KR100998571B1 - DNA marker for discrimination of Angelica decursiva Franch. et Savatier=Peucedanum decursivum Maxim., Peucedanum praeruptorum Dunn. and Anthricus sylvestris L. Hoffman - Google Patents

Abstract

The present invention is the body herbs [ Angelica decursiva Franch. et Savatier (= Peucedanum decursivum Maxim.)], Peucedanum praeruptorum Dunn.) And the Anthricus sylvestris (L.) Hoffman) is a genetic marker for the identification of varieties, specifically, the species specific to the body sprouts, baekhwajeon and jeonjeonho selected by the analysis of the gene nucleotide sequence selected from The present invention relates to a method for discriminating varieties of body sprouts, white pear pears and tortoises using a discriminating primer, and a kit for discriminating body sprouts, pear pears and tortoises. Variety determination method of the present invention can be utilized to prevent the misuse, misuse and distribution of unreasonable products of the horticulture.

Varieties of Herbs, White Flower, Earthen Lake, Genetic Markers and Varieties

Description

DNA marker for discrimination of Angelica decursiva Franch. et Savatier (= Peucedanum decursivum Maxim.), Peucedanum praeruptorum Dunn. and Anthricus sylvestris (L.) Hoffman}

The present invention is the body herbs [ Angelica decursiva Franch. et Savatier (= Peucedanum decursivum Maxim.)], Peucedanum praeruptorum Dunn.) And the Anthricus sylvestris (L.) A genetic marker for discriminating varieties of Hoffman).

Many herbal medicines that are produced and distributed in Korea are often mixed or misused due to their inaccurate origin or similar names. In addition, the countries that use herbal medicines such as Korea, China, and Japan define the origin of medicinal plants differently, and Korea, which relies on imports for more than 80%, is directly exposed to such misuse and misuse. Traditionally, differentiation methods related to the classification and origin of mixed and misused medicinal herbs have been used in terms of sensory, physicochemical, cytological and physiological tests in terms of morphological perspective. it's difficult. This is because the variation in composition between each individual is severe and shows a big difference depending on the breeding method, harvesting time, growth environment, and the site of the medicine. Recently, the hors d'oeuvre is the most controversial herbal medicine in the herbal medicine distribution market.

Jeonho is the perennial herbaceous herb (Umbelliferae), or Angelica decursiva Franch. et Savatier or Peucedanum decursivum Maxim.) or Peucedanum praeruptorum D _{UNN .} [Korean Standards for Herbal Medicine, 2008]. However, at present, in the domestic medicine market, almost no body herb is distributed and it is an antler , an antler and a plant, an anthem named Anthricus. The roots of sylvestris Hoffman are mainly distributed. Botanical name Jeonho is a Chinese herb that is used as a medicinal substance assam in China. It is known that the plant name Jeonho was circulated and misused as a similar product of Jeonho, and was mixed and misused.

The development of differentiation markers of medicinal plants or herbal medicines mainly involves the discrimination of morphological characteristics or the distinction between two species (Park CG et. al . , Korean J. Medicinal Crop Sci . 15: 1-5, 2007), or research to develop genetic markers for identifying specific varieties or products among various varieties (Wang J et. al . , Planta Med . 67: 781-783, 2001). The development of these gene discrimination markers is mainly based on sequence comparison of specific regions such as internal transcribed spacers (ITS) or polymorphic analysis of whole genomic genes such as random amplification of polymorphic DNA (RAPD). characterized amplified region. The RAPD method is the most commonly used method because of the ease and simplicity of analysis at various genome levels, but has a disadvantage of poor reproducibility according to analysis conditions (Bang KH et. al . , Koidz . Korean J. Medicinal Crop Sci . 11: 268-273, 2003). Therefore, in order to compensate for the above disadvantages, SCAR primers based on species-specific nucleotide sequences are analyzed by analyzing nucleotide sequences of specific amplification products obtained through RAPD analysis (Paran I & Michelomore RW, Theor . Appl . Genet . . 85: 985-993, 1993).

Accordingly, the present inventors can distinguish body sprouts and white flowers, as well as white flowers and fake soils, by analyzing the ITS sequences of body herbs, white flowers, and tori lakes and sequencing of RAPD-specific amplified DNA bands. The present invention has been completed by developing a multi-species simultaneous gene differentiation marker derived from SCAR, and confirming that the genetic differentiation markers can be usefully used for preventing misuse, misuse and circulation of whole products.

An object of the present invention is a body herb [ Angelica decursiva Franch. et Savatier (= Peucedanum decursivum Maxim.)], Peucedanum praeruptorum Dunn.) And the Anthricus sylvestris (L.) To provide a polynucleotide for breed discrimination of Hoffman).

Another object of the present invention is to provide a primer pair selected from among the polynucleotides for discriminating the above-mentioned body sprouts, white pears and tortoises, and capable of amplifying the polynucleotides.

Another object of the present invention is to provide a kit for discriminating varieties of body sprouts, baekhwajeon and jeonho lake comprising the primer pair.

It is another object of the present invention to provide a method for discriminating varieties of body sprouts, baekhwa jeonho and jeonhoho by using the primer pair.

In order to achieve the above object, the present invention is a body sprout [ Angelica decursiva Franch. et Savatier (= Peucedanum decursivum Maxim.), Peucedanum praeruptorum Dunn. and Anthricus sylvestris (L.) Provides a polynucleotide for breed identification of Hoffman).

