditions were: 20 ng of genomic DNA, 1×PCR buffer (Genetbio, Daejeon, Korea), 5 pmol random primer, 200 μM dNTP, 3 mM MgCl ₂ and 0.5 units of Taq DNA polymerase (Genetbio) in a total of 12.5 μL of reaction solution. ) Was added. The PCR reaction was carried out with the following program using a thermocycler (thermocycler, C-1000, Bio-Rad Laboratories, Hercules, CA, USA): initial denaturation at 94°C for 5 minutes, 45 seconds at 94°C, 37 Denature, annealing, and extension were repeated 10 times at ℃ 45 seconds, 72 ℃ for 2 minutes, respectively, and then 45 seconds at 94 ℃, 45 seconds at 42 ℃, 2 minutes at 72 ℃ Repeated 30 times. Finally, the reaction was terminated after treatment at 72° C. for 5 minutes. The amplified PCR product was stained with EtBr (ethidium bromide) and then electrophoresed for 3 hours at 150 V on a 1.4% agarose gel to search for polymorphic bands between varieties.

For the kiwi varieties shown in Table 1, Operon and UBC conifer kit primers were analyzed to select primers having a large number of polymorphic bands and a clear band. RAPD analysis was performed on 31 kiwi varieties using the selected primers.

Variety-specific selection of RAPD marker to SCAR (Sequence Characterized Amplified Region) marker conversion

The selected kiwi variety-specific RAPD band was converted to a SCAR marker through cloning and sequencing with a size of 1,000 bp or less. For the nucleotide sequence analysis of the breed-specific RAPD marker, the selected DNA band was cut and purified using a QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, USA). This was put into a pCR2.1-TOPO vector using a TOPO-TA cloning system (Invitrogen, Carlsbad, CA, USA), transformed into E. coli TOP10, and then a strain into which DNA was inserted was selected. Plasmid DNA was isolated from this strain, and the entire nucleotide sequence of the inserted DNA was analyzed using an automatic DNA analyzer (ABI 3730xl, Applied Biosysyems, CA, USA). Based on the sequencing result of the RAPD marker, a SCAR primer of 20-24 mer size was created with or without 10 bases of the selection primer using the Primer3 (http://frodo.wi.mit.edu) program. . At least 4 combinations of SCAR primers per 1 RAPD marker were assayed. The PCR reaction was performed in a total of 15 μL reaction solution with 40 ng of genomic DNA, 200 μM dNTP, 5 pmol SCAR primer, 1×PCR buffer (Genetbio), and 0.5 units of Hot-start Taq DNA polymerase to minimize non-specific DNA amplification during PCR reaction. (Genetbio) was added. The PCR temperature cycle was repeated 30 times at 95° C. for 10 minutes after denaturing the template DNA at 95° C. for 30 seconds, at 63-65° C. for 30 seconds, and at 72° C. for 1 minute, followed by treatment at 72° C. for 5 minutes, and the reaction was terminated. . The amplified PCR product was confirmed by electrophoresis on a 1.4% agarose gel. As a result, 16 kinds of SCAR markers were developed, and the kiwi variety could be identified according to the presence or absence of PCR amplification products for each variety and the size of the amplified band.

Tables 2 and 3 show the results of discriminating 31 kiwi varieties using 16 SCAR markers. In the table, a result indicated by 1 indicates that a specific marker was observed, and a result indicated by 0 indicates that a specific marker was not observed.

