KR102604105B1 - Marker derived from complete sequencing of chloroplast genome of Bupleurum genus, primer set for discrimination of Bupleurum genus and uses thereof - Google Patents

Abstract

The present invention relates to a set of interspecies discrimination markers and primers based on complete translation of the chloroplast genome sequences of five species of plants of the genus Shiho and their use. More specifically, SNP molecular markers for identifying five types of plants of the genus Shiho, a primer set and probe set for amplifying the SNP molecular marker, a kit including the primer set and probe set, and plants of the genus Shiho using the primer set and probe set. It relates to five species identification methods and a microarray for species identification of plants of the genus Shiho.
Using the single nucleotide polymorphism marker (SNP marker) according to the present invention, it is possible to determine the origin plant and place of origin of the herbal medicine designation, and this can be used for distribution and quality control of the herbal medicine designation. In other words, through accurate identification of the plant of origin, mixing and misuse of herbal medicines can be prevented, and the quality of herbal medicine raw materials can be maintained scientifically.

Description

Marker derived from complete sequencing of chloroplast genome of Bupleurum genus, primer set for discrimination of Bupleurum genus and uses thereof}

The present invention relates to a set of interspecies discrimination markers and primers based on complete translation of the chloroplast genome sequences of five species of plants of the genus Shiho and their use. More specifically, SNP molecular markers for identifying five types of plants of the genus Shiho, a primer set and probe set for amplifying the SNP molecular marker, a kit including the primer set and probe set, and plants of the genus Shiho using the primer set and probe set. It relates to five species identification methods and a microarray for species identification of plants of the genus Shiho.

Bupleurum falcatum is a perennial plant belonging to the genus Bupleurum of the Umbrella Apiaceae, and the genus consists of about 200 species of plants. Shiho root contains saponin and fatty oil, so it is used in oriental medicine as an antipyretic, pain reliever, tonic, and medicine for respiratory, digestive, and circulatory diseases. Korean and Japanese pharmacopoeia use the root of Bupleurum falcatum as the origin plant of the herbal medicine 'Shiho'. In China, the roots of Bupleurum chinense and Bupleurum scorzonerifolium are used as the origin plants of the herbal medicine 'Shiho'. In addition, plants of the genus include Bupleurum euphorbioides and Bupleurum latissimum .

Due to the morphological similarity of the plants belonging to the genus Shiho, confusion is occurring in Korea about the plant of origin of the herbal medicine ' Shiho', and it is known that Bupleurum falcatum is not the official plant of origin, but another plant belonging to the genus. falcatum ). Accordingly, it is necessary to identify the differences between varieties by identifying the genomic characteristics of the species, and furthermore, a more efficient and objective means of distinction is needed to improve the efficiency of genetic resource management and develop new varieties.

Due to the nature of medicinal plants that are generally distributed in the form of fragments, it is very difficult to distinguish the plant of origin based on external characteristics, causing problems of counterfeit products or mixing them with other species. To solve this problem, more systematic and scientific species identification technology is required, and the most appropriate method is to use molecular markers that can identify species at the DNA level.

In the case of plant DNA barcoding using existing molecular markers, it has been developed targeting only part of the sequence of specific genes or intergenic regions, such as rbcL, matK, and trnH-GUG-pabA, which are known to have many mutations in the chloroplast genome. However, the universal barcoding primers used to amplify these regions have the problem of low PCR amplification efficiency or no amplification depending on the plant species, and even if amplification is achieved, there is no polymorphism in the base sequence. There is a problem that may not be possible. In addition, these areas of high variation have the potential to distinguish the same species into different species, as variation may be found even within the same species depending on the plant.

To date, no identification method has been reported at the DNA level targeting the origin species of Siho, which is widely used as an herbal medicine.

Accordingly, the present inventors analyzed the entire chloroplast genome sequence, not just a portion of the chloroplast genome, to search for polymorphic and more reliable variation regions among the five major species of plants in the genus Shiho, and to develop molecular markers to distinguish the species of origin. We sought to develop a practical technique for determining the species of origin of posthumous names.

