KR101745070B1 - SNP marker for discriminating resistance to tomato spotted wilt virus and use thereof - Google Patents

Abstract

The present invention relates to a method for detecting Tomato spotted wilt virus (TSWV) resistance tomato single nucleotide polymorphism (SNP) marker and an agent capable of detecting or amplifying the SNP marker, Amplifying the SNP marker region of the polynucleotide consisting of SEQ ID NO: 1 from the composition, a tomato spotting virus resistance tomato-determining kit comprising the composition, and (a) DNA of a sample isolated from the individual; And (b) determining the base of the amplified SNP marker region of step (a).
The novel SNP markers of the present invention and the HRM analysis method using the novel SNP markers can be used as a means for evaluating tomato-spotted virus-resistant tomatoes which can not be distinguished by naked eyes, , It is possible to distinguish tomato varieties having resistance to tomato spotting virus. In addition, tomato varieties could be improved and resistance to improved varieties could be assessed.

Description

Tomato spotting virus resistance tomato determination SNP markers and their uses SNP markers for discriminating resistance to tomato spotted wilt virus and use thereof

The present invention relates to a method for detecting Tomato spotted wilt virus (TSWV) resistance tomato single nucleotide polymorphism (SNP) marker and an agent capable of detecting or amplifying the SNP marker, (A) amplifying the SNP marker region of the polynucleotide consisting of SEQ ID NO: 1 from the DNA of the sample isolated from the individual; And (b) determining the base of the amplified SNP marker region of step (a).

Tomato spotted wilt virus (TSWV) was first reported in Australia in 1919 and has a host range of 8 to 900 species. In Korea, it is reported that it occurs in house grown pepper, tomato, chrysanthemum, etc.

Tomato spotted wilt virus (TSWV), belonging to the Bunyaviridae family and Tospovirus, consists of three extra-stranded RNA genomes named according to length. The genome of Tomato spotted wilt virus (TSWV) consists of three genomes of L (8.9 kb), M (4.8 kb) and S (2.9 kb), and its characteristics are L (8.9 kb) (negative sense) and acts as an RNA-dependent RNA polymerase (RdRP). M (4.8 kb) produces the movement protein and the viral outer membrane structural proteins of G1 and G2. S (2.9 kb) produces the nucleocapsid protein (N) and the NSs protein, which is associated with the degree of viral disease in the infected plant.

Tomato spotted viruses are known to be particularly deadly to peppers and tomatoes. Once infected, round spots are formed on the leaves, and when they are heavily dry, they become poorly fruited, and even when the fruit runs, they cause stains.

Various methods have been tried to discriminate cultivars resistant to tomato spotting virus. Patent Publication No. 2012-0121639 discloses a method for determining resistance to tomato spotting virus using a nucleocapsid protein However, no method has been developed for accurately judging a variety having resistance to tomato spotting virus.

In addition, there are a total of 8 types (Sw1a, Sw1b, Sw2, Sw3, Sw4, Sw-5, Sw-6, Sw-7) reported as TSWV resistance genes to date. However, in most cases, the function of existing resistance genetic resources is lost or the application range of resistant gene sources is narrow.

Under these circumstances, the present inventors have made extensive efforts to develop a method for judging tomatoes resistant to tomato spotted wilt virus (TSWV). As a result, Sw-5b It was confirmed that tomato varieties resistant to genetically determined tomato spotted wilt virus (TSWV) can be judged by using the SNPs contained in the genes, and the present invention has been completed.

One object of the present invention is to provide a tomato spotting virus resistance tomato-determining SNP marker.

Another object of the present invention is to provide a composition for judging tomato-spotted virus-resistant tomatoes comprising an agent capable of detecting or amplifying the SNP marker.

Yet another object of the present invention is to provide a kit for judging tomato-spotted virus-resistant tomato comprising the above composition.

Yet another object of the present invention is to provide a method for determining a tomato spotted virus-resistant tomato, comprising determining a base at the SNP marker region.

