KR102151225B1 - Molecular marker based on nuclear genome sequence for discriminating Platycodon grandiflorum landraces and uses thereof - Google Patents

Abstract

The present invention is a molecular marker based on the nuclear genome sequence for distinguishing native Platycodon grandiflorum in the sunchang region of Korea, and a use thereof. The molecular marker of the present invention can quickly and accurately distinguish native Platycodon grandiflorum from the sunchang region among various Korean native Platycodon grandiflorum, thereby improving the reliability of the quality by providing consumers with accurate information (geographical indications) about the country of origin of the Platycodon grandiflorum.

Description

Molecular marker based on nuclear genome sequence for discriminating Platycodon grandiflorum landraces and uses thereof to distinguish native species of bellflower in Korea

The present invention relates to a nuclear genome sequence-based molecular marker and use thereof for distinguishing native bellflower species from Sunchang region among native bellflower species in 11 regions in Korea.

Recently, with the rapid development of molecular biology, a nucleic acid fingerprint analysis method and various DNA markers have been developed that enable the study of bio-diversity at the DNA level. Through this, it is possible to perform simple and rapid analysis of useful traits, species identification of organisms, breed classification and identification, and relationship analysis of population populations. Fingerprinting using polymerase chain reaction (PCR) developed so far includes randomly amplified polymorphic DNAs (RAPD) method, amplified fragment length polymorphic DNA (AFLP) method, and simple sequence repeat (SSR) method. Among the above methods, the RAPD method has a disadvantage of poor reproducibility because non-specific PCR products are amplified, and the AFLP method is in the spotlight for high DNA polymorphism detection, but the appearance and analysis of bands with low reproducibility are complicated. A method of analyzing the supersatellite within an individual by making a PCR primer based on the nucleotide sequence information of the microsatellite region, which is a repeating sequence.Since the number of repetitions of the simple nucleotide sequence differs between varieties or between individuals, PCR Polymorphism may occur when amplified by a reaction, but there is a disadvantage that it is not sufficient for high-density genetic mapping.

On the other hand, the InDel (insertion/deletion) marker complements the shortcomings of the SSR marker, which is not sufficient for high-density genetic mapping, while maintaining the advantage of showing polymorphism when amplified by PCR reaction. It is based on the insertion or deletion of nucleotide sequences between varieties through analysis.

Bellflower ( Platycodon grandiflorum ) is a perennial herb that grows up to 20 years and belongs to the Campanulaceae family. The lineages registered as bellflower varieties in Korea include Changbaek Doraji and Top White Doraji, which were secured through the periphery analysis of domestic bellflowers. In addition to this, there are also known strains that have not been registered but have been cultivated for generations by collecting seeds from Baekdoraji plants in Jeju Island, Miryang, and Asan.

As bellflower varieties registered in Korea so far, Gangsan, Dongchon, Sanaeul, Sancheon, Sancheonbaek Asian Road, Baby, Supreme, Supreme Baek, Changbaek, Jeil, Cheongnongmyeong, Cheongsan, and Cholongja Yeomteobaek are known, but most farmhouses In general, without knowing the exact cultivar, seeds harvested from strains collected in the field are cultivated for generations, or seeds grown in large quantities in one farm are sold and cultivated. Recently, it is known that there are large farmers who grow large amounts of seeds from China, so it is urgent to establish a seed guarantee system and a breeding system for varieties grown in Korea. In particular, since ancient times, local variety, which means a fixed species cultivated in a specific area, contains various genetic mutations such as various resistance genes while adapting to the environmental conditions of each region through natural selection for a long period of time. Although it can be very useful as a material and genetic resource, conventional species are rapidly disappearing due to urbanization, environmental destruction, farmland conversion, and uniform distribution of modern varieties. Therefore, it is necessary to develop a molecular genetic technology capable of classifying genetically related bellflowers for breeding research, variety improvement, variety protection, etc. of various bellflower lines, varieties or native species distributed in Korea.