In addition, the present invention can be amplified the polynucleotide consisting of 15 to 50 consecutive nucleotides, selected from the polynucleotide for discriminating the body sprouts, baekhwajeon and jeonho cultivation, body sprouts, baekhwajeon and toe Provide primer pairs for cultivar discrimination.

In addition, the present invention provides a kit for discriminating the body sprouts, baekhwajeon and jeonhohoe varieties comprising the primer pair for judging the body sprouts, baekhwajeonho and jeonjeonho varieties.

In addition, the present invention provides a method for determining the varieties of body sprouts, baekhwajeon and jeonhoho by using the primer for judging the body sprouts, baekhwajeonho and jeonjeonho varieties.

Hereinafter, the term used by this invention is demonstrated.

'Multiplex PCR' is a method of amplifying a plurality of target genes in the same reaction solution by using a plurality of primer pairs simultaneously. In this case, the interaction of multiple primers should be calculated to create a primer combination in which the primers do not form a dimer. In addition, multiple PCR product sizes should be sufficiently distinguishable in agarose gels.

Hereinafter, the present invention will be described in detail.

The present invention is a body sprout [ Angelica decursiva Franch. et Savatier (= Peucedanum decursivum Maxim.)], Peucedanum praeruptorum Dunn.) And the Tozan Arc ( Anthricus) sylvestris (L.) Provides a polynucleotide for breed identification of Hoffman).

Specifically, the present invention provides a polynucleotide for discriminating the cultivars of Toho Lake described in SEQ ID NO: 5.

The present invention also provides a polynucleotide for discriminating whitening cultivars according to SEQ ID NO.

In addition, the present invention provides a polynucleotide for discriminating the varieties of the body sprouts and whitening buds described in SEQ ID NO: 28.

In the embodiment of the present invention, the tortue-specific ITS gene described in SEQ ID NO: 5, which is specifically present in the body sprouts, Baekhun ho, and Tohwang ho, respectively (see FIG. 1), and the buds and bleaching of SEQ ID NOs: 28 and 29, respectively After obtaining the gene-specific gene (see Fig. 2) through the ITS sequence analysis method and the analysis method using RAPD primers of SEQ ID NO: 8 to 27, SEQ ID NO: 6 or 7 and SEQ ID NO: 2 of the present invention in the base sequence Species-specific ITS amplification primer pairs and species-specific SCAR primer pairs of SEQ ID NOs: 30 to 34 were prepared. The SCAR primer pairs are designed to amplify species-specific genes. Actually, the plant DNA of the body sprouts, white pears, and tortoises using the ITS amplification primer pairs and the SCAR primer pairs was expected to have a size expected. It was confirmed that the production of a single amplification product (see FIGS. 1, 3 and 4). Specifically, in the case of the Toho specific ITS 556 S primer (SEQ ID NO: 6) and the ITS4 primer of SEQ ID NO: 2, and in the case of the Toho specific ITS 273 S primer (SEQ ID NO: 7) and the ITS4 primer of SEQ ID NO: 2 It was confirmed that amplification products of 556 bp and 273 bp size were specifically generated (see FIGS. 1B and 1C). In addition, the S and AS SCAR primer pairs (see FIG. 3A) prepared from the body sprout specific amplification product (JA16-1; see FIG. 2A) by OPA16 RAPD primers are common to the body sprouts and the pear blossoms except for the Tojeon lake. An amplification product of 363 bp size was seen (see FIG. 3B). The JA16-1 S and AS primer pairs are difficult to use for differentiating the body sprouts, but may be used for the discrimination between the body tofu and the white wares which are similar to the tojeonho and the genuine hokkaido. In addition, S and AS 1 or AS 2 SCAR primers (Fig. 4a) prepared from about 600 bp whitening signal specific amplification products (JA17-2; see Fig. 2b) by OPA17 RAPD primer (Fig. 4a), respectively, 145 bp (Fig. DNA fragments were specifically amplified exactly whitening at size 305 bp (see FIG. 4C). The JA17-2 S primer and the JA17-2 AS 1 or JA17-2 AS 2 primer may be used for discriminating white flowers.

As such, a pair of primers for discriminating a variety of the sequences selected specifically from the sequences described in SEQ ID NOs: 5, SEQ ID NOs: 28, and 29 of the present invention are each or two or more depending on the variety to be discriminated. It can be used by mixing.

Specifically, multiplex PCR was performed by combining primer sets as shown below to determine species and incorporation of aliquots in a single test. It was confirmed that the markers for the simultaneous identification of multiple varieties that can discriminate not only all types of birds at the same time, but also discriminate the alien tones.

Primer set combinations:

1) A pair of primer for amplification of whitening signal of JA17-2 S and AS 1 SCAR primers (145 bp), and a pair of JA16-1 S and AS SCAR primers (363 bp) that can distinguish body sprouts and whites from native soil And primer pairs for tomic acid specific amplification of ITS 273 S and ITS4 primers (273 bp);

2) A pair of primer pairs for amplification of whitening signal of a JA17-2 S and AS 2 SCAR primer (305 bp), and a pair of JA16-1 S and AS SCAR primers (363 bp) that can distinguish a body sprout and a white flower from a native soil And primer pairs for atomic arc specific amplification of ITS 273 S and ITS4 primers (273 bp).