The purpose of the present invention is to provide a set of interspecies discrimination markers and primers based on complete translation of the chloroplast genome sequences of five species of plants of the genus Shiho and their use.

Specifically, for the identification of five species of genus plants : Bupleurum falcatum , Bupleurum chinense , Bupleurum scorzonerifolium , Bupleurum euphorbioides , and Bupleurum latissimum . SNP molecular marker, a primer set and probe set for amplifying the SNP molecular marker, a kit including the primer set and probe set, a method for discriminating five species of the genus Shiga using the primer set and probe set, and a micro for species discrimination within the genus. This is to provide an array.

In order to solve the above problem, the present invention provides a polymorphic nucleotide consisting of the base sequences of SEQ ID NOs. 1 to 8, which shows single nucleotide polymorphism between species of Bupleurum falcatum plants. , Bupleurum chinense , Bupleurum scorzonerifolium , Bupleurum euphorbioides , and Bupleurum latissimum . .

In addition, the present invention provides a primer set represented by SEQ ID NOs: 9 and 10; Primer sets represented by SEQ ID NOs: 12 and 13; Primer sets represented by SEQ ID NOs: 15 and 16; And a primer set represented by SEQ ID NOs: 18 and 19; A primer set for distinguishing one or more species from the species of plants in the genus, including Siho, Dumesi, Chamsi, Lighthouse, and Sumshi. to provide.

In addition, the present invention provides a probe represented by SEQ ID NO: 11; A probe represented by SEQ ID NO: 14; A probe represented by SEQ ID NO: 17; and a probe represented by SEQ ID NO: 20. It provides a probe set for distinguishing one or more species from the species of plants in the genus, including the genus of the genus of the genus, including the genus of the genus, including the genus of the genus of the genus of the genus of the genus, the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus.

In addition, the present invention relates to any one of the species of plants in the genus of the genus, including the genus of the genus, including the primer set, the probe set, and the reagent for performing the amplification reaction, the genus of the genus A kit is provided to distinguish the above species.

In addition, the present invention provides a method for discriminating one or more species from the species of plants in the genus of plants, including the genus of the genus of the genus, including the genus of the genus of the genus, including the genus of the genus of the genus, including the genus of the genus of the genus of the genus of the genus of the genus, using the primer set and the probe set.

In addition, the present invention relates to polymorphic nucleotides consisting of base sequences of SEQ ID NOs: 1 to 8, at least one polymorphic nucleotide selected from polymorphic nucleotides consisting of 10 or more consecutive bases including the 151st base, which is each SNP position, or its complement. Provided is a microarray for species discrimination of one or more species of plants in the genus of plants including Siho, Dumesh, True, Lighthouse, and Insect, which contain red polymorphic nucleotides.

Using the single nucleotide polymorphism marker (SNP marker) according to the present invention, it is possible to determine the origin plant and place of origin of the herbal medicine designation, and this can be used for distribution and quality control of the herbal medicine designation. In other words, through accurate identification of the plant of origin, mixing and misuse of herbal medicines can be prevented, and the quality of herbal medicine raw materials can be maintained scientifically.

Figure 1 is a diagram showing the complete chloroplast genome of Siho. Here, colored boxes represent conserved chloroplast genes classified based on the function of the gene product. Additionally, genes located inside the circle represent genes that are transcribed in a counterclockwise direction, and genes located outside the circle represent genes that are transcribed in a clockwise direction. Meanwhile, the dotted area in the inner circle means the GC content of the chloroplast genome.
Figure 2 shows 4 samples analyzed using the FenDEL-qPCR method for five species : Bupleurum falcatum , Bupleurum chinense , Bupleurum scorzonerifolium , Bupleurum euphorbioides , and Bupleurum latissimum . This is a diagram showing the amplification curve for each molecular marker and the +, - trait judgment results. Among the amplification curves for each marker, the blue line shows the amplification result of the internal control, and the red line shows the amplification result of each marker. Here, the + and - trait judgment for each marker is determined by comparing the ΔRn value (y-axis) of the amplification curve of the internal control (blue) with the ΔRn value (y-axis) of the amplification curve of the SNP marker (red). This means that if the ΔRn value (y-axis) of the SNP marker amplification curve is greater than the ΔRn value (y-axis) of the internal control amplification curve, it is judged as '+', and if it is smaller than the ΔRn value (y-axis) of the internal control amplification curve, it is judged as '+'.
Figure 3 shows 5 species of Bupleurum falcatum , Bupleurum chinense , Bupleurum scorzonerifolium , Bupleurum euphorbioides , and Bupleurum latissimum according to an embodiment of the present invention. This is a diagram showing the sequence information of a dog's SNP marker.