In one aspect, the present invention provides a single nucleotide polymorphism (SNP) marker, which is a single nucleotide polymorphism for tomato spotting virus resistance tomato determination.

In the present invention, the Sw-5b gene is used to distinguish TSWV-resistant and susceptible varieties from commercially available varieties, and then their single nucleotide polymorphisms are compared with each other to identify Sw-5b specific markers , And HRM (High Resolution Melting) analysis was conducted to confirm that the resistant and susceptible varieties can be clearly distinguished from commercially available varieties.

The marker may preferably be all or some of the polynucleotides comprising the SNP region of the Sw-5b gene, more preferably all or some polynucleotides of the polynucleotide consisting of SEQ ID NO: 1, The first nucleotide at 1,796 position is G at the translation start position of the Sw-5b gene, which is a polynucleotide consisting of SEQ ID NO: 1, and 5 to 200, preferably 50 to 150, more preferably 90 to 90, Tomato spotted wilt virus (TSWV) resistant tomato single nucleotide polymorphism (SNP) markers comprising a polynucleotide consisting of 110, most preferably 100 contiguous bases or a complementary polynucleotide thereof Lt; / RTI >

The term "Sw-5b gene" of the present invention refers to a gene resistant to Tospovirus, and includes CC (coiled-coil) - (Nucleotide-binding-ARC) -LRR (Leucine-rich repeats) And has a total of 3,741 nucleotide sequences. The nucleotide sequence of the Sw-5b gene can be obtained from a known database such as GeneBank of NCBI. AY007366, preferably a polynucleotide of SEQ ID NO: 1.

The term "SNP marker" of the present invention means a single base polymorphism allele base pair on the DNA sequence used to identify an individual or species. Because SNPs are relatively frequent and stable and distributed throughout the genome, and because of the genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity among individuals. SNP markers generally involve phenotypic changes associated with single nucleotide polymorphisms but may or may not be. In the case of the SNP markers of the present invention, a difference in the phenotype of an individual such as a mutation in an amino acid sequence or a resistance to tomato spotting virus can be shown.

The term "polymorphism " of the present invention refers to a case where two or more alleles exist in one locus. Of the polymorphic sites, only a single base is different depending on the individual, Polymorphism. Preferred polymorphic markers have two or more alleles with a frequency of occurrence of 1% or more, more preferably 5% or 10% or more in the selected population.

The term "allele " of the present invention refers to various types of a gene existing on the same locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

According to one embodiment of the present invention, by analyzing the nucleotide sequence of the Sw-5b gene region amplified in 27 kinds of commercially available tomato spotted virus resistance and susceptibility 27 varieties, One SNP was identified to accurately distinguish the susceptible variety group, and it was confirmed that G, the 1,796th base at the translation start position of the Sw-5b gene, was changed to the base A in the susceptible variety (Fig. 2). In addition, HRM analysis confirmed that the resistant and susceptible varieties were distinct (Fig. 3). Therefore, when the genotype of the SNP marker of the present invention is amplified and HRM analysis is performed, and the genotype of the SNP marker is read, it is expected that tomato-spotted virus-resistant tomatoes can be judged. It is the first to be identified.

According to another aspect of the present invention, there is provided a composition for judging a tomato spotting virus-resistant tomato comprising an agent capable of detecting or amplifying the SNP marker.

The term "agent capable of detecting or amplifying an SNP marker" of the present invention refers to a composition capable of determining tomato-spotted virus-resistant tomatoes by amplifying the polymorphic site of such a gene, Means a primer capable of specifically amplifying a polynucleotide of the SNP marker.

The primers used for the SNP marker amplification can be amplified using appropriate conditions in suitable buffers (for example, four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) and template-directed DNA Stranded oligonucleotide which can serve as a starting point of synthesis. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the SNP marker, but should be sufficiently complementary to hybridise with the SNP marker, preferably comprising the polynucleotide sequence of SEQ ID NOS: 4 and 5, But is not limited to.