In addition, the present invention can be amplified the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the polynucleotide for discriminating the body sprouts, baekhwajeonho and Tohoho cultivar, body sprouts, baekhwajeonho and Tohoho cultivars Provide a primer pair for discrimination.

Specifically, there is provided a pair of primers for discriminating one or more varieties of body sprouts, baekhwa horsoon and tortoise cultivar selected from the group consisting of:

1) a pair of primers for discriminating native cultivars capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequences set forth in SEQ ID NO: 5;

2) a pair of primers for the identification of whitening cultivars capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequences set forth in SEQ ID NO: 29; And,

3) A pair of primers for identifying a variety of varieties of a body sprout and baekhwahoe that can amplify the polynucleotide consisting of 15 to 50 contiguous nucleotides, selected from the sequences set forth in SEQ ID NO: 28.

The primer pair of 1) is described in SEQ ID NO: 6 or SEQ ID NO: 7 and SEQ ID NO: 2, the primer pair of 2) is described in SEQ ID NO: 32 and SEQ ID NO: 33 or SEQ ID NO: 34, The primer pair of 3) is set forth in SEQ ID NO: 30 and SEQ ID NO: 31.

If the length of the primer pairs is too short, it is not specific to the desired sequence, and if it is too long, they may be mismatched, so it is preferable to have a size of 16 to 35 bp, more preferably 16 to 25 bp. However, it is not particularly limited thereto.

In the embodiment of the present invention ITS sequence analysis method for the nucleotide sequence of the species-specific genes (see Fig. 1) of SEQ ID NO: 5, SEQ ID NO: 28 and SEQ ID NO: 29 which are specifically present in the soil, body sprouts and whitening And a pair of primers for amplifying species-specific ITS of SEQ ID NO: 6 or 7, and SEQ ID NO: 2 of SEQ ID NO: 6 to SEQ ID NO: 2 and SEQ ID NO: 2 of the present invention within the nucleotide sequence after obtaining through the analysis method using the RAPD primer of SEQ ID NO: 8 to 27 Species-specific SCAR primer pairs were prepared. The SCAR primer pairs are designed to amplify the species-specific genes. Actually, the plant DNA of the body sprouts, white pears, and tortoises using the ITS amplification primer pairs and the SCAR primer pairs was expected to have a size expected. It was confirmed that the production of a single amplification product (see FIGS. 1, 3 and 4).

In addition, a pair of primers for discriminating a variety that can specifically amplify the sequence selected from the sequences set forth in SEQ ID NO: 5, SEQ ID NO: 28 and SEQ ID NO: 29 of the present invention, respectively or two depending on the variety to be discriminated The above can be mixed and used (refer FIG. 5).

In addition, the present invention provides a kit for discriminating the body sprouts, baekhwajeon or jeonhohoe varieties comprising the primer pair for discriminating the body sprouts, baekhwajeonho or jeonhoho varieties.

Specifically, the present invention is selected from the sequence described in SEQ ID NO: 5 for the cultivation of jeonho lake comprising a primer pair for cultivating the jeonho lake amplification of the polynucleotide consisting of 15 to 50 consecutive nucleotides Provide the kit.

In addition, the present invention is selected from the sequence described in SEQ ID NO: 29 for the cultivation of baekhwahoe variety comprising a primer pair for the baekhwahoe cultivar discrimination that can amplify the polynucleotide consisting of 15 to 50 consecutive nucleotides To provide.

In addition, the present invention is a body sprout containing a primer pair for body buds and baekhwahoe variety to amplify the polynucleotide consisting of 15 to 50 consecutive nucleotides, selected from the sequence set forth in SEQ ID NO: 28 and Provides kit for discriminating white pear cultivar.

In addition, the present invention provides a kit for body varieties, baekhwajeon and jeonhohoe varieties, including both a primer pair for discriminating varieties of varieties, a pair of primers for discriminating varieties of baekhwahoe and a pair of primers for discriminating varieties of varieties and baekhwajeon. .

In a preferred embodiment of the present invention, the primer pairs are species-specific amplified DNA of the body sprouts, baekhwajeonho or tohojeonho respectively (see Fig. 1, 3 and 4), respectively or two depending on the variety to be determined It may contain a mixture of branches or more. In the embodiment of the present invention, even when the primer pairs are mixed, the accurate DNA fragments of the expected size are amplified, so that not only the three kinds of whole birds can be discriminated at the same time but also the incorporation of the false earthworms can be discriminated. It was confirmed that it is a marker for differentiation simultaneous gene differentiation (see FIG. 5).

In addition, the kit may additionally include reagents for DNA extraction, amplification and product detection, and instructions therefor. For example, the kit may contain a reagent for DNA extraction, a deoxynucleotide, a thermostable polymerase suitable for a DNA amplification reaction, and a reagent for labeling and detecting nucleic acids.

In addition, the present invention comprises the steps of 1) extracting the DNA of the assay sample;

2) performing a polymerase chain reaction (PCR) from the DNA of step 1) using the primer of the present invention; And,

3) Provides a method for discriminating varieties of body sprouts, baekhwajeon and jeonhoho including the step of identifying the PCR product by separating the PCR product of step 2) by electrophoresis.

