KR20140062712A - A method for identifying hot pepper varieties using microsatellites markers - Google Patents

Abstract

The present invention relates to a method for distinguishing hot pepper species using a microsatellite marker for distinguishing hot pepper species that represent polymorphism for hot pepper species that are distributed in Korea and to a kit including the microsatellite marker. In particular, the present invention enables a user to select the combination of the microsatellite marker having high polymorphism for 170 hot pepper species that are distributed domestically and internationally and distinguish hot pepper species that are distributed in the Korean seed market by using same. A molecular marker for distinguishing the hot pepper species that is used in the method of the present invention not only can distinguish the 170 hot pepper species but also can be usefully used to inspect the purity of F1 seeds by having a marker that represents heterozygosity for distinguishing the parents of all species. Accordingly, when a seed conflict occurs between a farm and a seed company or between a seed company and another seed company, the present invention can be very usefully used in various fields comprising: providing arbitration means for solving the problem; investigating the authenticity of hot peppers that are circulating in the market; selecting comparison species when applying for species protection; pre-monitoring the infringement of rights; and confirming the purity of F1 seeds.

Description

Technical Field [0001] The present invention relates to a method for identifying pepper cultivars using a supersatellite marker,

The present invention relates to a molecular beacon, that is, a supersaturate marker, a method for identifying a pepper variety using the marker, a method for identifying F1 seed purity, and a kit containing the marker, which exhibit polymorphism for a variety of pepper cultivated in a domestic seed company.

The UPOV provides guidelines for the selection of genetic analysis methods, selection of DNA markers, DNA isolation methods, and database construction in order to obtain reliable analysis results between laboratories and researchers on the use of molecular markers . This guideline is based on the assumption that the use of molecular markers is not only highly reproducible between labs and researchers but also has a bellicarity and that the utilized molecular markers are evenly distributed on the chromosome and that the same results should be obtained even when using various analyzers . Most suitable for this requirement is SSR (Simple Sequence Repeat) analysis method which confirms the polymorphism between the analytical materials by utilizing the difference of repetitive nucleotide sequences present on the chromosome. In fact, in Europe, a database of DNA profiles for 500 varieties of potatoes, roses, tomatoes and other crops under the auspices of the European Variety Protection Office (CPVO) has been established and the results of the research are reported. In China and Japan, SSR analysis technology for rice, corn, raspberry, strawberry, and other crops has been used for databases such as breeder protection rights and protection of agricultural products. On the other hand, in Korea, the use of molecular markers capable of identifying varieties of crops such as radish, Chinese cabbage, watermelon, melon, cucumber, rice and the like, which are highly important in the seed market or are likely to cause conflict in the seed market, We have constructed or are in the process of constructing a database of DNA profiles for 100 ~ 500 varieties per plant. In fact, we use the DNA profile database for each varieties to select the control varieties for varietal protection varieties and to verify the discriminability, uniformity and stability of varietal protection cultivation In recent years, gene analysis technology has been actively used to confirm the characteristics of varieties that are registered as varieties. In addition, breed identification molecular markers are being actively used as a means to mediate the occurrence of seed disputes related to breed authenticity between farmers, seed companies and seed companies.

As of 2011, the cultivated area of pepper is 42,574 ha and the production amount is 77,110 tons. As of October 2012, 258 varieties registered for the breed protection application and 2011 varieties for which production import and sale are reported are distributed in the domestic seed market.

In 2004 and 2006, 228 SSR markers derived from the genomic library and EST were used in the research team of Seoul National University in Korea. TF68 ( Capsicum annuum ) and Habanero ( Capsicum Genomic maps of the F2 population in which the genus Chinensis was crossed were created (Lee JM, Nahm SH, Kim YM and Kim BD 2004, Theoretical Applied Genetics 108, 619-627; Yi GB, Lee JM, Lee SH, Choi DI and Kim, BD 2006, Theoretical Applied Genetics, 114, 113-130). In Japan, 106 SSR markers were developed in-house, and Manganji ( Capsicum In this study, we have also reported the results of a genetic map study of the annuum and Tongari ( C. annuum ) cultured populations (Minamiyama Y, Tsuro M and Hirai M. 2006, Molecular Breeding 18, 157-169). In Italy and Germany, SSR markers derived from genomic libraries and ESTs have been developed and evaluated for the characterization of genetic resources and the possibility of application to branches and crops (Portas E, Nagyb I, Sasvarib Z, Stagela A, Barchia L and Lanteria S. 2007, Plant Science 172, 640-648; Nagy I, Stagel A, Sasvari Z, Roder M and Ganal M. 2007, Genome 50, 668-688). In recent years, SNP markers suitable for the identification of pepper cultivars have been developed to establish an identification system for 98 Korean pepper cultivars (Jung JM, Park SW, Liu WY and Kang BC, 2010. Euphytica 175: 97-107) Because SNP markers are dominant markers, it is pointed out that there is a limit to practical use of SNP markers due to problems such as repeated reproducibility of analysis methods and the use of limited varieties in analysis. In conclusion, the identification of varieties that can be identified by SSR markers, one of the genetic analysis techniques proposed by UPOV, is not yet established, There is no accurate DNA profile construction.