The term "primer" of the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i.e., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. At this time, the PCR conditions, the lengths of the sense and antisense primers can be modified based on those known in the art.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In another aspect of the present invention, there is provided a kit for judging tomato-spotted virus-resistant tomatoes comprising the composition. The kit may be an HRM assay kit.

The kit of the present invention can determine the tomato spotted virus-resistant tomato by amplifying and reading the genotype of the SNP marker, which is a marker for tomato spotting virus resistance, and detecting a small difference in the PCR dissociation curve. Preferably, the tomato spotting virus resistance tomato determination kit provided in the present invention may be an HRM assay kit including essential elements necessary for performing HRM analysis. The above "high resolution melting (HRM) analysis" technique is a relatively new post-PCR analysis method used to identify mutations in nucleic acid sequences, and this method is based on detecting small differences in the PCR dissociation curve do. This is made possible by the improved double-stranded DNA (dsDNA) with the dye used in conjunction with the PCR instrument. Data can be analyzed and processed using specially designed software for the HRM analysis of differences in the degree of dissociation of dsDNA with temperature. In the present invention, HRM analysis was used to select tomato-spotted virus-resistant tomatoes.

The HRM assay kit comprises a pair of primers specific for the polynucleotide comprising the SNP marker, DNA polymerase, deoxynucleotides (dNTPs), RNAase, DEPC-water, test tubes and appropriate containers . ≪ / RTI >

(A) amplifying the SNP marker region of the polynucleotide consisting of SEQ ID NO: 1 from DNA of a sample isolated from an individual; And (b) determining the base of the amplified SNP marker region of step (a). At this time, when the allele of the 1,796th base of the Sw-5b gene, which is a polynucleotide consisting of SEQ ID NO: 1, is G, the resistance against tomato spotting virus is higher than that of a normal tomato.

The term "individual" of the present invention means tomato which is a target to be tested for resistance to tomato spotting virus. By analyzing the genotype of the SNP marker using the sample obtained from the tomato, Can be determined. The specimen may be a leaf, a root, a stem, a flower, a fruit, a separated tissue, or a sample such as a separated cell, but is not particularly limited thereto.

The step of amplifying the polynucleotide from the DNA sample of step (a) may be any method known to those skilled in the art. For example, the target nucleic acid can be obtained by PCR amplification and purification thereof. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sequence amplification based on nucleic acids (NASBA) can be used as well as self-sustaining sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)).

Methods for determining the base of the amplified SNP marker region in step (b) of the above method include sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele hybridization PCR-SSCP, PCR-RFLP analysis, HRM analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (eg, Sequenom's MassARRAY system), mini-sequencing (e.g. Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium analysis ), But the present invention is not particularly limited thereto. One or more alleles in the SNP marker can be identified by the methods described above or other methods available to those skilled in the art to which the invention pertains.

The "HRM analysis" technique is as described above.

The sequencing analysis can be performed using a conventional method for nucleotide sequencing, and can be performed using an automated gene analyzer. In addition, allele-specific PCR means a PCR method in which a DNA fragment in which the mutation is located is amplified with a primer set including a primer designed with the base at the 3 'end at which the mutation site is located. The principle of the above method is that, for example, when a specific base is substituted by A to G, an opposite primer capable of amplifying a primer containing the A as a 3 'terminal base and a DNA fragment of an appropriate size is designed, When the base at the mutation position is A, the amplification reaction is normally performed and a band at a desired position is observed. When the base is substituted with G, the primer can be complementarily bound to the template DNA, And the amplification reaction is not performed properly due to the inability of complementary binding at the terminal. DASH can be performed by a conventional method, preferably by a method such as Prince et al.

The TaqMan method comprises the steps of (1) designing and preparing a primer and a TaqMan probe to amplify a desired DNA fragment; (2) labeling probes of different alleles with FAM dyes and VIC dyes (Applied Biosystems); (3) performing PCR using the DNA as a template and using the primer and the probe; (4) after completion of the PCR reaction, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; And (5) determining the genotype of the polynucleotides of step (1) from the analysis results.