On the other hand, Korean Patent Publication No. 2016-0134282 discloses a'marker for identifying the genus of Changbaek Doraji and a method for discriminating the lineage of Jangbaek Doraji using the same', and Korean Patent No. 1912192 discloses'Molecular markers and primers for discriminating bellflower varieties.' A set and its use' are disclosed, but there is no description of the nuclear genome sequence-based molecular marker and its use for distinguishing the domestic native species bellflower of the present invention.

The present invention was derived from the above request, and the present inventors provide nuclear genome information of native bellflowers in 11 regions in Korea (Sunchang, Pyeongchang, Geumsan, Ganghwa, Haman, Buan, Inje, Eumseong, Goseong, Suncheon and Cheonsong). After preparing a primer set based on a nucleotide sequence showing InDel (insertion/deletion) polymorphism by comparing with, PCR was performed on native bellflower samples from 11 regions in Korea using the primer set. By confirming that the marker can accurately distinguish only native bellflowers in the Sunchang area, the present invention was completed.

In order to solve the above problems, the present invention provides a primer set for distinguishing native bellflower species from Sunchang region from among domestic bellflower species including the oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2.

In addition, the present invention is the primer set; And it provides a kit for distinguishing the native species bellflower in the Sunchang region from among the domestic native bellflowers comprising a reagent for performing the amplification reaction.

In addition, the present invention comprises the steps of separating genomic DNA from a domestic native bellflower sample; Amplifying a target sequence using the isolated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set; And detecting the product of the amplification step. It provides a method for distinguishing native bellflower species from Sunchang region from among native bellflower species in Korea.

Since the InDel molecular marker of the present invention can quickly and accurately distinguish native bellflowers from Sunchang among various domestic bellflowers, it is possible to improve reliability in quality by providing accurate information (geographical indication) about the origin of bellflowers to consumers. There will be.

FIG. 1 is a result of comparing and analyzing the nuclear genome sequence of native bellflower strains, domestic bellflower varieties, or overseas bellflower bellflowers by region, and confirming the deletion polymorphic region (marked in red) in the nuclear genome sequence of the Sunchang region.
2 is a PCR result of analyzing native bellflowers in 11 regions in Korea using the Pg-nc-InDel22 primer set of the present invention.

In order to achieve the object of the present invention, the present invention provides a primer set for distinguishing native species bellflower from Sunchang region from among domestic native bellflowers comprising the oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2.

In the primer set of the present invention, the domestic bellflower may be a native bellflower from Sunchang, Pyeongchang, Geumsan, Ganghwa, Haman, Buan, Inje, Eumseong, Goseong, Suncheon and Cheongsong regions.

In the present invention, the term "native species" refers to a fixed species that has been cultivated and preserved by adapting to the environmental conditions of each region through natural selection for a long period before the start of modern breeding, and the domestic native species of the present invention is Sunchang , Pyeongchang, Geumsan, Ganghwa, Haman, Buan, Inje, Eumseong, Goseong, Suncheon, and Cheongsong may refer to the bellflower strains that have been cultivated in specific areas.

The primer of the present invention may include an oligonucleotide consisting of segments of 15 or more, 16 or more, 17 or more contiguous nucleotides in the sequence of SEQ ID NO: 1 and SEQ ID NO: 2, and the primer is SEQ ID NO: The addition, deletion or substitution of the nucleotide sequences of 1 and SEQ ID NO: 2 may also be included.

The oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2 according to the present invention is a primer set capable of amplifying a region in which a base of 24 bp is specifically deleted in the nuclear genomic sequence of a native bellflower in the Sunchang region. It is a primer set that can specifically distinguish native bellflowers from Sunchang from Pyeongchang, Geumsan, Ganghwa, Haman, Buan, Inje, Eumseong, Goseong, Suncheon and Cheongsong.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be copied, and can serve as an initiating point for the synthesis of a primer extension product. The length and sequence of the primers should allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

In the present specification, the oligonucleotide used as a primer may also comprise a nucleotide analogue, e.g., phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or It may include an intercalating agent.

The present invention also, the primer set; And it provides a kit for distinguishing the native species bellflower in the Sunchang region from among the domestic native bellflowers comprising a reagent for performing the amplification reaction.