Therefore, the present inventors selected a supersatellite marker showing polymorphism in 170 cultivars of domestic red pepper and amplified the pepper genomic DNA using these supersatellite marker sets as primers, When the genetic pattern and polymorphic information content (PIC) values are examined, it is revealed that the supersatellite marker is suitable for the identification method of the pepper variety, and at the same time, there is a molecular label having a heterozygous property which can identify the parents of all the pepper cultivars And it was judged that this marker set could be very useful for the purity determination of the pepper seeds. These results can be applied to various aspects such as selection of control varieties at the time of application for breed protection, scientific verification of breed authenticity at seed occurrence, seed distribution control and quality control of F1 seed.

It is an object of the present invention to provide a supersatellite marker which exhibits high polymorphism for 170 varieties of red pepper which are distributed in Korea.

It is still another object of the present invention to provide a method of identifying pepper cultivars using the supersatellite markers.

It is another object of the present invention to provide a method for identifying a variety of pepper cultivars, which makes it possible to predict the genetic similarity of the pepper cultivars cultivated in a seed company at the DNA level and directly utilize them for selection of a control cultivar when applying for breed protection.

It is another object of the present invention to provide a method and apparatus for evaluating the authenticity of pepper varieties sold in the seed market by applying molecular biology technology to the authenticity testing of the varieties of pepper, And to provide a method for distinguishing the pepper cultivars which can be very useful for solving seed conflicts related to the genetic authenticity occurring between a seed company, a seedling farmer, a farmer or a seed company and a seed company.

Another object of the present invention is to determine whether the two alleles representing the two alleles according to the varieties among the molecular markers used for the identification of the pepper cultivars indicate the genotype of the parents crossed at the breeding time, Level of knowledge.

In order to accomplish the above object, the present invention provides a marker for identifying a pepper cultivar, which comprises a primer set (SEQ ID NOS: 1 to 48) exhibiting polymorphism for a variety of red pepper distributed at home and abroad.

The present invention also provides a method for amplifying a nucleic acid comprising the steps of amplifying a nucleic acid using a genomic DNA derived from pepper as a template and using at least one primer set of SEQ ID NO: 1 to SEQ ID NO: 48 as a primer; And identifying a varietal of the pepper from the amplification product.

The present invention also provides a method for amplifying a nucleic acid comprising the steps of amplifying a nucleic acid using a genomic DNA derived from pepper as a template and using at least one primer set of SEQ ID NO: 1 to SEQ ID NO: 48 as a primer; Selecting a primer set having the number of the alleles having a gene specificity in the amplification products and having the number of alleles; Amplifying the nucleic acid by using the genomic DNA of a hybrid of a wild-type (F1) of a pepper to be tested for purity as a template and using the selected primer set as a primer; And determining that the amplification product has the size of the allele specific to the variety and that the number of alleles is two and that the F1 breed of the red pepper is purebred .

In addition, the present invention provides a kit for identifying a pepper variety comprising at least one primer set of SEQ ID NOS: 1-48.

In addition, the present invention provides a kit for testing the purity of pepper-one hybrid (F1) cultivars comprising at least one primer set of SEQ ID NOS: 1-48.

Hereinafter, the present invention will be described in more detail.

The present invention provides a marker for identifying pepper cultivars, including a primer set (SEQ ID NOS: 1 to 48) exhibiting polymorphism for pepper cultivars distributed in domestic and overseas seed markets.

The marker is a supersatellite marker showing high polymorphism for 170 varieties of red pepper distributed in Korea, and it can specifically discriminate the red pepper cultivars distributed in Korea. The markers of the present invention are SSR markers exhibiting high polymorphism for 170 varieties of red pepper cultivated and sold in domestic seed companies. Specifically, the markers of the present invention showed high polymorphism for 170 varieties of pepper described in Table 2 below.

The marker of the present invention may comprise, for example, one or more markers selected from the group consisting of the nucleotide sequences shown in Table 1 (SEQ ID NOS: 1 to 48).

