KR101761293B1 - SNP primer sets for discrimination of fusarium wilt resistance of Radish and uses thereof - Google Patents

Abstract

The present invention relates to a primer set for discriminating resistance to non-hostess disease, and a kit comprising the same, and more particularly, to a kit comprising the same, wherein the genotype is determined by single nucleotide polymorphism (SNP) To a primer set, a composition and a kit which are capable of effectively discriminating high or low tolerance against viruses entirely.
According to the present invention, it is possible to quickly and accurately discriminate resistance to radish strain. Accordingly, it is possible to select and cultivate radishes having excellent resistance to viviparous diseases, thereby contributing greatly to reducing the damage caused by the viviparous diseases, as well as being resistant to viviparous diseases and also useful for developing new varieties having other useful characteristics It is expected.

Description

SNP primer sets for discrimination of non-rootstock resistance and uses thereof [0002] SNP primer sets for discrimination of fusarium wilt resistance of Radish and uses thereof [

The present invention relates to a SNP primer set for discriminating resistance to non-hostess disease, and its use, and more particularly, to a method for genetically identifying a SNP primer set for genotyping by discriminating genotypes according to single nucleotide polymorphism (SNP) To a primer set, a composition and a kit which enable effective identification of high or low resistance to viviparous resistance.

Cabbage and crops are the three major crops in Korea, along with rice and pepper. Among them, mulberry cultivated in Korea was introduced in the Three Kingdoms period or the Unified Silla period, and it has been improved for a long time in different environments and adapted to climate and climate. Today, it is possible to cultivate a variety of new varieties and cultivate it all year round. The problem in the cultivation of radish is that various diseases and physiological disorders can easily occur due to the sequence in the facility house.

It is an infectious disease caused by soil in early summer and early fall, and the degree of damage increases year by year, and it causes considerable damage in non-producing area and seedling area. In 2000, 41 farms including Gangwon province, Hoengseong, Jungseon and Inje produced 21.5ha of fruitless diseases. This disease occurs frequently in series and at high temperatures, and it causes fatal damage and spreads nationwide. Therefore, raising the disease-causing variety is more important than ever, especially in the case of exporting to Japan and summer rice.

Fusarium oxysporum , which causes wilting of vegetable crops, has more than 120 differentiative types. Fusarium oxysporum f. sp. It is a soil infectious bacterium belonging to incomplete fungi. It forms three kinds of silent spores such as small conidiospore , large conidiospore , and thick spore. The symptom of the radish disease is the root canal discoloration from yellowish brown to dark brown color on the seedling stage, and the upper part of the seedlings is dead soon. In the growing season, symptoms of wilting appear on the new leaf, gradually falling from the lower leaf to yellowing, leaving only 1 ~ 2 leaves. At the early stage of the onset of roots, a part of the conduit changes from dark brown to dark brown, but when the disease becomes worse, it is destroyed by other conduits and is severely discolored. Soil fumigation, disinfection, and rotation are used to control the disease. However, these methods are not economical and have no clear control effect. Therefore, cultivation of resistant varieties for this disease is urgently needed.

On the other hand, the use of molecular markers in breeding is not affected by the environment or other genotypes, and it has the advantage of being able to greatly increase the selection efficiency such as saving the selection cost and time. It is also possible to select genes with specific traits from a number of genetic resources using molecular markers associated with specific traits and to improve accuracy by directly evaluating target genotypes during the selection process, .

The present inventors thought that the genetic information and the SNP information of the Chinese cabbage which has been accumulated for a long time by researching it could be applied to the muscle of the Chinese cabbage, and based on this, it is possible to find new SNPs I could. Thus, it was possible to develop a primer capable of discriminating SNPs accurately and easily. It was confirmed that when the SNPs of radishes were discriminated by using the primers, the individuals having excellent resistance to the epidemic diseases could be effectively discriminated, and the present invention was completed .

Kendric, J.B. and W.C. Snyder, 1936, A vascular Fusarium disease of radish, Phytopathology, 26:98. Hong Dong-ju, 1994, A study on cultivating tolerant varieties of non-rootstocks, Kangwon National University, Ph.D. Alabouvette, C., B. Schippers, P. Lemanceau, and P.A.H.M. Bakker, 1998, Biological control of fusarium wilts, Plant-microbe interactions and biological control, New York.

SUMMARY OF THE INVENTION Accordingly, it is a primary object of the present invention to provide a method for accurately and easily discriminating resistance to non-sweet potatoes.