In one embodiment of the present invention, reagents for performing the amplification reaction may include DNA polymerase, dNTPs, and buffers, but are not limited thereto.

In one embodiment of the present invention, the kit may further include a user's guide describing the optimum reaction performance conditions. The guide is a printout explaining how to use the kit, e.g., how to prepare reverse transcription and PCR buffers, and the reaction conditions presented. The guide includes a brochure in the form of a brochure or flyer, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also,

Separating genomic DNA from a domestic native bellflower sample;

Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set to amplify a target sequence; And

It provides a method for distinguishing native bellflower species from Sunchang region from among native bellflower species in Korea, comprising: detecting the product of the amplification step.

The method of the present invention includes the step of isolating genomic DNA from a domestic native bellflower sample. The sample of the domestic native bellflower is not limited thereto, but may be a root of a plant suspected to be a sample of the domestic native bellflower, or a product processed in the form of a slice thereof. The method for separating the genomic DNA may use a method known in the art, for example, the CTAB method may be used, or the Wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, an amplification reaction may be performed using the oligonucleotide primer set according to an embodiment of the present invention as a primer to amplify a target sequence. Methods of amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. amplification system), strand displacement amplification or amplification via Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling material. The labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer when amplifying the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. In addition, for labeling using a radioactive material, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution when performing PCR, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radiolabeled. The set of oligonucleotide primers used to amplify the target sequence is as described above.

In one embodiment of the present invention, the method for distinguishing the native species of bellflowers from the Sunchang region among the domestic bellflowers includes the step of detecting a product of the amplification step, and the detection of the amplification step product is DNA chip, gel electrophoresis , Capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement may be performed, but is not limited thereto. As one of the methods of detecting the amplification product, capillary electrophoresis may be performed. For capillary electrophoresis, for example, an ABi sequencer can be used. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product. In addition, when performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the fluorescence measurement method is labeled with a detectable fluorescent labeling material, and thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution when performing PCR, and then using a radioactivity measuring instrument such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. Bellflower DNA extraction

In Pyeongchang, Gangwon-do, Sunchang, Jeollabuk-do, Geumsan, Chungcheongnam-do, Ganghwa, Gyeongsangnam-do, Haman, Jeollabuk-do, Buan, Gangwon-do, Eumseong, Chungcheongbuk-do, Goseong, Daegu, Suncheon, Jeollanam-do, Cheongsong, Gyeongsangbuk-do, Collecting traditional bellflowers from 11 regions (Ginseng Specialty Department of Rural Development Administration ) And stored in a cryogenic freezer at -80°C. The young leaves of native bellflowers in each region were rapidly cooled and crushed using a mortar, and then DNA was extracted by CTAB (Cetyl Trimethyl Ammonium Bromide) method and eluted in Tris-EDTA buffer.

2. DNA amplification using polymerase chain reaction (PCR)

The DNA of the bellflower extracted using the CTAB method was diluted with 5 ng/µl to 2µl of DNA (10ng of DNA), 2µl of primer mixture (1µl of 2µM forward primer, 1µl of 2µM reverse primer), 10µl of Taq mixture, 6 µl of distilled water was mixed to make a 20 µl PCR reaction mixture. The PCR process was preheating 95°C for 5 minutes; The process of denaturation 95°C for 30 seconds, annealing 53°C for 30 seconds, and extension 72°C for 1 minute was repeated a total of 34 times; Final elongation was carried out under conditions of 72°C for 10 minutes. PCR amplification products were confirmed by electrophoresis on a 3% agarose gel.

3. InDel molecular marker based on nuclear sequence used in PCR

As a result of comparing and analyzing the nuclear genome sequence of bellflowers obtained by analyzing genomic DNA of domestic bellflower varieties, domestic bellflower varieties, or overseas bellflower bellflowers, the result of comparing and analyzing the nuclear genome sequence of bellflowers obtained by CLC Main Workbewnch program (version 8.0.1), the native bellflower core of the Sunchang region It was confirmed that the nucleotide sequence of 24 bp was specifically deleted from the genomic sequence (FIG. 1 and Table 1), and a primer set (hereinafter, Pg-nc-InDel22) capable of amplifying the region in which the InDel polymorphism appeared was prepared. (Table 2).