Markers used to identify pepper varieties SEQ ID NO: Supersatellite marking factor Primer base sequence Fluorescent staining One CAMS051
Forward: ACCCAGTTCCCTTTCTTGGT VIC
2 Reverse: GAAGGTTAGCGGAATGAACG 3 CAMS117
Forward: TTGTGGAGGAAACAAGCAAA NED
4 Reverse: CCTCAGCCCAGGAGACATAA 5 CAMS336
Forward: GGTGGAAACTTGCTTGGAGA PET
6 Reverse direction: CCCAGAACCATCCACCTACT 7 CAMS351
Forward: CGCATGAAGCAAATGTACCA FAM
8 Reverse: ACCTGCAGTTTGTTGTTGGA 9 CAMS855
Forward: AAGTGTCAAGGAAGGGGACA VIC
10 Reverse direction: CCTAACCACCCCCAAAAGTT 11 GPMS029
Forward: CAGGCAATACGGAGCATC NED
12 Reverse direction: TGTGTTGCTTCTTGGACGAC 13 GPMS100
Forward: TCCATACGGTTGGAGGAGAG FAM
14 Reverse: ACTATGCTCTGCTGTGCCCT 15 GPMS117
Forward: GATGTTAGGTCCGTGCTTCG VIC
16 Reverse: AAGCCCCATGGAAGTTATCC 17 GPMS159
Forward: AAGAACATGAGGAACTTTAACCATG NED
18 Reverse direction: TTCACCCTTCTCCGACTCC 19 GPMS161
Forward: CGAAATCCAATAAACGAGTGAAG FAM
20 Reverse: CCTGTGTGAACAAGTTTTCAGG 21 GPMS194
Forward: AGGTGGCAGTTGAGGCTAAG NED
22 Reverse: GTTCTAGGTCTTTGCCCTGG 23 GPMS197
Forward: GCAGAGAAAATAAAATTCTCGG FAM
24 Reverse direction: CAATGGAAATTTCATCGACG 25 EPMS305
Forward: CGTCTTTCACTTGTCTTTTGTTC VIC
26 Reverse: AGTGGGTTCACTGACTTGGG 27 EPMS331
Forward: AACCCAATCCCCTTATCCAC NED
28 Reverse: GCATTAGCAGAAGCCATTTG 29 EPMS376
Forward: ACCCACCTTCATCAACAACC PET
30 Reverse: ATTTGTGGCTTTTCGAAACG 31 EPMS386
Forward: ACGCCAAGAAAATCATCTCC VIC
32 Reverse direction: CCATTGCTGAAGAAAATGGG 33 EPMS418
Forward: ATCTTCTTCTCATTTCTCCCTTC NED
34 Reverse direction: TGCTCAGCATTAACGACGTC 35 EPMS426
Forward: GAGGAAACACTCTCTCTCTCTCTC FAM
36 Reverse direction: TCAAGAGACCCCAAATAGGG 37 EPMS441
Forward: GCACGAGGAAAGAGAGAGACATAG PET
38 Reverse direction: TCAACGGATTCAGTCTTCCC 39 EPMS542
Forward: ATCCACTTCCCCATTATCCC NED
40 Reverse direction: TGGATGATCGAGTTGACTGG 41 EPMS642
Forward: CAACTTCGCGTTATTGTCCA FAM
42 Reverse direction: AGGGCGGACAAAGAAGATTT 43 EPMS643
Forward: CCAAGATCAACTCTTACGCTAT PET
44 Reverse direction: CCCCTCAAGAATTCCCTCCAT 45 EPMS709
Forward: ACGCCGAGGACTATGATGAC NED
46 Reverse direction: TTCTTCATCCTCAGCGTGTG 47 EPMS755
Forward: CGCTCGCTACCCTTTCATTA FAM
48 Reverse: AATTTCGGAAGGGCAAAGAT

The present invention also provides a method for amplifying a nucleic acid comprising the steps of amplifying a nucleic acid using a genomic DNA derived from pepper as a template and using at least one primer set of SEQ ID NO: 1 to SEQ ID NO: 48 as a primer; And identifying a varietal of the pepper from the amplification product.

In the pepper cultivar identification method of the present invention, genomic DNA derived from pepper can be obtained by using a conventional method of collecting DNA from the whole plant of pepper seed and pepper. For example, genomic DNA derived from red pepper may originate from the leaves, stems, flesh or roots of red pepper seeds or red pepper, and may be harvested from leaves of young red pepper plants, especially after seeding and emergence.

In the pepper cultivar identification method of the present invention, amplification of genomic DNA is preferably performed using PCR reaction. Methods for performing general PCR are well known in the art. Specifically, the PCR reaction can be carried out using a PCR reaction solution containing various components known to be necessary for the PCR reaction in the art. For example, the PCR reaction solution includes genomic DNA derived from pepper to be analyzed, a marker of the present invention, an appropriate amount of DNA polymerase (for example, Taq polymerase), dNTP mixture, PCR buffer solution and water. The PCR buffer may contain KCl, Tris-HCl and MgCl _2.

In the present invention, the step of discriminating the pepper cultivars from the amplified products can be performed by identifying the size of the alleles (bands) using an automatic nucleotide sequence analyzer by a computer program, and then identifying the respective varieties. Concretely, the presence or absence of the amplification product by the markers of the present invention is tabulated for each of the pepper varieties, and the pepper varieties can be identified by comparing with the amplified products. For example, using the markers of the present invention, the sizes of the alleles from each of the red pepper cultivars are summarized in a table in advance, and the presence or absence of alleles is determined. When the alleles are present, they are represented as "1" If not, it is indicated by "0". Therefore, the genomic DNA is isolated from pepper to discriminate the breed, amplified using the marker of the present invention, analyzed for the size of the amplified product, and then the identification of the pepper cultivar can be confirmed through a statistical program.

The present invention also provides a method for testing the purity of pepper F1 varieties. The method comprising: amplifying a nucleic acid using genomic DNA derived from pepper as a template and using at least one of the pepper variety identifying primers set forth in SEQ ID NOS: 1 to 48 as a primer; Selecting a primer set which shows a variety specific allele in the amplification product and in which the number of alleles is two; Amplifying the nucleic acid using the genomic DNA of the pepper F1 variety to be tested for purity as a template and using the selected primer set as a primer; And determining that the F1 breed of the red pepper having the size of the allelic gene of the above-mentioned amplification product and having the number of alleles of 2 is pure obedience.