It is another object of the present invention to provide a primer set, a composition and a kit for discriminating resistance to non-boarsus disease.

According to one aspect of the present invention, the present invention provides a primer comprising a first primer pair consisting of an oligonucleotide having a nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide having a nucleotide sequence of SEQ ID NO: 2; A second primer pair consisting of an oligonucleotide having the nucleotide sequence of SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 4; And a third primer pair consisting of an oligonucleotide having the nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 6; and a pair of primers selected from the group consisting of .

The primer pair of the present invention is a pair of primers capable of easily discriminating SNPs related to radish disease, and consists of primers capable of accurately amplifying sequences near SNPs at different positions in radish genome.

By performing polymerase chain reaction (PCR) using these primer pairs and the nucleic acid of the sample and analyzing the amplified product by high resolution melting (HRM) or analyzing the nucleotide sequence of the amplified product, The genotype can be confirmed, and the resistance to the boar sickness can be judged according to the result.

In the primer set of the present invention, even if each of the primer pairs is used separately, resistance to radish disease can be discriminated. However, by using both the first primer pair, the second primer pair and the third primer pair, .

According to another aspect of the present invention, there is provided a composition for determining resistance to rainbow trouts comprising the primer set. At this time, the composition may further include components necessary for performing PCR, such as dNTPs, buffers, etc., in addition to the primer set. In some cases, a polymerase may be included.

According to still another aspect of the present invention, there is provided a kit for determining resistance to resistance to diseases, comprising the composition. In this case, the kit may further include a reagent, an apparatus, or an apparatus necessary for performing nucleic acid extraction, PCR, or HRM from the sample in addition to the composition. For example, CTAB buffer, isopropyl alcohol, ethanol, TE buffer, dNTP, PCR buffer, polymerase, and microcentrifuge tube.

According to still another aspect of the present invention, there is provided a method for producing an oligonucleotide comprising a nucleotide sequence isolated from a non-specimen as a template, an oligonucleotide having a nucleotide sequence of SEQ ID NO: 1, and a pair of first primers consisting of an oligonucleotide having a nucleotide sequence of SEQ ID NO: A second primer pair consisting of an oligonucleotide having the nucleotide sequence of SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 4, and a pair of oligonucleotides having the nucleotide sequence of SEQ ID NO: 5 and a second pair of oligonucleotides having the nucleotide sequence of SEQ ID NO: Performing a polymerase chain reaction (PCR) on a pair of primers selected from among a third pair of primers composed of oligonucleotides; And performing high resolution melting (HRM) analysis using the amplification product obtained by the polymerase chain reaction.

The resistance of the non-susceptible bacterium can be determined based on the melting temperature obtained by the polymerase chain reaction and HRM analysis using the primer pair of the present invention. In the case of using the first primer pair, it can be judged that the resistance to non-stressor disease is excellent when the melting temperature is 79.61 ± 0.05 ° C, and it can be judged that resistance to non-stressor disease is low if the melting temperature is 78.54 ± 0.05 ° C. In the case of using the second primer pair, it can be judged that the resistance to non-stressor disease is excellent when the fusion temperature is 80.37 ± 0.05 ° C, and it can be judged that the resistance to nonospore disease is low if the fusion temperature is 79.96 ± 0.05 ° C. In the case of using the third primer pair, it can be judged that the resistance to non-sickness disease is excellent when the melting temperature is 82.78 ± 0.05 ° C, and it can be judged that the resistance to non-sickness disease is low if the melting temperature is 82.50 ± 0.05 ° C. In addition, when a large number of samples are applied, two types of melting temperatures can be observed depending on each pair of primers. Among them, those having a high melting temperature can be judged as having excellent resistance to anthracnose disease, It is possible to judge that the resistance to non-bovine diseases is low.

In the method for determining resistance to intolerance of the present invention, even if each of the primer pairs is used separately, it is possible to discriminate resistance to non-infectious diseases. However, by using all of the first primer pair, the second primer pair and the third primer pair It is desirable to enhance discrimination accuracy.

According to the present invention, it is possible to quickly and accurately discriminate resistance to radish strain. Accordingly, it is possible to select and cultivate radishes having excellent resistance to viviparous diseases, thereby contributing greatly to reducing the damage caused by the viviparous diseases, as well as being resistant to viviparous diseases and also useful for developing new varieties having other useful characteristics It is expected.