On the other hand, in the PCR extension analysis, first, a DNA fragment containing a base in which a single nucleotide polymorphism is located is amplified with a pair of primers, and all the nucleotides added to the reaction are deactivated by dephosphorylation, and a specific extension primer, dNTP And then performing a primer extension reaction by adding a mixture, a digoxinucleotide, a reaction buffer and a DNA polymerase. At this time, the extension primer has the 3 'end immediately adjacent to the 5' direction of the base where the mutation site is located, and the nucleic acid having the same base as the didyoxynucleotide is excluded in the dNTP mixture, and the didyoxynucleotide has a mutation ≪ / RTI > For example, when dGTP, dCTP and TTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer is extended by the DNA polymerase in the base in which the substitution has occurred, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the kind of base showing the mutation by comparing the length of the extended primer.

At this time, as a detection method, when the extension primer or the didyxin nucleotide is fluorescently labeled, the mutation is detected by detecting fluorescence using a gene analyzer (for example, Model 3700 manufactured by ABI Co., Ltd.) used for general nucleotide sequence determination And when the unlabeled extension primer and the dideoxy nucleotide are used, the mutation can be detected by measuring the molecular weight using a MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

The novel SNP markers of the present invention and the HRM analysis method using the novel SNP markers can be used as a means for evaluating tomato-spotted virus-resistant tomatoes which can not be distinguished by naked eyes, , It is possible to distinguish tomato varieties having resistance to tomato spotting virus. In addition, tomato varieties could be improved and resistance to improved varieties could be assessed.

FIG. 1 is a schematic diagram of a Sw-5b gene known as a resistance gene of tomato spotted virus. Sw-5b has the structure of CC- (NB-ARC) -LRR. SNPs that can accurately divide resistance and susceptibility to tomato spotting virus are located in the NB-ARC domain 1,769-bp.
Fig. 2 is an amplification of the Sw-5b gene known as the tomato spotted virus resistance gene. The tomato varieties and susceptible varieties against tomato spotted virus were shown to have SNPs that can discriminate susceptibility to and resistance to tomato spotting virus among the amplified parts. The differences in amino acids translated into non-kinetic substitutions of the SNPs found were confirmed. Stevens and NY07-64 varieties were added as resistance and susceptibility alleles.
FIG. 3 shows HRM analysis of the SNP markers for HRM confirmation based on the SNPs found in the present experiment. As a result of the experiment, it was confirmed that the melting curve was separated into two pieces at 75 to 80 ° C. R is a resistive group, and S is a susceptible group.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1: Total genome in domestic commercial tomato spotted virus resistance / susceptible varieties DNA  extraction

Table 1 shows the domestic F1 market varieties used for the resistance breeding of tomato spotted viruses. A total of 27 varieties were used, ranging from 15 varieties in Nongwoo Bio, 9 varieties in Syngenta, 1 each in Chukchi, Sakata, and money maker.

Breed name source One TY Sense Q Nongwoo Bio 2 Savera 3 TY Tiny 4 Titi 5 tiara 6 Red Fang 7 Bettany 8 Prime Alexander 9 Mini maru 10 Gold mining 11 TY Alto 12 Alexander Deluxe 13 Minnie 14 13T510 15 Pink Top 16 Deer Ross Syngenta 17 Daphne 18 Madison 19 TYPE-7 PLUS 20 Mamirio 21 Dune 22 Gaya Plus 23 Lycopene-9 24 Rhapsody 25 COTTAN and TY Winner Daki 26 Oyama Sakata 27 Money maker