SCAR marker Variety number One 2 3 4 5 6 7 8 9 10 11 12 13 14 15 KB08_182 0 0 0 One One 0 0 One One 0 0 One 0 0 One KK08_287 0 0 One 0 0 0 0 0 0 0 0 One 0 0 0 KG19_295 0 One One 0 0 One 0 0 0 0 0 One 0 0 0 KN15_316 0 0 0 0 0 0 0 0 0 0 0 One 0 0 0 KJ08_319 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 KG01_411 One One 0 0 0 0 0 0 0 One 0 0 0 0 0 KF07_433 0 One 0 0 0 0 0 0 0 0 0 One 0 0 0 KG01_443 One 0 0 0 0 0 0 0 0 0 0 0 0 0 0 KT08_447 0 0 One One One One One 0 One One One One One One One KG09_468 0 0 0 0 0 0 0 One 0 0 0 0 0 0 One KK08_474 0 0 One One 0 One 0 0 0 0 One One 0 0 0 KG09_477 0 0 One One 0 0 One 0 0 0 One 0 0 0 One KG01_596 0 One 0 0 0 0 0 0 0 0 0 One 0 0 0 KL01_764 0 One 0 One 0 0 0 0 0 0 0 One 0 One One KL03_775 0 0 0 0 0 0 0 One One 0 One 0 0 0 One KA11_774-1 0 0 One One One One 0 0 One 0 One 0 0 0 One KA11_774-2 0 One One One 0 One One One One One 0 One One One 0 Number of amplified fragments 2 6 7 7 3 5 3 4 5 3 5 10 2 3 7

SCAR marker Variety number 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 KB08_182 0 0 One One One 0 0 One 0 One 0 0 0 One One One KK08_287 0 0 0 0 One 0 0 One One One 0 0 0 0 0 0 KG19_295 0 0 0 0 One One 0 One One One 0 0 0 0 0 0 KN15_316 0 0 0 0 0 0 0 0 One 0 0 0 0 0 0 0 KJ08_319 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 One KG01_411 0 0 0 0 0 0 One 0 0 0 0 0 One 0 0 0 KF07_433 0 0 0 0 0 0 0 One One 0 0 0 0 0 0 0 KG01_443 0 0 0 0 0 0 One 0 0 0 0 0 0 0 0 0 KT08_447 One One One One One One One One One One One One 0 One One One KG09_468 0 0 0 One 0 0 0 0 0 0 0 0 0 0 0 One KK08_474 One 0 0 0 One 0 0 One One One 0 0 0 0 0 0 KG09_477 One 0 One One One One One 0 0 0 0 One 0 0 0 0 KG01_596 0 0 0 0 0 0 0 One One One 0 0 0 0 0 0 KL01_764 One One 0 0 0 0 0 One One One 0 0 0 One 0 0 KL03_775 0 0 One One 0 0 0 0 0 0 0 One 0 0 0 One KA11_774-1 One One 0 One 0 One One 0 0 0 One One 0 One 0 One KA11_774-2 One One One 0 One One One One One One 0 One 0 0 One 0 Number of amplified fragments 6 4 5 6 7 5 6 9 9 8 2 5 One 4 3 6

It was not necessary to use all 16 types of markers for discrimination of 31 kiwi varieties. Primer sets KB08_182, KK08_287, KG19_295, KN15_316, KJ08_319, KG01_411, KF07_433, KG01_443, KT08_447, KG09_468, KK08_474, KG09_477, KG01_596, KL01_764, and KA11_774, respectively, and SEQ ID NOs: 1775 and 2774, and KL01_774, respectively. 11 and 12, 13 and 14, 15 and 16, 17 and 18, 25 and 26, 27 and 28, 29 and 30, and 31 and 32) were used to determine the cultivars of 31 kiwis. It is shown in 4 and Table 5.

SCAR marker Variety number One 2 3 4 5 6 7 8 9 10 11 12 13 14 15 KB08_182 0 0 0 One One 0 0 One One 0 0 One 0 0 One KK08_287 0 0 One 0 0 0 0 0 0 0 0 One 0 0 0 KN15_316 0 0 0 0 0 0 0 0 0 0 0 One 0 0 0 KG01_411 One One 0 0 0 0 0 0 0 One 0 0 0 0 0 KF07_433 0 One 0 0 0 0 0 0 0 0 0 One 0 0 0 KG01_443 One 0 0 0 0 0 0 0 0 0 0 0 0 0 0 KG09_477 0 0 One One 0 0 One 0 0 0 One 0 0 0 One KG01_596 0 One 0 0 0 0 0 0 0 0 0 One 0 0 0 KL01_764 0 One 0 One 0 0 0 0 0 0 0 One 0 One One KL03_775 0 0 0 0 0 0 0 One One 0 One 0 0 0 One KA11_774-1 0 0 One One One One 0 0 One 0 One 0 0 0 One KA11_774-2 0 One One One 0 One One One One One 0 One One One 0 Number of amplified fragments 2 5 4 5 2 2 2 3 4 2 3 7 One 2 5