Fig. 1 shows the result of marker analysis available on the basis of the information of the Chinese cabbage genome.
Fig. 2 shows the results of PCR using SNP primers related to a non-sweet potato resistance.
FIG. 3 shows the result of applying the HRM analysis method to the non-susceptible strain and the susceptible line using the primer pair of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

Example 1. No-sample preparation and genomic DNA extraction

Based on the results of long - term cultivation, the young leaves of three strains (three resistant and three susceptible strains), which are clearly distinguished from resistance and susceptibility, were collected from domestic seed companies.

Genomic DNA was extracted from each of the collected samples by slightly modifying the CTAB method (Doyle and Doyle, 1990). A more detailed description follows.

The juvenile leaves of the radish were finely ground using liquid nitrogen, and then placed in a 1.5-ml microcentrifuge tube and washed with 600 μl of CTAB buffer (2% w / v CTAB, 1.42 M NaCl, 20 mM EDTA, 100 mM Tris- % w / v polyvinylpyrrolidine (PVP-40), 5mM ascorbic acid) were added to each well. The treated sample was centrifuged at a rate of 15,000 rpm for 10 minutes at room temperature to remove the sample residue, and only the clear sample solution was transferred to a new tube. To the clean supernatant transferred to a new tube, a solution of CI (Chloroform: Isoamyl alchol) in a volume ratio of 24: 1 (v / v) was added and mixed, and centrifuged at 15,000 rpm to transfer the clear solution to a new tube. The clear supernatant was loaded with the same volume of isopropyl alochol, and genomic DNA was precipitated, washed with 70% ethanol and dissolved in TE buffer containing RNase A. Each genomic DNA sample thus prepared was quantified using a Nanodrop 1000 spectrophotometer (Thermo Scientic, Wilmington, USA) and stored at -20 ° C until use.

Example 2. Analysis of radish SNP information based on genome information of Chinese cabbage

In order to confirm the position of the 8,000 disease resistance-associated SNP primer pairs developed by the present inventors, gene prediction was performed from the BAC clone sequence of Brassica rapa in the Chinese cabbage genome database to confirm the position of each primer, Respectively. The Chinese cabbage genome sequence disclosed in NCBI dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP/), which is already registered with SNPs and various variation related data, is set as a reference, and the cabbage resistance-associated SNP primer All sequences of the pair were aligned using the CLC Genomics Workbench program and SNP primer candidates were selected. The primer conditions were set to a product size of 150 to 200 bp, a Tm value of 57 to 60 ° C and a GC content of 50 to 60%.

The primer sequences of the Chinese cabbage SNP markers were mapped to the nucleotide sequences of the radishes to determine whether PCR was possible. The actual sequences used were GSS, ESTs, and mRNA (see Table 1). The primer sequences of the Chinese cabbage SNP markers were aligned in paired-end manner, and their PCR product sizes were restricted to 50 ~ 1500bp, and classified as SNP markers that could be used when alignment to one template sequence. Gene structure information on the genome was divided into exon, intron, and CDS, and the position information of each potential SNP was analyzed. As a result, 234 SNPs expected to be applicable to radish were selected (see Table 2).

R. sativus sequence information for ortholog analysis R. sativus (Radish) ESTs 123,451 Genome GSS (14) mRNA 537 Protein 440

Unavailability rate of SNP markers related to resistance to cabbage disease organism R. sativus (Radish) template 124,002 PCR success marker 234 PCR success rate (%) 3.06

Using the CLC Genomics Workbench program, FunCat results were obtained by gene sequence analysis and gene orthology (GO) analysis in the existing databases of Nu, comparing the nucleotide sequence information and non-nucleotide sequence information of the cabbage resistance-related SNP markers . In other words, the available markers were classified into 26 molecular functions, 32 biological processes, and 51 cellular components (see Figure 1).

Example 3: Selection of SNP markers related to non-bullous diseases

PCR and HRM were performed using the genomic DNA prepared in Example 1 above. The primer combinations used included 25 primer combinations that included only 145 SNP markers related to cabbage resistance resistance and only 1 SNP among 234 unapplicable SNP analyzed based on the cabbage genome information.

3-1. PCR analysis

PCR was performed using an Eppendorf gradient S PCR machine system (Effendorf, USA) for PCR (polymerase chain reaction). For the PCR reaction, 50 ng of template DNA, 1.25 μl of 10X buffer, 0.5 μl of 10 mM dNTPmix, (5 μM), 1 μl of reverse primer (5 μM) and 0.1 μl of Taq polymerase (GenetBio, Korea) were mixed and distilled water was added to a final volume of 20 μl.

The PCR amplification conditions are shown in Table 3 below.

