KR20150121794A - Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same - Google Patents

Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same Download PDF

Info

Publication number
KR20150121794A
KR20150121794A KR1020140047729A KR20140047729A KR20150121794A KR 20150121794 A KR20150121794 A KR 20150121794A KR 1020140047729 A KR1020140047729 A KR 1020140047729A KR 20140047729 A KR20140047729 A KR 20140047729A KR 20150121794 A KR20150121794 A KR 20150121794A
Authority
KR
South Korea
Prior art keywords
seq
primer set
cucumber
resistant
primer
Prior art date
Application number
KR1020140047729A
Other languages
Korean (ko)
Inventor
이상협
베가스 후안
Original Assignee
세종대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 세종대학교산학협력단 filed Critical 세종대학교산학협력단
Priority to KR1020140047729A priority Critical patent/KR20150121794A/en
Publication of KR20150121794A publication Critical patent/KR20150121794A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a primer set for selecting a cucumber resistant organism resistant individual and a screening method using the primer set, wherein the primer set of SEQ ID NO: 1 and SEQ ID NO: 2, the primer set of SEQ ID NO: 3 and SEQ ID NO: 4, A primer set, and a primer set of SEQ ID NO: 7 and SEQ ID NO: 8. In addition, the present invention provides a method for screening cucumber bacillus-resistant individuals using the primer set and a method for cultivating cucumber bacillus-resistant individuals. In addition, the present invention provides a kit for screening a cucumber bacterium resistant object comprising the primer set.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a primer set for screening a cucumber-resistant bacterium,

The present invention relates to a primer set for screening a cucumber resistant organism resistant organism and a screening method using the primer set.

Cucumbers have been grown for thousands of years and are popular plant crops grown worldwide. Cucumbers have a delicious flavor, are juicy, contain a variety of vitamins and minerals, and are the most preferred consumer-recommended vegetable. They are grown all year round in greenhouses and greenhouses. Cucumber is a humectant that requires a lot of water during growth, and the distribution of roots in the soil is shallow, so it is easily damaged if the soil moisture is insufficient. Therefore, cucumbers are cultivated in a relatively humid environment, so they are susceptible to nosocomial diseases, jade fungus diseases, and scleroderma caused by humid environments.

Mycosis is caused by the fungus Pseudoperonospora cubensis (P.C.) and causes significant crop loss in many cucurbit species including cucumber. The disease is found all over the world, and is affected by humidity and temperature conditions. The disease occurs in plants grown in greenhouses, and plants grown in open fields. Nonghyack disease is one of the most important leaf diseases of Bacillus, and it can decrease fruit yield and quality and can kill susceptible seedlings. Initially, irregular spots are formed on the front side of the leaf, light yellowish color appears on the back side of the leaf, It occurs first in the lower leaves and spreads upward. When the spots are combined, the lesion grows larger and the leaves dry.

Cucumber naturally occurring disease is an active parasitic disease (artificial cultivation is impossible and naturally occurring symptoms are observed in the packaging). Therefore, it is necessary to observe the disease caused by naturally occurring disease in the package to judge resistance, Resistant cultivars. However, because it relies on natural disease development in packaging, it can not guarantee uniform disease occurrence for all individuals to be selected. Therefore, selection of resistant individuals is inaccurate, It takes a long time, and there is a problem that it is costly to cultivate the cucumber in the packaging and then select the resistant individuals by looking at the symptoms.

US Published Patent 2011-0126309A1 (Released May 26, 2011)

It is an object of the present invention to provide a primer set for screening cucumber fungus resistant individuals.

Another object of the present invention is to provide a method for screening cucumber-resistant individuals using the primer set and a method for cultivating cucumber-resistant cucumber-resistant individuals.

It is still another object of the present invention to provide a kit for screening a cucumber resistant organism containing the primer set.

In order to achieve the above object, the present invention provides a primer set of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6, A primer set for selecting one or more cucumber antifungal susceptible individuals selected from the group consisting of:

The present invention also relates to a method for isolating DNA from a cucumber sample, Amplifying the target sequence by performing PCR using the separated DNA as a template and using the primer set according to claim 1; And a step of detecting the amplification product.

In addition, the present invention provides a method for cultivating a cucumber bacterium resistant organism using the above-described screening method.