SCAR marker Variety number 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 KB08_182 0 0 One One One 0 0 One 0 One 0 0 0 One One One KK08_287 0 0 0 0 One 0 0 One One One 0 0 0 0 0 0 KN15_316 0 0 0 0 0 0 0 0 One 0 0 0 0 0 0 0 KG01_411 0 0 0 0 0 0 One 0 0 0 0 0 One 0 0 0 KF07_433 0 0 0 0 0 0 0 One One 0 0 0 0 0 0 0 KG01_443 0 0 0 0 0 0 One 0 0 0 0 0 0 0 0 0 KG09_477 One 0 One One One One One 0 0 0 0 One 0 0 0 0 KG01_596 0 0 0 0 0 0 0 One One One 0 0 0 0 0 0 KL01_764 One One 0 0 0 0 0 One One One 0 0 0 One 0 0 KL03_775 0 0 One One 0 0 0 0 0 0 0 One 0 0 0 One KA11_774-1 One One 0 One 0 One One 0 0 0 One One 0 One 0 One KA11_774-2 One One One 0 One One One One One One 0 One 0 0 One 0 Number of amplified fragments 4 3 4 4 4 3 5 6 6 5 One 4 One 3 2 3

FIG. 2 is a KB08_182 SCAR marker having a size of 182 bp, respectively, and 774 bp and 892 bp, shown only in some of the 31 kiwi varieties, identified using the primer sets of SEQ ID NOs: 1 and 2 and the primer sets of SEQ ID NOs: 31 and 32. This is the result of electrophoresis of the size KA11_774 SCAR marker.

Table 6 below is information on the SCAR primer set for determining kiwi varieties of the present application.

Selection RAPD marker SCAR marker order
number Primer nucleotide sequence (5'→3') Amplification product size (bp) OPB08_182 KB08_182 One
2 F: GTCCACACGGAGACAGTTGACC
R: GTCCACACGGCCTTAAATACTCA 182 OPK08_335 KK08_287 3
4 F: ACTGGGTGAGAGGAACTTAGTCAC
R: GAACATGGGTTCAAACAGAACTTT 287 OPG19_295 KG19_295 5
6 F: GTCAGGGCAACAAGGTGTGTAC
R: GTCAGGGCAATGACTAGAGAAAAT 295 OPN15_316 KN15_316 7
8 F: CAGCGACTGTATGGTATAGACATG
R: CAGCGACTGTGGATGTCTTTATC 316 OPJ08_319 KJ08_319 9
10 F: CATACCGTGGTGGCAAAATGTTGA
R: CATACCGTGGAGAGAGCGAGAG 319 OPG01_443 KG01_411 11
12 F: CTACGGAGGACAAATCGAGTTC
R: GAGTAATGAGCAACAGAGCAAGTC 411 OPF07_433 KF07_433 13
14 F: CCGATATCCCTTGATCATAAAAAAATG
R: CCGATATCCCATCCTTCCCCACC 433 OPG01_443 KG01_443 15
16 F: CTACGGAGGACAAATCGAGTTC
R: CTACGGAGGAGGAGGAAAGCA 443 OPT08_447 KT08_447 17
18 F: AACGGCGACATGATAGGCTAGAC
R: AACGGCGACACTAATTGTGGGGT 447 OPG09_468 KG09_468 19
20 F: CTGACGTCACCAACAAATTTGCA
R: CTGACGTCACATACCTTAGAAAAA 468 OPK08_474 KK08_474 21
22 F: GAACACTGGGATTGGGTTCCG
R: GAACACTGGGCATGGAGATGTT 474 OPG09_503 KG09_477 23
24 F: GAACGTTGAATTGGTAGACAGCTA
R: GTCACGGTTCAATAACGGTTG 477 OPG01_596 KG01_596 25
26 F: CTACGGAGGAGCACACCAAACT
R: CTACGGAGGAGAATGGTGGTCA 596 OPL01_791 KL01_764 27
28 F: GGCATGACCTGACACGATTAAAA
R: ACGAAACCCTAAGAAAATCACAAG 764 OPL03_884 KL03_775 29
30 F: CCAGCAGCTTATTCAACAAAGGTC
R: GCATCATAATTAAAAGTGCGGTAA 775 OPA11_903 KA11_774 31
32 F: AGCCACCACTACCCATCTACTATC
R: CAATCGCCGTTATTGCTACTGAG 774, 892