In the present invention, genomic DNA derived from pepper can be obtained by using a conventional method of collecting DNA from seeds of pepper and whole plants of pepper. Using the obtained genomic DNA derived from the pepper as a template, the presence or absence of the amplification product is tabulated using one or more pepper cultivar identification primers set forth in SEQ ID NOS: 1 to 48 as primers. For example, DNA was collected from 170 varieties of red pepper distributed in domestic market described in the following Table 2, and amplified using a pepper variety identifying primer set, and the presence or absence of amplification products as shown in Fig. 2 was tabulated do. For example, according to FIG. 2, there are two alleles for the CAMS051 primer set and two alleles for the CAMS351 primer set. In the above table, a primer set having a specific allele gene for each of the pepper cultivars and having the number of the alleles, that is, a co-dominance primer set is selected. For example, for the 'endless spore' varieties (100 in FIG. 2), the marker CAMS117 can not distinguish between the parents because only one band representing the allele appears, so that the purity of the 'endless spore' Can not be used as a marker. However, according to the marker 2 for 'endless running' varieties, CAMS051, CAMS351, GPMS029, GPMS117, GPMS159, GPMS161, GPMS197, EPMS305, EPMS376, EPMS386, EPMS426, EPMS542, EPMS642, EPMS643 contain two specific alleles . These markers can be used as markers to test the purity of the 'endless' varieties as they can identify the parents of 'endless' varieties.

Genomic DNA of F1 breed of pepper to be tested for purity is extracted. The method for extracting the genomic DNA is carried out in the same manner as the method for extracting genomic DNA from the red pepper.

The nucleic acid is amplified using the genomic DNA of the F1 breed of pepper to be tested for purity as a template and the selected primer set as a primer.

When the size of the allele in the amplification product is specific to the variety and the number of the allele is 2, the F1 breed of the red pepper is verified to be a purebred normal cross between the parents. When the number of alleles is 1 in the amplification product, it is judged that the F1 breed of the red pepper does not cross between the parents.

In addition, the present invention provides a kit for identifying a pepper variety comprising at least one primer set of SEQ ID NOS: 1-48. The kit of the present invention comprises at least one of the primer sets of the present invention, a DNA polymerase and a PCR buffer solution. In addition, components necessary for conducting electrophoresis to confirm whether the PCR product is amplified can be further included in the kit of the present invention.

In addition, the present invention provides a kit for testing the purity of pepper-one hybrid (F1) cultivars comprising at least one primer set of SEQ ID NOS: 1-48. The kit of the present invention comprises at least one of the primer sets of the present invention, a DNA polymerase and a PCR buffer solution. In addition, components necessary for conducting electrophoresis to confirm whether the PCR product is amplified can be further included in the kit of the present invention.

Using only the markers for identifying the pepper varieties of the present invention, it is possible to identify 170 major varieties sold in the domestic and overseas seed markets. Therefore, it can be useful in various fields such as preliminary monitoring of infringement of breed protection through identification of genuineness of pepper cultivars, confirmation of infringement, selection of control varieties at the time of application for breed protection, and confirmation of purity when producing F1 seeds.

FIGS. 1A to 1C are graphs showing the genetic similarity of the pepper cultivars according to the present invention, by encoding each of the pepper cultivars analyzed by the marker according to the present invention and utilizing the NTSYSPC computer program.
FIGS. 2A to 2I are diagrams illustrating the presence or absence of bands according to the sizes (bp) of alleles when amplified using 24 primer sets of the present invention in 170 pepper cultivars cultivated in Korea. Quot; 1 ", and when there is no band, it is represented by " 0 ".

Hereinafter, the present invention will be described in more detail by way of examples. However, the present invention is not limited by the following examples.

Example  1: for identification of pepper varieties Marker  evaluation

(1) Pepper samples

In the present invention, 170 kinds of red pepper described in the following Table 2 were used for screening the pepper cultivar discriminating primer set and for testing the discrimination ability of the red pepper cultivars.