The present invention relates to the chloroplast genome sequences of five species of plants belonging to the genus, namely Bupleurum falcatum , Bupleurum chinense , Bupleurum scorzonerifolium , Bupleurum euphorbioides , and Bupleurum latissimum . Completely decoded, a SNP molecular marker for interspecies discrimination based on this, a primer set and probe set for amplifying the SNP molecular marker, a kit including the primer set and probe set, and plants of the genus Shiho using the primer set and probe set. It relates to five species identification methods and a microarray for species identification of plants of the genus Shiho.

In one embodiment, the present invention relates to Bupleurum falcatum , which contains polymorphic nucleotides consisting of the base sequences of SEQ ID NOs. 1 to 8, which exhibit single nucleotide polymorphism between species of Bupleurum plants. Provided is a composition for distinguishing one or more species from species of the genus plants, including Bupleurum chinense , Bupleurum scorzonerifolium , Bupleurum euphorbioides , and Bupleurum latissimum .

The polymorphic nucleotide consisting of the base sequences of SEQ ID NOs: 1 to 8 is a polymorphic nucleotide containing a single nucleotide polymorphism (SNP) located at the 151st base in each base sequence, and the term "single nucleotide polymorphism (SNP) )" means that one base sequence consisting of A, T, C, and G in the genome has been changed to a different base sequence.

SNP polymorphism base information for polymorphic nucleotides consisting of the base sequences of SEQ ID NOs: 1 to 8 according to an embodiment of the present invention is shown in Figure 3.

Specifically, the composition includes a single nucleotide polymorphism (SNP) in which the 151st base is A in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 1; SNP where the 151st base is T in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 2; SNP where the 151st base is G in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 3; SNP where the 151st base is T in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 4; SNP where the 151st base is T in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 5; SNP where the 151st base is A in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 6; SNP where the 151st base is G in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 7; and a SNP where the 151st base is A in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 8.

In a composition for distinguishing one or more species from species of plants of the genus Shiho according to an embodiment of the present invention, a polymorphism consisting of base sequences of SEQ ID NOs: 1, 2, 5, 6, 7, and 8 including SNP polymorphisms Using nucleotides, Bupleurum falcatum can be distinguished among the five species of plants in the genus; By using polymorphic nucleotides consisting of the base sequences of SEQ ID NOs: 1, 2, 3, 4, 7, and 8, Bupleurum chinense can be distinguished among the five species of plants in the genus; By using polymorphic nucleotides consisting of the base sequences of SEQ ID NOs: 1 to 8, Bupleurum scorzonerifolium can be distinguished among the five species of plants in the genus; By using polymorphic nucleotides consisting of the base sequences of SEQ ID NOs: 3 to 8, Bupleurum euphorbioides can be distinguished among the five species of plants in the genus; By using polymorphic nucleotides consisting of the base sequences of SEQ ID NOs: 1 to 6, Bupleurum latissimum can be distinguished among the five species of plants in the genus (see Figures 2 and 3).

In another aspect, the present invention provides a primer set represented by SEQ ID NOs: 9 and 10; Primer sets represented by SEQ ID NOs: 12 and 13; Primer sets represented by SEQ ID NOs: 15 and 16; And a primer set represented by SEQ ID NOs: 18 and 19; A primer set for distinguishing one or more species from the species of plants in the genus, including Siho, Dumesi, Chamsi, Lighthouse, and Sumshi. to provide.