Tomato spots virus resistance and susceptibility The total genomic DNA (gDNA) was extracted using CTAB (cetyl trimethyl ammonium bromide) after collecting leaves from 27 varieties. In the DNA extraction method, young leaves of tomato (4 ~ 5 weeks after sowing) were sampled and pulverized, and then placed in a 2 ml tube. Then, 300 μl of CTAB buffer was added and the mixture was treated at 60 ° C. for 30 minutes. 150 의 of chloroform was added and centrifugation was carried out for 15 minutes. After centrifugation, the supernatant was taken, isopropanol was added and centrifuged to obtain a DNA pellet. After that, it was disinfected with ethanol, and then dried. Then, 100 μl of distilled water was added. The DNA thus extracted was measured using a spectrophotometer, and then diluted to a final concentration of 10 ng / μl.

Example  2: Extracted tomato gDNA in Sw -5b gene region PCR  Amplification

Using the primers (AACCACTAGGGGCAGTCCTT) of SEQ ID NO: 2 and the primer (CTCACTATGTGGCTGCTCCA) of SEQ ID NO: 3, the Sw-5b gene region was amplified by PCR in 27 domestic market tomato varieties shown in Table 1. The amplified region corresponds to 662 bp of the Sw-5b gene, which is known as the resistance gene of tomato spotted virus, and is shown in FIG.

PCR reactions in the total amount 50㎕ 25㎕ PCR smart mix (10X Taq Reaction Buffer, 25 mM MgCl 2 mixed, 5 U / ㎕ Taq DNA Polymerase, 5X Band Doctor TM), 2.5㎕ 10pmol forward primer, 10pmol 2.5㎕ reverse primer, PCR was carried out using 15 증 of distilled water and 5 g g of DNA. PCR was performed at 95 ° C for 1 minute and 40 seconds, followed by 40 cycles of 94 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute, and then 72 ° C for 5 minutes.

The nucleotide sequence information of PCR primers for carrying out this experiment is shown in Table 2. SEQ ID NOS: 2 and 3 were used to compare resistance and susceptibility (susceptibility) varieties to a set of primers for the Sweet 5b portion of tomato spotting virus resistance gene.

SEQ ID NO: designation Base sequence SEQ ID NO: 2 Forward primer AACCACTAGGGGCAGTCCTT SEQ ID NO: 3 Reverse primer CTCACTATGTGGCTGCTCCA

Example  3: amplified Sw Sequence analysis of gene region of -5b

The nucleotide sequence of the amplified Sw-5b gene region was analyzed in resistant and susceptible varieties, and FIG. 2 shows part of the gene sequence of the corresponding varieties. As shown in FIG. 2, several SNPs were found in the amplified portions of 27 commercial varieties. Among the SNPs detected, one SNP that accurately discriminates between the resistant and resistant varieties of tomato spotted viruses Respectively. In Fig. 2, underlined region, G at 1,796th nucleotide at the translation start position of the resistant Sw-5b gene is changed to base A in the susceptible varieties.

Example  4: SNP primer  Using a set HRM  ( High resolution melting ) Analysis PCR

PCR was performed using primer sets of SEQ ID NOS: 4 and 5 for HRM analysis.

Table 3 shows primer sequences capable of discriminating between resistance and susceptibility as a result of HRM analysis using SNP markers prepared based on the SNP found in Example 3.

SEQ ID NO: designation Base sequence SEQ ID NO: 4 Sw5b-SNP forward primer AAACCTGTAACTTGACTGAAAATATC SEQ ID NO: 5 Sw5b-SNP reverse primer TTATTGTTTCTCGCTTTGATGTTCG

10 μl real time PCR mix (10 μM Taq Reaction Buffer (25 mM MgCl ₂ mix), 10 mM of each dNTP Mix, 2.5 U / μl DNA polymerase, 5X Band Doctor ^™ ), 1 ^{㎕ EvaGreen TM (Solgent, Daejeon,} Korea), 0.5㎕ 10pmol forward "‡ PCR was performed with primers effort, 0.5㎕ 10pmol reverse primer, 3㎕ distilled water, 5㎕ gDNA. The PCR amplification conditions were 95 ° C for 20 seconds, 60 ° C for 15 seconds, and 72 ° C for 30 seconds. PCR and HRM analysis were performed with the CFX Connect ^™ Real-Time PCR Detection System (BIO-RAD, Hercules, USA). The dissociation rate of the fluorescent material was measured by increasing the temperature from 65 ° C to 95 ° C by 0.2 ° C for HRM fluorescence measurement. The results are shown in FIG.