The sample may be a food body that is expected to contain the body sprouts, white jeonhwajeom and tojeonho itself or the body sprouts, white jeonhwaho and jeonjeonho.

In addition, the primers include primers capable of specifically amplifying the sequence selected from the sequences set forth in SEQ ID NO: 5, SEQ ID NOs: 28 and 29. In a preferred embodiment of the present invention, the primers species-specific amplified DNA of the body sprouts, white pear and tortoise, respectively (see FIGS. 1, 3 and 4).

In addition, the primer for discriminating the variety that can specifically amplify the sequence selected from the sequences set forth in SEQ ID NO: 5, SEQ ID NO: 28 and 29 of the present invention, each or two or more mixed depending on the variety to be determined Can be used. In the embodiment of the present invention, by confirming that the correct DNA fragment of the expected size is amplified even when the above primers are mixed, not only the three kinds of whole birds are distinguished at the same time but also the incorporation of the alien soils is different. It was confirmed that it is a marker for simultaneous gene differentiation (see FIG. 5).

Qualitative analysis of step 3) can be performed by detecting the PCR product of the electrophoresis result. In other words, when PCR is performed using a primer that can amplify the ITS marker that is specifically amplified, and a primer that can amplify the SCAR markers of JA16-1 and JA17-2, PCR is not only distinguishing species from all species. In addition, it can be judged that even if a false earthenware is mixed, it can be identified.

Variety determination method using a pair of primers for judging the body sprouts, baekhwajeonjeon and Tohoho varieties of the present invention can be utilized to prevent the misuse, misuse and circulation of the horticulture.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> plants DNA  extraction

<1-1> Test Materials

Domestic Herbs [ Angelica decursiva Franch. et Savatier (= Peucedanum decursivum Maxim.)] Three Natives , Peucedanum praeruptorum Dunn.) Three Natives and Anthricus sylvestris (L.) Hoffman) were collected and used in each of two fields. Specifically, body sprouts are native to Sangju-myeon, Namhae-gun, Gyeongsangnam-do, Gongyang-myeon, Sacheon-si, Gyeongnam, and Dong-gu, Dong-gu, Daejeon. Collected, the roots, stems, and leaves of biological samples were stored at -70 ° C.

<1-2> plants DNA  extraction

The biological sample stored at −70 ° C. was quenched with liquid nitrogen and ground to a powder state using a mortar, and then DNA was extracted using a Plant genomic DNA Prep kit (Solgent, Korea). Specifically, 50 mg of the powdered biological sample was collected in a 1.5 ml tube, 500 µl of cell lysate was added and mixed well. Then, 8 µl of protease-K (20 mg / ml) was added and vortexed lightly at 65 ° C. Cell disruption was incubated for 30 minutes. The crushed samples were cooled on ice for 5 minutes, and then 200 μl of Protein Precipitation Solution was added thereto, mixed well, and centrifuged at 13,000 rpm for 10 minutes. After centrifugation, 600 μl of the supernatant was taken and separated according to the manufacturer's user instructions to store the final 50 μl (45 ng / μl) of purified total DNA at −20 ° C.

< Example  2> ITS  Sequencing and primer  making

<2-1> PCR  Perform

To prepare specific primers through ITS (Internal Transcribed Spacer) site sequencing, the ITS site of nuclear ribosomal DNA nrDNA of body sprouts, white pears, and tortoises was selected from SEQ ID NO: 1 (ITS1; 5'-TCC GTA). PCR amplification was carried out using primer pairs described as GGT GAA CCT GCG-3 ') and SEQ ID NO: 2 (ITS4; 5'-TCC TCC GCT GAT TGA TAT GC-3').

Specifically, 30 μl of 1 × reaction solution [75 mM Tris-HCL (pH 8.8), 20 ng of total DNA, 20 pmole of primer pairs described in SEQ ID NO: 1 and SEQ ID NO: 2, and 2 units of DNA polymerase. 20 mM (NH ₄ ) ₂ SO ₄ , 0.1% (v / v) Tween 20, 20 μM dNTP, 200 μM MgCl ₂ ], respectively, were amplified using a DNA Engine Dyad Thermal Cycler (MJ Research, USA). Reaction conditions were carried out under the conditions of initial denaturation at 95 ° C. for 5 minutes, 30 seconds denaturation at 95 ° C., 40 seconds annealing at 51 ° C., 1 minute extension at 72 ° C., and final extension at 72 ° C. for 10 minutes. It was. ITS site PCR amplification products were observed by electrophoresis with 100 bp DNA ladder (Invitrogen, USA) on 1.5% agarose gel and stained with EtBr.

<2-2> Sequence Analysis

The nucleotide sequence of the ITS amplification products of each precursors obtained in Example 2-1 was analyzed.

Specifically, the identified ITS amplification products were recovered and purified from agarose gel using PCR & Gel Purification Kit (SolGent, Korea), and then inserted into pGEM-T Easy Vector Systems (Promega, USA). The inserted amplification products were transduced into XL1-Blue MRF 'transforming cells (Stratagene, USA), and then added to LB agar medium containing ampicillin (Sigma, USA) and X-gal / IPTG (Sigma, USA). Smear and incubate. After white colony was selected and cultured at 37 ° C. in an ampicillin-added LB liquid medium, the cells were recovered to separate plasmid DNA using a Plasmid mini preparation kit (SolGent, Korea). The nucleotide sequence of the ABI3730 automatic DNA sequencer (Applied Biosystems, USA) was analyzed using T7 and SP6 primers.