In addition, the analysis was performed using the NCBI BlastX tool to find out the location of the gene where InDel polymorphism appeared in the nuclear genome sequence of the native bellflower in the Sunchang region, but this sequence has not yet been identified, so the exact location of the gene is not found. Could not be confirmed.

InDel polymorphic sequence information of native bellflower in Sunchang area Native bellflower from Sunchang region (24 bp sequence deletion) (SEQ ID NO: 3) AGTTGATGAGTGGTGAGA TGATTCTAGGTAAAAGGGTTGACATTGCGATGAAAGCAAGGCATGTGAGTAGGGTAAAAGAGAAAAAATGAGGAGACTTTCCCACACTAGATTGGTGGTTCCTGTCCAAAGTGTGGCCCTGNTATAAATCT------------------------ GCTGATTCCAGCTAGATAATGAGGATCCAGAGAGTTTTTT

Bold and underlined: primer location

Dotted line: the location where the base sequence was deleted

Primer for distinguishing native bellflower varieties in Sunchang area Primer name Base sequence (5'→3') (SEQ ID NO) Pg-nc-InDel22 F AGTTGATGAGTGGTGAGA (1) Pg-nc-InDel22 R AACTGGATACGGGAAAGGA (2)

Example 1. Distinguishing native bellflower from Sunchang region using InDel molecular marker

In order to verify that the developed Pg-nc-InDel22 primer set can distinguish native bellflowers from Sunchang region among various domestic bellflowers, Sunchang, Pyeongchang, Geumsan, Ganghwa, Haman, Buan, Inje, Eumseong, Goseong, Suncheon and Cheongsong PCR was performed using local native bellflower DNA samples as a template, and two native bellflower plants collected from a total of 11 regions were used.

As a result, as disclosed in FIG. 1, a band of 244 bp size was identified in native bellflowers in the Sunchang region, and a band of 268 bp in native bellflowers in the remaining 10 regions except Sunchang was identified. It was confirmed that the native species of bellflower are accurately distinguished.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Molecular marker based on nuclear genome sequence for discriminating Platycodon grandiflorum landraces and uses thereof <130> PN20003 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 agttgatgag tggtgaga 18 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 aactggatac gggaaagga 19 <210> 3 <211> 240 <212> DNA <213> Unknown <220> <223> Platycodon grandiflorum <400> 3 agttgatgag tggtgagatg attctaggta aaagggttga cattgcgatg aaagcaaggc 60 atgtgagtag ggtaaaagag aaaaaatgag gagactttcc cacactagat tggtggttcc 120 tgtccaaagt gtggccctgn tataaatctg ctgaagctag ataatgagga tgaaggcagc 180 gtgcttttaa ttgttatttt ttancactta aattaagtga gtcctttccc gtatccagtt 240 240

Claims (6)

A primer set for distinguishing native bellflower species from Sunchang region from among domestic native bellflowers comprising the oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2. The primer set according to claim 1, wherein the domestic bellflower is a native bellflower from Sunchang, Pyeongchang, Geumsan, Ganghwa, Haman, Buan, Inje, Eumseong, Goseong, Suncheon and Cheongsong regions. The oligonucleotide primer set of claim 1 or 2; And a reagent for performing an amplification reaction. A kit for distinguishing native bellflower species from Sunchang region from among domestic bellflower species. The kit according to claim 3, wherein the reagent for performing the amplification reaction comprises DNA polymerase, dNTPs, and buffer. Separating genomic DNA from a domestic native bellflower sample;
Using the isolated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set of claim 1 or 2 to amplify a target sequence; And
Detecting the product of the amplification step; comprising, a method for distinguishing a native species bellflower in the Sunchang region from among domestic bellflowers. The method of claim 5, wherein the detection of the product of the amplification step is performed through a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement.

Images