In the HRM analysis, when the SNP is present in a specific nucleotide sequence, the melting curve of the nucleotide sequence undergoes a subtle change in physico-chemical properties due to the nucleotide sequence. In detecting the fluorescence, SNP When the corresponding G is present or A is present instead of G, resistance and sensitivity are distinguished by differences in the shape of the melting curve. Specifically, in the case of resistance, the dissociation rate was slower than in the case of susceptibility, and it was possible to distinguish between the two phenotypes.

Stevens and NY07-64 varieties are known to have resistance and susceptibility, respectively. Therefore, Melting curves of these varieties were confirmed. As a result of the experiment, it was confirmed that Melting curve was separated into two at 75 ~ 80 ℃. Respectively. Based on the melting curve of these representative resistant and susceptible varieties, the resistance and susceptibility of 27 varieties used in this experiment were distinguished.

FIG. 3 shows the result of HRM analysis of SNP markers for HRM confirmation based on the SNPs found in the present experiment. As a result, it was confirmed that the Melting curve was separated into two pieces at 75 to 80 ° C in the remaining products, as in Steven and NY07-64. In addition, as shown in FIG. 3, The primer sets clearly confirmed that the resistant and susceptible varieties were distinct. As a result, five varieties of TY Sense Q, TTICURA, TY TINY, SABERA and DEEROS were classified as resistant varieties and the rest were classified as susceptible varieties.

In order to test the utility of the SNP markers used in the present embodiment, the results of the SNP marker test for the resistance and susceptibility to tomato spotted viruses to 27 varieties determined by HRM analysis are shown in Table 4, Q, TITRICH, TY TINY, SAVERA, and DEEROS showed resistance to tomato spotting virus, and the remaining 22 varieties were susceptible (Table 4).

Breed name source SNP marker results One TY Sense Q Nongwoo Bio Resistance 2 Savera Resistance 3 TY Tiny Resistance 4 Titi Resistance 5 tiara sensibility 6 Red Fang sensibility 7 Bettany sensibility 8 Prime Alexander sensibility 9 Mini maru sensibility 10 Gold mining sensibility 11 TY Alto sensibility 12 Alexander Deluxe sensibility 13 Minnie sensibility 14 13T510 sensibility 15 Pink Top sensibility 16 Deer Ross Syngenta Resistance 17 Daphne sensibility 18 Madison sensibility 19 TYPE-7 PLUS sensibility 20 Mamirio sensibility 21 Dune sensibility 22 Gaya Plus sensibility 23 Lycopene-9 sensibility 24 Rhapsody sensibility 25 COTTAN and TY Winner Daki sensibility 26 Oyama Sakata sensibility 27 Money maker sensibility