As a result, as shown in FIG. 1A, an ITS site amplification product of 689 bp in body sprouts (SEQ ID NO: 3), 693 bp in whitening call (SEQ ID NO: 4) and 694 bp in Tojeon ho (SEQ ID NO: 5) was obtained. It was found that 94.6% of herb and white pear, 82.8% of body and pear, and 82.7% of white and pear, respectively. As a result of examining the homology of the three ITS sequences, it was possible to identify the specific soil sequence at the 140-160 bp site of the ITS1 position and the 420-440 bp site of the ITS2 position.

<2-3> All kinds  Breed Selection primer  Pair productions

20 mer SCAR primers were prepared based on the sequencing results of the ITS amplification products of each precursor, PCR was performed, and specificity of the amplification products was confirmed.

Specifically, the ITS 556 S primer described in SEQ ID NO: 6 (5'-GGTGTCAACAACCAAATA-3 ') and the ITS 273 S primer described in SEQ ID NO: 7 (5'-CCCTGACCAACTAATCTTC-3') of the ITS2 site. Was prepared by requesting Bioneer (Korea) as a primer for SCAR marker, and then PCR amplification in the same manner as in Example 2-2 with the ITS4 primer described in SEQ ID NO: 2 to confirm the specificity of the amplification product.

As a result, as shown in Figures 1b and 1c each primer pair produced a 556 bp and 273 bp torsion specific amplification products.

< Example  3> RAPD  analysis

The body sprouts and the baekhwajeon were not able to obtain species-specific markers for the identification of varieties because of high similarity between ITS sequences. Therefore, species-specific markers and primer pairs for the identification of varieties were developed through random amplified polymorphic DNA (RAPD) analysis.

<3-1> PCR  Perform

PCR amplification was performed for RAPD analysis using RAPD kits A and C (Table 1) among 10-mer RAPD Kits of Operon. 20 ng of total DNA, 40 pmole of RAPD primer of Table 1 and 2 units of DNA polymerase were added to 30 μl of 1 × reaction solution, respectively, and amplified using DNA Engine Dyad Thermal Cycler (MJ Research, USA). Reaction conditions were performed under the conditions of initial denaturation at 95 ° C. for 5 minutes, 30 seconds denaturation at 95 ° C., 30 seconds annealing at 46 ° C., 45 seconds elongation at 72 ° C., and final extension at 72 ° C. for 5 minutes. It was. RAPD specific PCR amplification products were observed by electrophoresis with 100 bp DNA ladder (Invitrogen, USA) on 1.5% agarose gel and stained with EtBr.

As a result, PCR amplification products appeared in various sizes mainly from 0.2 kb to 3.0 kb, and two species-specific amplification products were obtained from two kinds of primers (OPA16 and OPA17) for body sprouts and white pears. 2).

Specifically, a body sprout specific amplification product was obtained from OPA16 primer (FIG. 2A), which was named JA16-1; Whitening hoc specific amplification product was obtained from OPA17 primer (FIG. 2B), which was named JA17-2.

Sequences of Operon RAPD Primers A and C primer Sequence (5'-3 ') SEQ ID NO: GC content (%) primer Sequence (5'-3 ') SEQ ID NO: GC content (%) OPA-11 CAATCGCCGT 8 60% OPC-11 AAAGCTGCGG 18 60% OPA-12 TCGGCGATAG 9 60% OPC-12 TGTCATCCCC 19 60% OPA-13 CAGCACCCAC 10 70% OPC-13 AAGCCTCGTC 20 60% OPA-14 TCTGTGCTGG 11 60% OPC-14 TGCGTGCTTG 21 60% OPA-15 TTCCGAACCC 12 60% OPC-15 GACGGATCAG 22 60% OPA-16 AGCCAGCGAA 13 60% OPC-16 CACACTCCAG 23 60% OPA-17 GACCGCTTGT 14 60% OPC-17 TTCCCCCCAG 24 70% OPA-18 AGGTGACCGT 15 60% OPC-18 TGAGTGGGTG 25 60% OPA-19 CAAACGTCGG 16 60% OPC-19 GTTGCCAGCC 26 70% OPA-20 GTTGCGATCC 17 60% OPC-20 ACTTCGCCAC 27 60%

<3-2> RAPD  Specific amplification products of  Sequencing

The base sequences of the two species specific amplification products obtained in Example 3-1 were analyzed in the same manner as in Example 2-2.

As a result, base sequences of SEQ ID NOs: 28 to 29 were obtained for JA16-1 (body specific) and JA17-2 (whitening specific).

< Example  4> SCAR Marker  Exploration and Multiclass Identification of Genes Marker  Development

Based on the sequencing results of the species-specific RAPD amplification products of Example 3, 20 mer SCAR primers were prepared at the portion except for the RAPD 10-mer primer sequence region, and PCR was performed to confirm specificity of the amplification products.

Specifically, SCAR primers were prepared as shown in Table 2.