The present invention also provides a primer set of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6, and a primer set of SEQ ID NO: Wherein the kit comprises at least one primer set selected from the group consisting of:

The present invention relates to a primer set for selecting cucumber resistant organisms resistant to cucumber, and a screening method using the primer set. The primer set of the present invention can provide efficient (low-cost, short-term, accurate selection) cucumber resistant organism selection techniques. In addition, conventional breeding methods require a period of 10 years or more and a large expense. However, when the biomarker according to the present invention is used, breeding can be carried out within 1/100 or less of the existing breeding cost and within 5 years, .

Figure 1 shows the results of cucumber resource genotyping analysis by SSR genotyping analysis. Lane 1: Resistant, Lane 2: Sensibility, Lane 3: F2 line -1, Lane 4: F2 line -2, Lane 5: F2 line -3. After 30 cycles of PCR at 95 ° C (denature), 60 ° C (annealing) and 74 ° C (extension), images were taken after electrophoresis on 3% metaphor gel .
Fig. 2 shows a cucumber gene map using the SSR marker and the NBS-SSR gene. Chromosomes 1, 2, and 6 are the QTL regions that Monsanto claims to be resistant to, and the chromosome 1, 5, and 6 chromosome-resistant QTL regions reported by Chinese researchers are labeled with purple and light blue bars. The box next to the chromosome indicates the location of the NBS-LRR gene, known as the disease-resistance gene, and the * mark on each chromosome indicates the location of the SSR marker that is polymorphic between the nociceptive resistance and the dysplasia.
FIG. 3 shows the disease occurrence pattern after 2 weeks of inoculation with Nociceptive Resistance (S7) and Nociceptive (S6) individuals.
Fig. 4 shows a scoring index of no disease.
FIG. 5 shows quantification results in agarose gel after extraction of gDNA.
Figure 6 shows the results of genotyping analysis using the SSR marker for the F2 mapping line.
FIG. 7 shows the result of confirming the difference in genotype between a conventional agarose and a meta-foraging gel.
8 shows the result of genotyping analysis using an automatic electrophoresis apparatus.
Fig. 9 shows an image obtained from the Nitric Acid QTL Mapping. The above is a linkage map image, and the following is QTL map.

In order to overcome the disadvantages of the conventional high cost, inaccurate and long-term packaging selection, SSR markers showing polymorphism between the nociceptive resistance and the dysplastic individuals were selected and applied to the F2 mapping group using the polymorphic markers, The present inventors have completed the present invention.

The present invention provides a primer set of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6, and a primer set of SEQ ID NO: There is provided a primer set for selecting one or more cucumber antifungal susceptible individuals to be selected.

As used herein, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be amplified and may serve as a starting point for the synthesis of a primer extension product. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target. In the present invention, the oligonucleotide used as a primer may also include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or And may include an intercalating agent.

The present invention also relates to a method for isolating DNA from a cucumber sample, Amplifying the target sequence by performing PCR using the separated DNA as a template and using the primer set; And a step of detecting the amplification product. Specifically, the detection of the amplification product can be confirmed by gel electrophoresis of the amplification product.

In addition, the present invention provides a method for cultivating a cucumber bacterium-resistant organism using the above-described screening method.

As used herein, the term "simple sequence repeat (SSR) marker " is also referred to as STR (Short Tandem Repeats) and refers to a sequence in which 1 to 6 bases are repeated on DNA. In general, SSR sequences can be used as a variety of markers within a gene and are also used in studies of replication or deletion of specific genes. Currently, there are more than 20,000 simple sequence repeats (SSR) markers in the cucumber standard genome sequence information revealed in China.

The present invention also provides a primer set of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6, and a primer set of SEQ ID NO: Wherein the kit comprises at least one primer set selected from the group consisting of: Specifically, the kit may further comprise a DNA polymerase, dNTPs, and a reaction buffer.

A "kit" of the present invention may include one or more other component compositions, solutions or devices suitable for the assay method, as well as a primer set capable of selecting the cucumber-resistant organism of the present invention.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.

< Example  1> Genetic mapping

First, SSR markers showing resistance to nociceptive disease and polymorphism between heterologous individuals were selected (Fig. 1). And the location of these polymorphic markers on the cucumber genome was confirmed. As shown in FIG. 2, it was confirmed that the polymorphism markers were uniformly distributed in 7 cucumber chromosomes. Once the polymorphic markers are applied to the F2 mapping group, we expect to be able to identify the QTL regions involved in the resistance to nociceptive disease.