<110> University-Industry Cooperation Group of Kyung Hee University <120> SNP marker for discriminating resistance to tomato spotted wilt          virus and use thereof <130> KPA150117 / KR <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 3741 <212> DNA <213> Solanum lycopersicum <220> <221> gene &Lt; 222 > (1) .. (3741) <223> Sw-5b <400> 1 atggctgaaa atgaaattga ggaaatgtta gagcacctga gaaggatcaa gagtggaggt 60 gatctggatt ggctcgacat attgcgaatt gaggaacttg aaatggtgct aagagttttt 120 agaaccttta caaagtataa tgatgttctt ttgcctgatt ccttagtcga actcacaaag 180 agggccaaat tgattgggga aatacttcac cggttgtttg gtaggattcc acataaatgt 240 aaaactaacc ttaatctaga aaggctagaa tcacatttgt tggaattctt tcaaggtaat 300 acggcaagtt taagtcacaa ttatgagttg aataattttg atctgtcgaa atatatggat 360 tgtctggaaa attttctaaa tgatgtactg atgatgttct tgcaaaagga taggttcttc 420 cattccagag aacaacttgc aaaacatcga tcaataaagg aactgaaaat tgttcaaaag 480 aaaataagat ttttgaaata catatatgcc acagagataa atggttatgt cgactatgag 540 aagcaggaat gtttggagaa tcgaattcag ttcatgacta acactgtggg acaatattgt 600 ttggcagtat tagattatgt cactgagggt aaacttaatg aagaaaatga caactttagt 660 aaacctcctt acctattatc attgattgtg ttagtggagc tggaaatgaa gaagattttt 720 catggtgaag taaaggcttc aaagtttact caatcaaaaa ctttcaagga caagaaatta 780 ccaaaaggat tttcacatca tctccacaat ctgttgatgt atctcagaaa caaaaagctc 840 gagaattttc ctaataatat cgctgctcaa aatattgatg tggcaataga gttcttgttg 900 gttttccttg atgctgatgt gtcaaatcat gttattaatg gtaactggtt gaaaaaggtc 960 ttgttaaagg ttggagctat agcgggtgat attctatatg taattcaaaa gcttcttcct 1020 agatcaataa acaaagatga aactagcaac ataagtcttt gctcaataca gatattggag 1080 aagactaaag atctgaaggc acaagttgag acgtactaca aatccttaaa atttactcca 1140 tctcagttcc ccacctttgg tggattgagc tttctgaatt ctcttttaag gaaactgaat 1200 gagatgtcga catctaagtc cggattaggt ttcctgatga aacctctttt agggaatttg 1260 gagaaagagc tatcatctct tacatccatt ttagagaagg agctctcatc cattttccgt 1320 gatgtcgtgc accatgaaca taacattcct aaagatcttc agaggcgtac catcaatttg 1380 tcatatgagg ctgaggttgc tattgattct attcttgctc agtataatgc ttttttgcat 1440 attttttgct cacttcctac aattgtaaaa gagatcaagc aaattaatgc agaggtgact 1500 gagatgtggt cagcggacat tcctcttaat cctcactatg tggctgctcc attaaaacat 1560 ctgccggatc gacatagcaa tcttgtaact gatgaggagg tagtgggttt tgagaataaa 1620 gcagaagaac taattgatta tctgattaga ggtacaaatg agctagacgt tgtcccaatt 1680 gtaggcatgg gaggacaagg gaaaacgaca attgctagaa agttgtacaa taatgacatt 1740 attgtttctc gctttgatgt tcgagcatgg tgcatcattt ctcaaacgta taatcggaga 1800 gagttattac aagatatttt cagtcaagtt acaggttccg acgacaatgg agctacggtt 1860 gatgttcttg ccgacatgtt gaggagaaaa ttaatgggaa agagatatct cattgtattg 1920 gatgatatgt gggattgtat ggtatgggat gacttaaggc tttcttttcc agatgatgga 1980 attagaagca gaatagtcgt aacaactcga cttgaagaag tgggtaagca agtcaagtac 2040 catactgatc cttattctct tccattcctc acaacagaag agagttgcca attgttgcag 2100 aaaaaagtgt ttcaaaagga agattgcccg cctgaactac aagatgtgag tcaagcagta 2160 gcagaaaaat gcaaaggact gcccctagtg gttgtcttgg tagctggaat aatcaaaaaa 2220 aggaaaatgg aagaatcttg gtggaatgag gtgaaagatg ctttatttga ctatcttgac 2280 agtgagttcg aagaatacag tctggcaact atgcagttga gttttgataa cttaccccac 2340 tgtttaaagc cttgtcttct ttatatggga atgttttcgg