SCAR primer Amplification primer Sequence (5'-3 ') SEQ ID NO: JA16-1 S TTGAGGATGATAAGGGGTAG 30 AS CCTAAGTGTTGACACCTACT 31 JA17-2 S ATCCGGTGATGGGGGAGAAT 32 AS 1 GAAGCACCGCTATACGGCTT 33 AS 2 CTTTATCCCTATTCCAAGCT 34

PCR amplification conditions using the SCAR primers are as follows: 20 ng of total DNA, 20 pmole of S (sense) primer, AS (anti sense) primer, and 2 units of DNA polymerase in 30 μl of 1 × reaction solution. Each was added and amplified using a DNA Engine Dyad Thermal Cycler. The reaction conditions were initially denatured at 95 ° C. for 5 minutes, followed by 1 minute denaturation at 95 ° C., 30 seconds annealing at 51 ° C., 2 minutes elongation at 72 ° C., and finally elongated at 72 ° C. for 5 minutes. The SCAR amplification products were observed by electrophoresis with 100 bp DNA ladder on 1.5% agarose gel and stained with EtBr.

As a result, the S and AS SCAR primer pairs (FIG. 3A) prepared from the body sprout specific amplification product (JA16-1; FIG. 2A) by the OPA16 RAPD primers were commonly used in the body sprouts and the pear blossoms except for the Tojeon. Amplification products of bp size appeared (FIG. 3B). The JA16-1 S and AS primer pairs are difficult to use for differentiating the body sprouts, but may be used for the discrimination between the body tofu and the white wares which are similar to the tojeonho and the genuine hokkaido.

In addition, in the case of S and AS 1 or AS 2 SCAR primers (FIG. 4A) prepared from an about 600 bp whitening signal specific amplification product (JA17-2; FIG. 2B) by OPA17 RAPD primer (FIG. 4B), respectively. DNA fragments were specifically amplified at exactly 305 bp (FIG. 4C). The JA17-2 S primer and the JA17-2 AS 1 or JA17-2 AS 2 primer may be used for discriminating white flowers.

 < Example  5> Simultaneous Differentiation of Multiple Varieties Using Species Specific Sequences Marker  Development

<5-1> Marker  Development

We have developed a marker for differentiation of all kinds of horticulture species that can discriminate three species of miscellaneous species that are mixed and misused by one test.

<5-2> multiplex PCR  One

Primer for amplification of the whitening signal of the JA17-2 S and AS 1 SCAR primers shown in Table 2 (145 bp), pair of JA16-1 S and AS SCAR primers (363 bp) that can distinguish the body sprouts and the whitening from the tortoise ) And multiplex PCR was performed using primer pairs (273 bp) for atomic signal specific amplification of ITS 273 S and ITS4 primers.

Multiplex PCR conditions were amplified using DNA Engine Dyad Thermal Cycler by adding 20 ng of total DNA, 20 pmole of S primer, 3 pairs of AS primer, and 2 units of DNA polymerase to 30 μl of 1 × reaction solution. It was. The reaction conditions were initially denatured at 95 ° C. for 5 minutes, followed by 1 minute denaturation at 95 ° C., 30 seconds annealing at 51 ° C., 2 minutes elongation at 72 ° C., and finally elongated at 72 ° C. for 5 minutes. The SCAR amplification products were observed by electrophoresis with 100 bp DNA ladder on 1.5% agarose gel and stained with EtBr.

As a result, as shown in Fig. 5a, by confirming that the correct DNA fragment of the expected size is amplified, it is possible to discriminate not only three kinds of all types of birds at the same time, but also to discriminate the incorporation of alien tones. It confirmed that it was.

<5-3> multiplex PCR  2

A pair of primers for amplification of whitening call of a JA17-2 S and AS 2 SCAR primer of Table 2 (305 bp), a pair of JA16-1S and AS SCAR primers (363 bp) that can distinguish a body sprout and a white call from a tortoise ) And multiplex PCR was performed using primer pairs (273 bp) for atomic signal specific amplification of ITS 273 S and ITS4 primers.

As a result, as shown in Fig. 5b, by confirming that the correct DNA fragment of the expected size is amplified, it is possible to discriminate not only three kinds of whole birds, but also to discriminate the incorporation of alien tones. It confirmed that it was. The markers had less DNA amplification specificity than the markers of FIG. 5A.

1 is a view showing the results of performing the ITS analysis in the body sprouts, whitening and land battles:

a: homology test;

b: PCR performance using ITS 556 S primer; And,

c: PCR result using ITS 273 S primer.

Figure 2 is a diagram showing the results of PCR in the body sprouts, whitening and hojeonho using the primer for RAPD analysis:

a: OPA16; And,

b: OPA17.

Figure 3 is a diagram showing the results of PCR in the body sprouts, whitening and tofu using the base sequence of the JA16-1 amplification product and the SCAR primer pair prepared based on the base sequence:

a: nucleotide sequence; And,

b: PCR result.

4 is a diagram showing the results of PCR in the body sprouts, whitening and tofu using the nucleotide sequence of the JA17-2 amplification product and the SCAR primer pair prepared based on the nucleotide sequence:

a: nucleotide sequence;

b: PCR result (145 bp); And,

c: PCR result (305 bp).

Figure 5 is a diagram showing the results of performing multiplex PCR using three pairs of SCAR primers:

a: JA17-2 S / AS 1, JA16-1 S / AS and ITS 273 / ITS4; And,

b: JA17-2 S / AS 2, JA16-1 S / AS and ITS 273 / ITS 4.