Serial number Breed name Upbringing company Serial number Breed name Upbringing company Serial number Breed name Upbringing company One Super maniac Nongwoo 58 Golden Syngenta 115 Grassland consistently KS 2 Hong Mi-in Nongwoo 59 Heavily Eastern 116 new world Sakata 3 Lives PR Nongwoo 60 A supper Nongwoo 117 PR Dragon Eco seed 4 Double Nongwoo 61 Big Nongwoo 118 PR Apollo Eco seed 5 Hong Jin-ju Nongwoo 62 Korean Peninsula Nongwoo 119 A disease free longevity Samsung 6 Ohbok Nongwoo 63 Mirak Hong Modern 120 TPE010 Daki 7 PR villages Nongwoo 64 Tian Syngenta 121 Hongwon peace 8 PR win-win Nongwoo 65 SS-33 Samsung 122 Strong Bayer 9 PR Mani Ta Nongwoo 66 The government agency Syngenta 123 Winner glory Modern 10 PR matching Nongwoo 67 This plus Samsung 124 Daobo Tower Monsanto 11 PR passion Nongwoo 68 Our thing Samsung 125 Daily Gold Syngenta 12 PR Goldfish Nongwoo 69 Daecon Nongwoo 126 Red Cliff Wars Bayer 13 PR Shin Nongwoo 70 Gossip Nongwoo 127 The Monsanto 14 Mani Ta Nongwoo 71 Stiff Cedex 128 Gold floor Monsanto 15 Prosperity Syngenta 72 Home Run Cedex 129 Flourishing Eastern 16 One person Syngenta 73 Taishan Nongwoo 130 New moon Farmer 17 festival Syngenta 74 Jamani Nongwoo 131 A new martyr Farmer 18 Super rainless Syngenta 75 Live foot Nongwoo 132 Beautiful Syngenta 19 Large intestine Syngenta 76 Sight Monsanto 133 Super granite Syngenta 20 Power speed Eastern 77 Tannic flavor Nongwoo 134 Fireworks Syngenta 21 new epoch Monsanto 78 Hwang most 135 Daphne Syngenta 22 Rich king Eastern 79 PR Giant Eco seed 136 Strong thing This 23 Hay king Samsung 80 TP052 Daki 137 A mild way Sakata 24 Absolute strong Samsung 81 Gold rich Eastern 138 PR Smart Nongwoo 25 Hero Hogel Samsung 82 Taste of Delight one 139 Pick and pull Asia 26 B25 Samsung 83 New Life Bayer 140 Asian Jumbo Asia 27 King Samsung 84 New PR Monsanto 141 New Tongkong Asia 28 Super Hong KS 85 PR Blue Tower Modern 142 Shin Lantern Sakata 29 Light purple Sakata 86 New Power Phoenix Farmer 143 Golden Bell Crop 30 e-rich Sakata 87 Double gun Farmer 144 Warhead Nongwoo 31 safety belt Sakata 88 Meet Me one 145 Seonon Seam Nongwoo 32 Polished Asia 89 PR Dragon 2 Eco seed 146 Three rural redshirts Nongwoo 33 squall Asia 90 TP034 Daki 147 Home taste Samsung 34 PR spark KOREGON 91 Hana 3 one 148 glamour Samsung 35 crossbeam Daki 92 Hana No. 2 one 149 Myth Creation Gold Samsung 36 Thousand Mobilization 93 Hana 1 one 150 Healthless Gold Samsung 37 Dojo Mobilization 94 I often think Regular 151 PR hay king Samsung 38 Hong Nolbu Hector 21 95 The strongest ever Samsung 152 PR couple Samsung 39 PR Gold Chili Monsanto 96 PR money Samsung 153 PR farmhouse king Samsung 40 PR diamond Monsanto 97 PR action Samsung 154 ambitious Sakata 41 This Monsanto 98 Bad taste Syngenta 155 World work Sakata 42 Crying Monsanto 99 Gesture Sakata 156 Asasak Rural Development Administration 43 Onnuri Monsanto 100 Infinite run Syngenta 157 Flaming Rural Development Administration 44 A villager Monsanto 101 General Kang Hong KOREGON 158 Red line Rural Development Administration 45 The best of the world Monsanto 102 Ode kulak 159 Enemy Rural Development Administration 46 Welcome Monsanto 103 Morning Foot Syngenta 160 Stronghold Bayer 47 PR peace NH 104 Sharp foot Nongwoo 161 RS902 Bayer 48 Korean people NH 105 BN54 Sakata 162 Papko red Samsung 49 PR crude Promotion 106 A standing ovation Syngenta 163 Pappo Yellow Samsung 50 TM strong listed group Crop 107 Long green flavor Nongwoo 164 Ecoef 79 Eco seed 51 Cheon Tae-pyeong Eastern 108 Dressing me Hector 21 165 Everlene Plus Syngenta 52 Gold Eastern 109 Farmhouse king Samsung 166 Midas Monsanto 53 Fast Eastern 110 The Samsung 167 special Enza 54 Kangsu Gangsan Daki 111 Shin Love Foot Mobilization 168 Pierrot Syngenta 55 One-sided Syngenta 112 A powerful tribute Bayer 169 A loaf of bread Asia 56 Gold tower Monsanto 113 High Green Foot Samsung 170 The best spicy Cheongyang most 57 Cheongyang Monsanto 114 Bite-in taste KS

(2) Extraction of genomic DNA

The disclosed pepper seeds described in Table 2 were seeded on a 50-well plug seedling plate, and after 3 weeks, the leaves of the fleshy region were collected and used as a genomic DNA separation material. Three tungsten beads were placed in a 2 ml tube containing the leaves of the red pepper and rapidly frozen using liquid nitrogen (-196 ° C). The vortexing procedure was repeated and the tissue was evenly ground. Genetically engineered tissues were isolated from genomic DNA using the NucleoSpin® Plant II (Macherey-Nagel Cat. 740 770.250) kit. The extracted genomic DNA was electrophoresed on a 1.0% agarose gel to confirm the DNA concentration. After quantification, the DNA was diluted to a concentration of 10 ng per μl and used for PCR analysis.

(3) SSR primer selection for breed identification

In order to select the effective molecular markers for the identification of the pepper varieties, 'Ochu', 'first order', 'Kangjeong', 'BN54', 'Green', 'Hibita Yellow', 'Gool', ' (HDA-GT12TM System, eGEnE, Inc.) and the computer, and then amplified using the 600 SSR primer sets reported in the DNA of the ' After analyzing the difference of alleles of each sample using the program (Biocalculator 2.0), 24 markers with high band pattern and high polymorphism were selected. Fluorescently labeled oligonucleotides were prepared with one of the fluorogenic materials FAM, VIC, NED and PET as forward primers in order to carry out a precise analysis of the molecular markers of these 24 markers using an automatic sequencer.