Temperature time Initiation degeneration 95 ℃ 5 minutes
30cycle denaturalization 95 ℃ 1 minute restore 55 ° C 1 minute extension 72 ℃ 1 minute 30 seconds Final extension 72 ℃ 10 minutes

Electrophoresis was performed on a 2% metaphore agarose gel to confirm amplification results.

As a result of primary PCR using 145 markers among the cabbage resistance-related SNP markers, amplification bands were generated from 54 markers of 145 HRM analysis SNPs, and real-time PCR analysis was possible. Further, through the information analysis of Example 2, PCR was performed using primer pairs for 25 SNPs that were judged to be applicable to radish, and as a result, a single band was amplified from 16 SNP primer pairs and used for subsequent HRM analysis 2 and Table 4).

No applicable SNP marker PCR results PCR amplification type Amplified primer No. HRM analysis Single-band 70 ○ Multi-band 3 × No amplification 97 ×

3-2. HRM analysis

High resolution melting (HRM) was performed using 70 SNP primer pairs amplified in a single band in 3-1 above.

For HRM analysis, 50 ng of template DNA, 1 μl of forward primer (5 μM), 1 μl of reverse primer (5 μM) and 1 μl of Bio-Rad ssofast evagreen 2X) were mixed and filled with distilled water to a final volume of 20 占 퐇. The amplification conditions are shown in Table 5 below.

Temperature time Initiation degeneration 98 ℃ 2 minutes
40cycle denaturalization 98 ℃ 2 seconds restore 57 ℃ 15 seconds extension 65 to 95 ° C 0.2 ° C increase every 10 seconds

Ten of the 70 SNP primer pairs showed the difference between the three strains with no resistance and the three susceptible strains. Among these, three SNP primer pairs (RF_SNP2668, RF_SNP0026, and RF_SNP0137) were highly reproducible and showed a specific difference between resistance varieties (R) and susceptibility varieties (S) And Table 6).

Results of HRM analysis for discrimination of resistance Genotypes Melt temperature (℃) RF_SNP2668 RF_SNP0026 RF_SNP0137 R 79.61 80.37 82.78 S 78.54 79.96 82.50

Thus, the primer pair as shown in Table 7 below was finally selected as a marker for resistance to non-rice bug resistance.

SNP marker Forward primer sequence Reverse primer sequence RF_SNP2668 AGGCTGATAACCGCGAAC GGAACTTCTCTTGGTTCACCC RF_SNP0026 TCCAGAGGAGAGAACGGAGA GATGCATGCTATGACTTGATATGAC RF_SNP0137 GAGTCACCACCCTCGTTTGT GAAATTGTTAAGCGGCCAAG

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> SNP primer sets for discrimination of fusarium wilt resistance          Radish and uses thereof <130> PA-D15128 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RF_SNP 2666 <400> 1 aggctgataa ccgcgaac 18 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RF_SNP 2666 <400> 2 ggaacttctc ttggttcacc c 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RF_SNP0026 <400> 3 tccagaggag agaacggaga 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RF_SNP0026 <400> 4 gatgcatgct atgacttgat atgac 25 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RF_SNP0137 <400> 5 gagtcaccac cctcgtttgt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RF_SNP0137 <400> 6 gaaattgtta agcggccaag 20

Claims (8)

A primer set comprising a primer pair consisting of an oligonucleotide having a nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide having a nucleotide sequence of SEQ ID NO: 2. The method according to claim 1,
A pair of primers consisting of an oligonucleotide having the nucleotide sequence of SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 4; And
A pair of primers selected from the group consisting of an oligonucleotide having a nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide having a nucleotide sequence of SEQ ID NO: 6. 3. The method of claim 2,
The primer set
Wherein the primer set includes all of the three primer pairs. A composition for determining resistance to an opium resistance comprising a primer set according to any one of claims 1 to 3. A kit for determining resistance to resistance to diseases, comprising the composition of claim 4. A polymerase chain reaction (PCR) was performed on a pair of primers consisting of an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 2 with the nucleotide separated from the no-sample as a template ; And
And performing HRM (high resolution melting) analysis using the amplification product obtained by the polymerase chain reaction. The method according to claim 6,
An oligonucleotide having the nucleotide sequence of SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 4, and a pair of oligonucleotides having the nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: Wherein the polymerase chain reaction is carried out by further using a primer pair selected from among primer pairs constituted by the primer pair. 8. The method of claim 7,
Wherein the primer pairs are used in all three primer pairs to perform a polymerase chain reaction.

Images