To date, data on purple and light blue areas are chromosomes 1, 5, and 6, which are published by Chinese researchers. The data reported by Monsanto in the United States include cucumber 1, 2 It is known that QTL is located on chromosome 6 and 6. This is probably because two researchers used different genetic resources (Figure 2).

< Example  2> QTL mapping

The SSR markers were applied to 152 lines of F2 mapping provided by Dongbu Hanon Co.,

First, two parental line resistance (S7) and a yeast infection (S6) provided by Dongbu Hanon Co. were placed on a plant growth at 26 ℃ / relative humidity of 96%, and P. cubensis spores were made into 10 6 cfu, As shown in FIG. 3, the S7 and S6 individuals showed resistance and dyspnea patterns to the nodule, respectively, and they were found to have a proper mapping group.

Then, DI (disease index) for nosocomial infections was set for 152 F2 mapping groups that grew up in Dongbu Hanon packaging (Fig. 4), and scoring of Nosocomial phenotype for the entire mapping group was performed.

After scoring the nocicept, 152 individuals of the F2 mapping line were sampled, and then gDNA was extracted using a DNA extraction kit (Fig. 5). Since the marker of lane 1 is 50 ng / 2 u, the amount of gDNA is about 25 ~ 75 ng / ul.

Using the extracted gDNA as a template, the PCR reaction was performed using the primer prepared in the SSR marker. Then, electrophoresis was performed using a metaphor gel having a gel separation higher than that of the agarose, and 152 mapping lines (Fig. 6). The upper band is derived from the resistance, and the lower band is derived from the susceptibility. Therefore, if the upper band is the only resistance, the lower band has both the upper band and the lower band.

The PCR primers used in the present invention are as follows.

The chromosome 2 QTL region is between DM2_009 and DM2_429 [DM2_009-R; TGCTGCGTTTGCCAATGTAG (SEQ ID NO: 1) and DM2_009-F; ATTTCCAGACGTCTCACCGT (SEQ ID NO: 2), DM2_429-F; GAATTGGCCCATCCTTCATT (SEQ ID NO: 3) and DM2_429-R; GCCATTCCAAAAACTTTTCAAC (SEQ ID NO: 4)].

The chromosome 5 QTL region is between DM5_436 and DM5_598 [DM5_436-R; TCACATCAAATTAACACTTTCATCTC (SEQ ID NO: 5) and DM5_436-F; CGCACGAGAACCTTTATGA (SEQ ID NO: 6), DM5-598-F; TATAACCCCGTCTTCTCCCC (SEQ ID NO: 7) and DM5_598-R; GGGAAACCCCTTTGACTCTC (SEQ ID NO: 8)].

In many cases, there is no difference in the band shift in agarose or meta-foraging gel, so that genotyping can not be analyzed in many cases (Fig. 7). In this case, a genotyping analysis was carried out (FIG. 8) when an automatic electrophoresis apparatus (MultiNA, Shimoshima) having a high resolution of separation was used and genetic analysis was possible. As a result, the same PCR product used in FIG. 7 was analyzed using a MultiNA instrument, and band separation was observed.

So far, 77 SSR markers have been used for genotype analysis of 1521 mapping lines. And QTL mapping using mapping software (WinQTL) using phenotypic data from Dongbu Hanon pavement to derive the results that presumably existed on chromosome 2 and 5, the major regulators responsible for nociceptive resistance 9).

The QTL markers derived from the above QTL mapping results will be used for molecular breeding of the mycorrhizal resistant cucumber varieties.

<110> INDUSTRY-ACADEMIA COOPERATION GROUP OF SEJONG UNIVERSITY <120> Primer set for selecting cucumber downy mildew disease resistant          variety and selection method using the same <130> ADP-2013-0526 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tgctgcgttt gccaatgtag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 atttccagac gtctcaccgt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gaattggccc atccttcatt 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gccattccaa aaacttttca ac 22 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 tcacatcaaa ttaacacttt catctc 26 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cgcacgagaa cctttattga 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tataaccccg tcttctcccc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gggaaacccc tttgactctc 20

Claims (6)