(4) PCR amplification and electrophoresis

PCR was performed using the prepared genomic DNA and the prepared marker as a material. The composition of the PCR reaction mixture was 20 ng of the prepared pepper genomic DNA, 0.1 μM of the marker, 2.0 μl of dNTP mixture (2.5 mM), 1 μl of Taq polymerase (Takara CAT.RR011A), 2.5 μl of 10 × PCR buffer KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl 2) was added to distilled water to adjust the total volume to 25 μl. PCR (C1000, BioRad, USA) amplification was performed by denaturing the genomic DNA at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and elongation at 72 ° C for 45 seconds for 40 times Lt; / RTI > The PCR product was reacted at 72 ° C for 10 minutes for final elongation. The annealing temperatures for each primer set are shown in Table 3 below. After completion of the PCR, amplification was confirmed by electrophoresis on 2.8% agarose gel. The amplified samples were stored at -20 ° C for the next experiment. The PCR amplified samples were diluted in 150 μl of ultrapure water to an appropriate concentration, and 3 μl of the diluted PCR product was added to 10 μl of deionized formamide, a size marker (size marker LIZ500 size standard) were mixed well and then denatured at 94 DEG C for 2 minutes. The denatured gene amplification product was electrophoresed using an automatic sequencing apparatus (Genetic Analyzer 3130XL, Applied Biosystem). The allele size of each species was measured accurately using GeneMapper3.7 computer program (Applied Biosystem).

(5) Identification of pepper varieties of markers according to the present invention

Identification of the pepper varieties of the marker according to the present invention was examined using the allele gene size determined by the automatic nucleotide sequence analyzer. Polymorphism information content (PIC) values were calculated using the following equation (1). In the following equation, Pij is the frequency of the jth common band pattern among the bands of the marker i (Anderson et al., 1993, Genome 36: 181-186).

<Formula 1>

As a result, annealing temperature (° C), amplification product size (bp), number of alleles and PIC value according to each marker are shown in Table 3 below.

Serial number SSR marker name Annealing temperature (캜)  The size of the allele (bp) Number of alleles PIC value One CAMS051 55 155-165 5 0.610 2 CAMS117 55 216-240 11 0.753 3 CAMS336 55 144-175 6 0.547 4 CAMS351 55 187-218 11 0.788 5 CAMS855 55 242-291 9 0.635 6 GPMS029 50 250-262 5 0.523 7 GPMS100 50 170-173 2 0.324 8 GPMS117 55 133-148 8 0.685 9 GPMS159 55 284-325 14 0.814 10 GPMS161 55 248-265 7 0.770 11 GPMS194 60 224-246 5 0.558 12 GPMS197 58 275-335 15 0.802 13 EPMS305 55 064-088 5 0.559 14 EPMS331 55 070-104 11 0.710 15 EPMS376 55 250-263 5 0.788 16 EPMS386 55 125-158 9 0.824 17 EPMS418 55 194-208 6 0.808 18 EPMS426 55 099-119 4 0.788 19 EPMS441 55 117-129 5 0.670 20 EPMS542 58 171-189 4 0.520 21 EPMS642 55 187-209 5 0.695 22 EPMS643 55 197-219 4 0.748 23 EPMS709 50 259-278 6 0.744 24 EPMS755 50 138-145 2 0.496 sum 164 16.156 Average 6.833 0.673

As shown in Table 3, two of the markers (GPMS100 and EPMS755) used in the present invention showed a PIC value lower than 0.50 and the remaining 22 markers showed a high PIC value from 0.520 to 0.814. Thus, it can be seen that the markers of the present invention can make the pepper cultivars sufficiently distinguishable.

In addition, NTSYS pc (version 2.10b) (Rohlf, 2000, Numerical Taxonomy and Multivariate Analysis System-Version 2.10b. Applied Biostatistics Inc., New York.) Computer program according to the presence of breed bands according to the size of the allele And genetic similarity values were calculated according to Jaccard's method (Sneath and Sokal 1973, Numerical taxonomy: The Principles and Practice of Numerical Classification, WH Freeman, San Francisco.). A dendrogram was constructed by using the genetic similarity method and analyzed by UPGMA (Sneath and Sokal, 1973) method. The results are shown in FIG. 1, it can be seen that the primer set of the present invention enables identification of 170 red pepper cultivars distributed in Korea.

Example  2: Identification of pepper varieties

(1) Using the marker of the present invention to prepare a variety identification list

Genomic DNA was extracted from each of the 170 pepper cultivars cultivated in Korea according to the method (2) of Example 1 above. PCR was carried out according to the method of (1) in (1) above using 24 markers of the present invention as a primer set. From the PCR result, the presence or absence of the band was determined for the marker according to the present invention. When the band was present, the marker was coded as score 1, and when there was no band, the marker was encoded as 0, The breed identification table was prepared. The results are shown in Fig. As shown in FIG. 2, according to the number of alleles according to the marker of the present invention, each of the pepper cultivars showed different band sizes. For example, in Table 2, the 'endless spikelets' of 100 varieties of pepper have two alleles of 157 bp and 163 bp when amplified with the molecular marker CAMS51.

(2) Identification of varieties of pepper

The seeds of the red pepper were sown on a 50 - well plug seedling plate, and after 3 weeks, the leaves of the fleshy region were collected and used as a genomic DNA separation material. Three tungsten beads were placed in a 2 ml tube containing the leaves of the red pepper and rapidly frozen using liquid nitrogen (-196 ° C), followed by vortexing to uniformly grind the tissue. Genetically engineered tissues were isolated from genomic DNA using the NucleoSpin® Plant II (Macherey-Nagel Cat. 740 770.250) kit. The extracted genomic DNA was electrophoresed on a 1.0% agarose gel to confirm the DNA concentration. After quantification, the DNA was diluted to a concentration of 10 ng per μl.