<110> Korea Institute of Oriental Medicine <120> Gene marker for classification of Angelica decursiva, Peucedanum          praeruptorum and Anthricus sylvestris <130> 8P-04-30 <160> 34 <170> KopatentIn 1.71 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITS1 <400> 1 tccgtaggtg aacctgcg 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITS4 <400> 2 tcctccgctg attgatatgc 20 <210> 3 <211> 689 <212> DNA <213> Angelica decursiva <400> 3 tccgtaggtg aacctgcgga aggatcattg tcgaatcctg caatagcaga atgacccgct 60 aacacgttaa caatttgggc gagcgtcggg gggcctcggt ctcctgtctt cgaatccctg 120 gtaggtggcc actcccgggt ggtcactggc ctgcaaaatc attcgggcgc ggaatgcgcc 180 aaggacctta aaactgaatt gtacgtccgt atcccgttcg cgggcaccgg cgtcattcca 240 aaacacaacg actctcgaca acggatatct cggctctcgc atcgatgaag aacgtagcga 300 aatgcgatac ttggtgtgaa ttgcagaatc ccgtgaacca tcgagtcttt gaacgcaagt 360 tgcgcccgaa gccactaggc tgagggcacg cctgcctggg tgtcacgcat cgtattgcct 420 gcagaccact cacacctgag aagttgtgac ggtttggggc gcaaattggc ctcccgtacc 480 ttgtcgtgcg gttggcggaa aaacgagtct ccggcgacgg atgtcgcgac atcggtggtt 540 gtgaaagacc ctcttgtctt gtcgcgcgag tccccgtcat cttagcgagc tccaggaccc 600 ataggcagca cacactctgt gcgcttcgac tgtgacccca ggtcaggcgg gactacccgc 660 tgagtttaag catatcaata agcggagga 689 <210> 4 <211> 693 <212> DNA <213> Peucedanum praeruptorum <400> 4 tccgtaggtg aacctgcgga aggatcattg tcgaatcctg caacagcaga atgacccgct 60 aacacgtcaa caatttgggc aagcgtcggg gggcctcggt ctcctgtctg cgaatccttg 120 gtaggtggcc actcccgggt tgccactggc cttcaaaatc attcgggcgc ggaatgcgcc 180 aaggacctta aaaactgaat tgtacgtccg tatcccgtta gcgggcagcg gcgtcgttct 240 aaaacacaac gactctcgac aacggatatc tcggctctcg catcgatgaa gaacgtagcg 300 aaatgcgata cttggtgtga attgcagaat cccgtgaacc atcgagtctt tgaacgcaag 360 ttgcgcccga agccattagg ttgagggcac gtctgcctgg gtgtcacgca tcgtctttgc 420 ccacaaacca ctcacacctg agaagttgtg tcggtttggt ggcggaaact ggcctcccgt 480 accttgttgt gcggttggcg gaaaaatgag tctccggcga cggacgtcgc gacatcggtg 540 gttgtaaaag accctcttgt attgtcgtac gaatcctcgt cgtcttaaga gagattcagg 600 acccttaggc agcacacact ctgtgcgctt cgactgtgac cccaggtcag gcgggaccac 660 ccgctgagtt taagcatatc aataagcgga gga 693 <210> 5 <211> 694 <212> DNA <213> Anthricus sylvestris <400> 5 tccgtaggtg aacctgcgga aggatcattg tcgaatcctg ctcaagcgga atgacccgtt 60 aactcgttaa aacatcgggc aagcgttagg gggcccaagg tcccctcttt gcgatcccgt 120 ggtggttgtc ccctcacggg tgtcaaccaa ccaaataaat caaccgggcg ctgacggcgc 180 caaggaaatt aatattgaat tgattgttag cttctcgttc gcgggaagcg gcgtcaatct 240 gaaacacaaa tgactctcgg caacggatat cccggctctc gcatcgatga agaacgtagc 300 gaaatgcgat acttggtgtg aattgcagaa tcccgtgaac cattgagtct ttgaacgcaa 360 gttgcgcccg aagccactag gctaagggca cgtctgcctg ggtgtcacgc atctagttgc 420 cccctgacca actaatcttc taagagattt tgtcggtttg ggggcggaaa ttagcctcct 480 gtgccatgtt gtgcggctgg cgtaaaactg agtctatggt gacgaatgtc acgacatcgg 540 tggttgtaag aagaccttct tgtcttgtcg tgtgaatgtc cgtcatctta taaggctcaa 600 tgacccttag gcgccaaaaa ctttggcact tcgattgtga ccccaggtca ggcgggatta 660 cccgctgagt ttaagcatat caataagcgg agga 694 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITS 556 S <400> 6 ggtgtcaaca accaaata 18 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ITS 273 S <400> 7 ccctgaccaa ctaatcttc 19 <210> 8 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-11 <400> 8 caatcgccgt 10 <210> 9 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-12 <400> 9 tcggcgatag 10 <210> 10 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-13 <400> 10 cagcacccac 10 <210> 11 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-14 <400> 11 tctgtgctgg 10 <210> 12 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-15 <400> 12 ttccgaaccc 10 <210> 13 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-16 <400> 13 agccagcgaa 10 <210> 14 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-17 <400> 14 gaccgcttgt 10 <210> 15 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-18 <400> 15 aggtgaccgt 10 <210> 16 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-19 <400> 16 caaacgtcgg 10 <210> 17 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-20 <400> 17 gttgcgatcc 10 <210> 18 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-11 <400> 18 aaagctgcgg 10 <210> 19 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-12 <400> 19 tgtcatcccc 10 <210> 20 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-13 <400> 20 aagcctcgtc 10 <210> 21 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-14 <400> 21 tgcgtgcttg 10 <210> 22 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-15 <400> 22 gacggatcag 10 <210> 23 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-16 <400> 23 cacactccag 10 <210> 24 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-17 <400> 24 ttccccccag 10 <210> 25 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-18 <400> 25 tgagtgggtg 10 <210> 26 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-19 <400> 26 gttgccagcc 10 <210> 27 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-20 <400> 27 acttcgccac 10 <210> 28 <211> 383 <212> DNA <213> Artificial Sequence <220> <223> JA16-1 <400> 28 agccagcgaa ttgaggatga taaggggtag ccaacctatg ggtaattgag tactttttca 60 aaagagactc aaattggtga ttcttaaagt gcgtgccttg gtcactaatg atagctcgag 120 gtgtgccaaa tcgagaaaag atattctctt ttaggaattt aagaacgacc ttgttatcat 180 tggacctagt tggtatggct tctacccact tagaaacgta atcaaccgct aagagaatgt 240 agaggttgcc gaacgaatta ggaaagggac ccataaaatc aatcccccac acgtcgaaaa 300 tttcaatgat aaggatggga gtcattggca tcatgtttct tctcgtgatc tttcctaagt 360 gttgacacct actttcgctg gct 383 <210> 29 <211> 608 <212> DNA <213> Artificial Sequence <220> <223> JA17-2 <400> 29 gaccgcttgt tataaatccg gtgatggggg agaataagat ctggaaagtc ctgatcgatg 60 aagggagttc ggtcaacatc ttgtatcacc ggacatattg caaaatgaac ttgggaggcg 120 aacaactaga gccatgccat gaagcaccgc tatacggctt cggtaatcaa cctgtaccga 180 tcgaaggaac tataacactg aacgtcttat taggaaaagc accattcaca acgatgaaag 240 aggcgaaatt ttacgttgtt agagtcgaca gcccgtataa tgggatcctg ggaagacctg 300 ctttatccct attccaagct gtgtcatcta tccctcactt gaaattgaaa tttccaaccg 360 aacacggggt cggagaaatg aggggcgacc aaaaagcagc acgaatcatt atgttggaag 420 acctggagaa agaaaaagtt gtcgaaatga ccgaagccgg gaaaagaaga agaaatgaga 480 ccgaaccagg aggcagtcac caactgctga atatcgagtt ggagaaattt ggagccgacc 540 tgtcaaatcc gatagccgaa ccggctgtcg aaaccgaaga agttgaatta tacgtaggac 600 aagcggtc 608 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JA16-1 S <400> 30 ttgaggatga taaggggtag 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JA16-1 AS <400> 31 cctaagtgtt gacacctact 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JA17-2 S <400> 32 atccggtgat gggggagaat 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JA17-2 AS 1 <400> 33 gaagcaccgc tatacggctt 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JA17-2 AS 2 <400> 34 ctttatccct attccaagct 20  