A primer set of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6, and a primer set of SEQ ID NO: A set of primers for screening cucumber antifungal susceptibility. Separating the DNA from the cucumber sample;
Amplifying the target sequence by performing PCR using the separated DNA as a template and using the primer set according to claim 1; And
And detecting the amplified product. 3. The method according to claim 2, wherein the detection of the amplification product is performed by gel electrophoresis of the amplified product to confirm the band size. A method for cultivating a cucumber resistant organism by using the screening method according to claim 2. A primer set of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6, and a primer set of SEQ ID NO: Wherein the primer set is a primer set. [Claim 5] The kit for screening a cucumber mildew-resistant organism according to claim 5, wherein the kit further comprises a DNA polymerase, dNTPs and a reaction buffer.
KR1020140047729A 2014-04-21 2014-04-21 Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same KR20150121794A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140047729A KR20150121794A (en) 2014-04-21 2014-04-21 Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140047729A KR20150121794A (en) 2014-04-21 2014-04-21 Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same

Publications (1)

Publication Number Publication Date
KR20150121794A true KR20150121794A (en) 2015-10-30

Family

ID=54430792

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140047729A KR20150121794A (en) 2014-04-21 2014-04-21 Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same

Country Status (1)

Country Link
KR (1) KR20150121794A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190003129A (en) * 2017-06-30 2019-01-09 동국대학교 산학협력단 Marker for screening maize downy mildew resistance object and method using the same
KR102175452B1 (en) * 2020-03-24 2020-11-09 동국대학교 산학협력단 Composition for screening maize downy mildew resistance object and method using the same
KR20220086084A (en) 2020-12-16 2022-06-23 대한민국(농촌진흥청장) Primer Set for Detecting Peronospora Destructor Berk, Diagnostic kit using the same

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190003129A (en) * 2017-06-30 2019-01-09 동국대학교 산학협력단 Marker for screening maize downy mildew resistance object and method using the same
KR102175452B1 (en) * 2020-03-24 2020-11-09 동국대학교 산학협력단 Composition for screening maize downy mildew resistance object and method using the same
KR20220086084A (en) 2020-12-16 2022-06-23 대한민국(농촌진흥청장) Primer Set for Detecting Peronospora Destructor Berk, Diagnostic kit using the same

Similar Documents

Publication Publication Date Title
CN105385697B (en) Sesame inflorescence finite basis is because of Sidt1 and its SNP marker
CN105950736B (en) Molecular marker co-separated from bruchid-resistant gene VrPGIP of mung bean and application thereof
KR101516190B1 (en) SSR primer sets for discrimination of oriental melon line or cultivar and uses thereof
CN108330163B (en) Characteristic sequence, primer and identification method of apocarya variety Nacono and Sumner
KR101816573B1 (en) Markers for discrimination of resistance or susceptibility about gummy stem blight disease of watermelon
CN111961749B (en) KASP primer for detecting tomato yellow leaf curl virus disease-resistant genes Ty-3 and Ty-3a and application thereof
CN106811462B (en) Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof
WO2016010068A1 (en) Identification method for individual broccoli plants having clubroot resistance, breeding method for clubroot-resistant broccoli
KR101255544B1 (en) Primer Set for Discerning Flowering Type in Brassica and Method for Discerning Using the Same
WO2015034040A1 (en) Anthracnose resistance-associated marker for plant of genus fragaria, and use thereof
KR20150121794A (en) Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same
CN104946630B (en) Disease-resistant linkage molecular marker for cucumber target spot disease and special primer and application thereof
CN108531636B (en) Molecular marker TJcM01 for identifying melon unisexual flower and application thereof
CN108239675B (en) Molecular marker TJcM02 for identifying melon unisexual flower and application thereof
CN114032323B (en) Co-dominant SSR marker closely linked with cigar black shank resistance gene and application thereof
CN108004236B (en) Corn stalk rot disease-resistant molecular breeding method and application thereof
KR101783347B1 (en) CAPS marker for discriminating presence or absence of pollen in pear and uses thereof
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
KR101761293B1 (en) SNP primer sets for discrimination of fusarium wilt resistance of Radish and uses thereof
KR102144263B1 (en) Primer set for screening tomato resitant to Bacterial wilt, method for screening tomato resitant to Bacterial wilt
CN107326070A (en) The special codominant marker of one haynaldia villosa 4VL chromosome and its primer and purposes
CN109811085B (en) Primer for identifying purity of autumn-sown Chinese cabbage Zhenlun No. 6 seeds and application of primer
KR101684069B1 (en) Novel genomic marker for identifying Flammulina vehitipes and uses thereof
KR101490013B1 (en) Molecular marker for selecting cucumber downy mildew disease resistant variety and selection method using the same marker
JP4575613B2 (en) DNA marker linked to aluminum resistance factor and use thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E601 Decision to refuse application