Each of the 24 markers of the present invention was amplified by PCR using the primer set and the extracted genomic DNA was subjected to electrophoresis. PCR amplification and electrophoresis were carried out in the same manner as described in Example 1 above. The presence or absence of bands in each electrophoresis result was compared with the results in Fig. The red pepper, which was intended to identify the variety, showed the same band type as that of 'endless spruce', so it was identified as 'endless spruce'.

Example  3: Pepper F1 seed purity test Marker  Selection

A variety identification table was prepared according to (1) of Example 2 above for 170 varieties of pepper (see Figs. 2A to 2I). Among the 170 varieties of pepper, the seeds of 'endless spruce' cultivars were ground and DNA was isolated in the same manner as in Example 2 (2). The isolated DNA was amplified using the 24 primers shown in Table 3, and the size and number of alleles were observed. The results are shown in Fig. According to FIG. 2, the markers CAMS117, CAMS336, CAMS855, GPMS100, GPMS194, EPMS331, EPMS418, EPMS441, EPMS709 and EPMS755 show only one allele and can not be distinguished from each other. However, two parents-specific alleles of the F1 breeds were clearly distinguished in the markers CAMS051, CAMS351, GPMS029, GPMS117, GPMS159, GPMS161, GPMS197, EPMS305, EPMS376, EPMS386, EPMS426, EPMS542, EPMS642 and EPMS643. Thus, these markers can identify the parents of the 'endless' varieties of pepper, and can be used as a marker to determine that the F1 breed has been generated by normal mating of the parents.

Example  4: Purity of black pepper F1 seed

The seeds of the &quot; endless &quot; variety to be tested for purity were subjected to DNA isolation as described in (2) of Example 2 above. The separated DNA was amplified using primers such as the markers CAMS051, CAMS351, GPMS029, GPMS117, GPMS159, GPMS161, GPMS197, EPMS305, EPMS376, EPMS386, EPMS426, EPMS542, EPMS642 and EPMS643. The amplification conditions were the same as described in (4) of Example 1 above. As a result, the number of alleles specific to the breed was two. Thus, the seeds of the tested 'infinite' F1 varieties could be verified to be purebreds produced from the normal mating of the parents.

<110> Korea Seed & Variety service <120> A method for identifying hot pepper varieties using          microsatellites markers <130> PN099244 <160> 48 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS051_F primer <400> 1 acccagttcc ctttcttggt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS051_R primer <400> 2 gaaggttagc ggaatgaacg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS117_F primer <400> 3 ttgtggagga aacaagcaaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS117_R primer <400> 4 cctcagccca ggagacataa 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS336_F primer <400> 5 ggtggaaact tgcttggaga 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS336_R primer <400> 6 cccagaacca tccacctact 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS351_F primer <400> 7 cgcatgaagc aaatgtacca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS351_R primer <400> 8 acctgcagtt tgttgttgga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS855_F primer <400> 9 aagtgtcaag gaaggggaca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAMS855_R primer <400> 10 cctaaccacc cccaaaagtt 20 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GPMS029_F primer <400> 11 caggcaatac ggagcatc 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPMS029_R primer <400> 12 tgtgttgctt cttggacgac 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPMS100_F primer <400> 13 tccatacggt tggaggagag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPMS100_R primer <400> 14 actatgctct gctgtgccct 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPMS117_F primer <400> 15 gatgttaggt ccgtgcttcg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPMS117_R primer <400> 16 aagccccatg gaagttatcc 20 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GPMS159_F primer <400> 17 aagaacatga ggaactttaa ccatg 25 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GPMS159_R primer <400> 18 ttcacccttc tccgactcc 19 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GPMS161_F primer <400> 19 cgaaatccaa taaacgagtg aag 23 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GPMS161_R primer <400> 20 cctgtgtgaa caagttttca gg 22 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPMS194_F primer <400> 21 aggtggcagt tgaggctaag 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPMS194_R primer <400> 22 gttctaggtc tttgccctgg 20 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GPMS197_F primer <400> 23 gcagagaaaa taaaattctc gg 22 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPMS197_R primer <400> 24 caatggaaat ttcatcgacg 20 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> EPMS305_F primer <400> 25 cgtctttcac ttgtcttttg ttc 23 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS305_R primer <400> 26 agtgggttca ctgacttggg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS331_F primer <400> 27 aacccaatcc ccttatccac 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS331_R primer <400> 28 gcattagcag aagccatttg 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS376_F primer <400> 29 acccaccttc atcaacaacc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS376_R primer <400> 30 atttgtggct tttcgaaacg 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS386_F primer <400> 31 acgccaagaa aatcatctcc 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS386_R primer <400> 32 ccattgctga agaaaatggg 20 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> EPMS418_F primer <400> 33 atcttcttct catttctccc ttc 23 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS418_R primer <400> 34 tgctcagcat taacgacgtc 20 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> EPMS426_F primer <400> 35 gaggaaacac tctctctctc tctctc 26 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS426_R primer <400> 36 tcaagagacc ccaaataggg 20 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> EPMS441_F primer <400> 37 gcacgaggaa agagagagac atag 24 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS441_R primer <400> 38 tcaacggatt cagtcttccc 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS542_F primer <400> 39 atccacttcc ccattatccc 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS542_R primer <400> 40 tggatgatcg agttgactgg 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS642_F primer <400> 41 caacttcgcg ttattgtcca 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS642_R primer <400> 42 agggcggaca aagaagattt 20 <210> 43 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> EPMS643_F primer <400> 43 ccaagatcaa ctcttacgct at 22 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EPMS643_R primer <400> 44 cccctcaaga attccctcca t 21 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS709_F primer <400> 45 acgccgagga ctatgatgac 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS709_R primer <400> 46 ttcttcatcc tcagcgtgtg 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS755_F primer <400> 47 cgctcgctac cctttcatta 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EPMS755_R primer <400> 48 aatttcggaa gggcaaagat 20