The SCAR primer sets for determining kiwi varieties according to the present application are used as a primer set for DNA amplification, and preferably may be used as a set described in Table 6. In addition, when one or more primer sets are used in combination, the kiwi variety can be more accurately identified. In addition, the primer may include a sequence in which a base sequence is added, deleted, or substituted in SEQ ID NO: 1 to SEQ ID NO: 32. In Table 6, F denotes a forward primer, and R denotes a reverse primer.

More preferably, 11 or more of the primer sets listed above may be used in combination (see Table 4 and Table 5).

As described above, specific parts of the present invention have been described in detail, and it is obvious that these specific techniques are only preferred embodiments and are not intended to limit the scope of the present invention to those of ordinary skill in the art. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> REPUBLIC OF KOREA (MANAGEMENT:RURAL DEVELOPMENT ADMINISTRATION) <120> SCAR marker for identification of kiwifruit and use thereof <130> 0 <160> 32 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 1 gtccacacgg agacagttga cc 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 2 gtccacacgg ccttaaatac tca 23 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 3 actgggtgag aggaacttag tcac 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 4 gaacatgggt tcaaacagaa cttt 24 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 5 gtcagggcaa caaggtgtgt ac 22 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 6 gtcagggcaa tgactagaga aaat 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 7 cagcgactgt atggtataga catg 24 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 8 cagcgactgt ggatgtcttt atc 23 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 9 cataccgtgg tggcaaaatg ttga 24 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 10 cataccgtgg agagagcgag ag 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 11 ctacggagga caaatcgagt tc 22 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 12 gagtaatgag caacagagca agtc 24 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 13 ccgatatccc ttgatcataa aaaaatg 27 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 14 ccgatatccc atccttcccc acc 23 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 15 ctacggagga caaatcgagt tc 22 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 16 ctacggagga ggaggaaagc a 21 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 17 aacggcgaca tgataggcta gac 23 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 18 aacggcgaca ctaattgtgg ggt 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 19 ctgacgtcac caacaaattt gca 23 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 20 ctgacgtcac ataccttaga aaaa 24 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 21 gaacactggg attgggttcc g 21 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 22 gaacactggg catggagatg tt 22 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 23 gaacgttgaa ttggtagaca gcta 24 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 24 gtcacggttc aataacggtt g 21 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 25 ctacggagga gcacaccaaa ct 22 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 26 ctacggagga gaatggtggt ca 22 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 27 ggcatgacct gacacgatta aaa 23 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 28 acgaaaccct aagaaaatca caag 24 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 29 ccagcagctt attcaacaaa ggtc 24 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 30 gcatcataat taaaagtgcg gtaa 24 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 31 agccaccact acccatctac tatc 24 <210> 32 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 32 caatcgccgt tattgctact gag 23

Claims (15)