aggacgcaag aattccagca 2400 tctacattga taagtttatg gattgctgaa ggattcgtgg agaacactga atctgggaga 2460 ttaatggaag aggaagctga aggttacttg atggatctca ttagcagtaa cttggtaatg 2520 ctttcaaaga gaacttataa gggtagagtc aaatactgtc aggttcatga tgttgtgcat 2580 cacttttgct tggaaaagag tagagaagca aagtttatgc ttgcagtgaa gggtcaatat 2640 atccattttc aaccttcgga ttggaaggga actcgagtga gcttcagttt tagtgaagag 2700 ctttccaagt ttgcatctct ggtctccaaa acacagaagc ctttccatca acacttgagg 2760 tcattgataa cgaccaatcg agcaaaatct attaatgata ttttctcctg tcagattagt 2820 gaattgcgac ttcttaaagt cttggatttg agttcttata ttgtggagtt tttgtcgtta 2880 gctacattca aaccactaaa tcagctgaag tacctcgcag ttcaggcttt tgaattctat 2940 tttgatccag gatcacatct tccccatata gaaactttca ttgtaatgaa tcttccttat 3000 tatgatatat tgttaccagt gtctttttgg gaaatgaaaa aattaaggca tgctcatttt 3060 ggtaaggctg aatttgacaa gcaggggctc tctgaaggat cctctaaatt ggaaaatttg 3120 aggatattaa agaatattgt tggatttgat agggtggatg tgttatcaag gaggtgtcct 3180 aatcttcaac aacttcaaat cacatatttt gggaataatg aagagccttt ttgtcccaaa 3240 ttggagaatc ttacccagct tcaacaactt caactttcct ttgcgcgtcc ccgcactcta 3300 tccgggttac agttgccttc aaatttaaat aagttggtac ttgaaggaat tcatatagga 3360 tgtgttattc ccttcattgc gggactacca agcctggaat atctccagtt acatgatgtg 3420 tgttttcctc aatcagaaga gtggtgcctt ggagatatca cgttccataa acttaagttg 3480 ttgaaactgg taaagttaaa tatatcaagg tgggatgtct cagaggaatc atttccgttg 3540 cttgaaacac tcgttataaa gaagtgcatt gacctagagg agattccact tagctttgct 3600 gatattccaa cattggaaca gattaaattg attgggtcct ggaaagtatc tctggaggat 3660 tcagctgtga gaatgaagga agaaatcaaa gacactgaag gatgtgatcg tttacacctc 3720 gtcaaacaac gctcagattg a 3741 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sw5b forward primer <400> 2 aaccactagg ggcagtcctt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sw5b reward primer <400> 3 ctcactatgt ggctgctcca 20 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Sw5b-SNP forward primer <400> 4 aaacctgtaa cttgactgaa aatatc 26 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Sw5b-SNP reward primer <400> 5 ttattgtttc tcgctttgat gttcg 25

Claims (7)

delete delete Wherein the first nucleotide of the Sw-5b gene represented by SEQ ID NO: 1 is G and the polynucleotide consisting of 5 to 200 consecutive bases comprising the 1,796 base or its complementary polynucleotide, Virus (Tomato spotted wilt virus, TSWV) resistant tomato-determining SNP (single nucleotide polymorphism) marker,
Wherein the primer comprises a primer represented by the polynucleotide consisting of SEQ ID NOS: 4 and 5.
A tomato-spotted virus-resistant tomato-determining kit comprising the composition of claim 3.
5. The method of claim 4,
Wherein the kit is an HRM assay kit.
(a) amplifying the SNP marker region of the polynucleotide consisting of SEQ ID NO: 1 from the DNA of the sample separated from the individual with a primer represented by the polynucleotide consisting of SEQ ID NOS: 4 and 5; And
(b) determining the base of the amplified SNP marker region of step (a)
Wherein the polynucleotide of SEQ ID NO: 1 is judged to have higher resistance to tomato spotting virus than normal tomato when the allele of the 1,796th base is G. delete

Images