Claims (8)

A CAMS051 primer set consisting of the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2;
A CAMS117 primer set consisting of the oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4;
A CAMS336 primer set consisting of the oligonucleotides of SEQ ID NO: 5 and SEQ ID NO: 6;
A CAMS351 primer set consisting of oligonucleotides of SEQ ID NO: 7 and SEQ ID NO: 8;
A CAMS855 primer set consisting of oligonucleotides of SEQ ID NO: 9 and SEQ ID NO: 10;
A GPMS029 primer set consisting of oligonucleotides of SEQ ID NO: 11 and SEQ ID NO: 12;
A GPMS100 primer set consisting of oligonucleotides of SEQ ID NO: 13 and SEQ ID NO: 14;
A GPMS117 primer set consisting of oligonucleotides of SEQ ID NO: 15 and SEQ ID NO: 16;
A GPMS159 primer set consisting of oligonucleotides of SEQ ID NO: 17 and SEQ ID NO: 18;
A GPMS161 primer set consisting of oligonucleotides of SEQ ID NO: 19 and SEQ ID NO: 20;
A GPMS194 primer set consisting of oligonucleotides of SEQ ID NO: 21 and SEQ ID NO: 22;
A GPMS197 primer set consisting of oligonucleotides of SEQ ID NO: 23 and SEQ ID NO: 24;
An EPMS305 primer set consisting of oligonucleotides of SEQ ID NO: 25 and SEQ ID NO: 26;
An EPMS331 primer set consisting of oligonucleotides of SEQ ID NO: 27 and SEQ ID NO: 28;
An EPMS376 primer set consisting of oligonucleotides of SEQ ID NO: 29 and SEQ ID NO: 30;
An EPMS386 primer set consisting of oligonucleotides of SEQ ID NO: 31 and SEQ ID NO: 32;
An EPMS418 primer set consisting of oligonucleotides of SEQ ID NO: 33 and SEQ ID NO: 34;
An EPMS426 primer set consisting of oligonucleotides of SEQ ID NO: 35 and SEQ ID NO: 36;
An EPMS441 primer set consisting of oligonucleotides of SEQ ID NO: 37 and SEQ ID NO: 38;
An EPMS 542 primer set consisting of oligonucleotides of SEQ ID NO: 39 and SEQ ID NO: 40;
An EPMS642 primer set consisting of oligonucleotides of SEQ ID NO: 41 and SEQ ID NO: 42;
An EPMS643 primer set consisting of oligonucleotides of SEQ ID NO: 43 and SEQ ID NO: 44;
An EPMS709 primer set consisting of oligonucleotides of SEQ ID NO: 45 and SEQ ID NO: 46;
47. A primer set for identifying pepper cultivars, comprising at least one primer set selected from the group consisting of EPMS755 primer set consisting of oligonucleotides of SEQ ID NO: 47 and SEQ ID NO: 48. Amplifying the nucleic acid using a genomic DNA derived from pepper as a template and using a pepper variety identifying primer set of claim 1 as a primer; And identifying a varietal of the pepper from the amplification product. The method according to claim 2, wherein the detection of the obtained amplification product is performed by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. 3. The method according to claim 2, wherein the genomic DNA is derived from leaves, stems and fruit of the seeds or young plants of the red pepper. [Claim 2] The method according to claim 2, wherein the step of identifying the pepper cultivar from the amplification product comprises the step of preparing the pepper cultivar identification primer set according to claim 1 for each of the pepper cultivars and comparing the amplified product with the amplified product &Lt; / RTI &gt; wherein the method comprises identifying the pepper cultivar. Amplifying the nucleic acid using genomic DNA derived from pepper as a template and using at least one of the pepper variety identifying primers set forth in SEQ ID NOS: 1 to 48 as a primer;
Selecting a primer set which shows a variety specific allele in the amplification product and in which the number of alleles is two;
Amplifying the nucleic acid using genomic DNA of a F1 breed of pepper to be tested for purity as a template and using the selected primer set as a primer; And
Determining the purity of the pepper-grown hybrid (F1) cultivar including the step of determining that the amplification product has the size of the allele specific to the above-mentioned variety and that the number of alleles is 2 and that the F1 breed of the red pepper is purebred Way. A kit for identifying pepper cultivars comprising the pepper cultivar identification primer set, DNA polymerase and PCR buffer solution according to claim 1. A kit for purity determination of a red pepper (F1) variety including a pepper cultivar discriminating primer set, a DNA polymerase and a PCR buffer solution of claim 1.

Images