A first primer set or a second primer set,
The first primer set is a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 5 and 6; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 9 and 10; A primer set consisting of SEQ ID NOs: 11 and 12; A primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 19 and 20; A primer set consisting of SEQ ID NOs: 21 and 22; A primer set consisting of SEQ ID NOs: 23 and 24; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 29 and 30; And a primer set consisting of SEQ ID NOs: 31 and 32,
The second primer set includes a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 11 and 12; A primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 23 and 24; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 29 and 30; And a primer set consisting of SEQ ID NOs: 31 and 32. A primer set for determining kiwi varieties. A kit for determining kiwi varieties, comprising the primer set of claim 1. delete delete The method of claim 2,
The kiwi varieties are Actinidia arguta , Bulgari, Deliung, First Emperor, Persimmon, Gammok, Golden Ball, Gold One, Gold Rush, Green Mall, Halla Gold, Hayward, Hongyang, Hort16A , Jesse Gold, Jesse Green, Mega Gold, NHK0012, NHK0013, NHK0041, NHK0042, Nokga, Octogreen, Bohwa, Bohok, Red Vita, Sensation Apple, Skinny Green, Songoku, Sunfl, A kit for determining kiwi varieties, which is one selected from the group consisting of Sweetgold. (a) extracting genomic DNA from the sample;
(b) amplifying the extracted genomic DNA with the primer set of claim 1; And,
(c) determining whether the genomic DNA is amplified or not; including, a method of determining kiwi varieties. The method of claim 6,
The primer set,
A primer set consisting of SEQ ID NOs: 1 and 2;
A primer set consisting of SEQ ID NOs: 3 and 4;
A primer set consisting of SEQ ID NOs: 5 and 6;
A primer set consisting of SEQ ID NOs: 7 and 8;
A primer set consisting of SEQ ID NOs: 9 and 10;
A primer set consisting of SEQ ID NOs: 11 and 12;
A primer set consisting of SEQ ID NOs: 13 and 14;
A primer set consisting of SEQ ID NOs: 15 and 16;
A primer set consisting of SEQ ID NOs: 17 and 18;
A primer set consisting of SEQ ID NOs: 19 and 20;
A primer set consisting of SEQ ID NOs: 21 and 22;
A primer set consisting of SEQ ID NOs: 23 and 24;
A primer set consisting of SEQ ID NOs: 25 and 26;
A primer set consisting of SEQ ID NOs: 27 and 28;
A primer set consisting of SEQ ID NOs: 29 and 30; And
The method of determining kiwi varieties comprising a primer set consisting of SEQ ID NOs: 31 and 32. delete The method of claim 6,
The primer,
A primer set consisting of SEQ ID NOs: 1 and 2;
A primer set consisting of SEQ ID NOs: 3 and 4;
A primer set consisting of SEQ ID NOs: 7 and 8;
A primer set consisting of SEQ ID NOs: 11 and 12;
A primer set consisting of SEQ ID NOs: 13 and 14;
A primer set consisting of SEQ ID NOs: 15 and 16;
A primer set consisting of SEQ ID NOs: 23 and 24;
A primer set consisting of SEQ ID NOs: 25 and 26;
A primer set consisting of SEQ ID NOs: 27 and 28;
A primer set consisting of SEQ ID NOs: 29 and 30; And
The method of determining kiwi varieties comprising a primer set consisting of SEQ ID NOs: 31 and 32. The method of claim 6,
In the case of amplification of DNA by the primer set, the variety was selected from Actinidia arguta , Bulgi, Deliung, First Emperor, Gamwang, Gamnok, Golden Ball, Gold One, Gold Rush, Green Mall, Halla Gold, Hayward, Hongyang, Hort16A, Jesse Gold, Jesse Green, Mega Gold, NHK0012, NHK0013, NHK0041, NHK0042, Nokga, Octo Green, Bohwa, Boho, Red Vita, Sensation Apple, Skinny Green , Songoku (Songoku), Sunfl (Sunfl) or sweet gold (Sweetgold) to determine, a method of determining kiwi varieties. delete delete delete delete delete

Images