Claims (16)

Kit for the determination of body sprouts, whitening and earthworms including all of the following primer pairs; 1) a pair of primers set forth in SEQ ID NO: 2 and SEQ ID NO: 6 for amplifying the sequence set forth in SEQ ID NO: 5, 2) a pair of primers set forth in SEQ ID NO: 2 and SEQ ID NO: 7 for amplifying the sequence set forth in SEQ ID NO: 5, 3) a pair of primers set forth in SEQ ID NO: 30 and SEQ ID NO: 31 for amplifying the sequence set forth in SEQ ID NO: 28, 4) a pair of primers set forth in SEQ ID NO: 32 and SEQ ID NO: 33 for amplifying the sequence set forth in SEQ ID NO: 29, 5) A pair of primers set forth in SEQ ID NO: 32 and SEQ ID NO: 34 for amplifying the sequence set forth in SEQ ID NO: 29. The kit of claim 1, further comprising a dNTP mixture, a PCR reaction buffer, and a thermostable DNA polymerase. 1) extracting the DNA of the assay sample; 2) amplifying the DNA of step 1) using the kit of claim 1; And 3) separating the PCR product of step 2) by electrophoresis; And, 4) a body comprising the step of confirming that the PCR product of step 3) is a PCR product of SEQ ID NO: 5, a ternary number if the PCR product of SEQ ID NO: 28, or a body sprout or whitening call, or a whitening if the PCR product of SEQ ID NO: 29 A method for discriminating one or more species from a group comprising herbs, white pear and land horn. The method according to claim 3, wherein the analytical sample of step 1) is a body sprout, a baekhwajeon, or a soil food, which is expected to include the body sprouts, baekhwajeon, and jeonho. A method of determining one or more species from a group comprising a tonic lake. 4. The method according to claim 3, wherein the polymerase chain reaction (PCR) of step 2) is amplified in one reaction solution. 4. The method of claim 3, wherein the electrophoresis of the PCR product of step 3) can be distinguished in one gel. delete delete delete delete delete delete delete delete delete delete

Images