In the present invention, the term "distinction" refers to determining the diversity of varieties and distinguishing them using the primer set of the present invention from plant samples of five species of the genus, including Siho, Dumesiho, Chamsiho, Lighthouse, and Island Siho. It means, and can be used interchangeably with ‘discrimination’.

In the present invention, the term “primer” refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and serves as a starting point for the synthesis of a primer extension product. The length and sequence of the primers must be sufficient to initiate synthesis of the extension product, and the specific length and sequence of the primers will depend on the conditions of primer use, such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target. something to do.

In the present invention, the primer may further include a DNA intercalating material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is FAM or HEX. When amplifying a target sequence, if the 5'-end of an allele-specific primer is labeled with FAM or HEX and PCR is performed, the target sequence can be labeled with a detectable fluorescent labeling substance.

In the present invention, the term “primer set” refers to a plurality of primers. Additionally, the primer set may further include a container for accommodating the primers. A primer is a short base sequence with a free 3' hydroxyl group that can form base pairs with a complementary template and serves as a starting point for copying the template strand. . Primers can initiate DNA synthesis in the presence of four nucleoside triphosphates and reagents for polymerization at an appropriate buffer solution and temperature. The primer may be an oligonucleotide, which may contain a nucleotide analogue, such as a phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or may contain an insert material ( may include an intercalating agent). Primers can be manufactured through chemical synthesis using the phosphoramidite method, phosphodiester method, diethylphosmolamidite method, etc. Additionally, the primer base sequence may be modified by means known in the art.

In another aspect, the present invention provides a probe represented by SEQ ID NO: 11; A probe represented by SEQ ID NO: 14; A probe represented by SEQ ID NO: 17; and a probe represented by SEQ ID NO: 20. It provides a probe set for distinguishing one or more species from the species of plants in the genus, including the genus of the genus of the genus, including the genus of the genus, including the genus of the genus of the genus of the genus of the genus, the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus.

In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA that is as short as a few bases or as long as several hundreds of bases that can specifically bind to a gene or mRNA, and is called an oligonucleotide. It can be manufactured in the form of a probe, single stranded DNA probe, double stranded DNA probe, RNA probe, etc., and can be labeled for easier detection.

The probe of the present invention is an RT-PCR-based allele-specific probe that uses the FEN (Flap endonuclease) specificity of DNA polymerase. The probe is a polymorphic site in nucleic acid fragments derived from two members of the same species, so that one member Hybridizes to DNA fragments derived from , but does not hybridize to fragments derived from other members.

The primer or probe of the present invention described above can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of a native nucleotide with one or more homologues, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonate, phosphosotriester, phoramidate, carbamate, etc.) or charged linkages (e.g. phosphorothioate, phosphorodithioate, etc.).

As a primer or probe used in the present invention, a sequence that is completely complementary to the sequence containing the SNP may be used, but a substantially complementary sequence may be used to the extent that it does not interfere with specific hybridization. It may also be used. Specifically, the probe used in the present invention contains a sequence capable of hybridizing to a sequence containing at least 10, preferably 10-100 consecutive nucleotide residues, comprising the SNP of the present invention. More specifically, the 3'-end or 5'-end of the probe has a base complementary to the SNP base. In general, since the stability of the duplex formed by hybridization tends to be determined by the matching of the terminal sequences, the terminal in the probe having a base complementary to the SNP base at the 3'-end or 5'-end If the portions do not hybridize, these duplexes can disassemble under stringent conditions.

Suitable conditions for hybridization are found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B. D., et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985). Stringent conditions used for hybridization can be determined by controlling temperature, ionic strength (buffer concentration), and the presence of compounds such as organic solvents. These stringent conditions may vary depending on the sequence being hybridized.

In the present invention, the term "complementary" means sufficiently complementary that a primer or probe hybridizes selectively to a target nucleic acid sequence under predetermined annealing or hybridization conditions, and is substantially complementary and fully complementary ( It has a meaning that encompasses everything that is perfectly complementary, and specifically means being completely complementary. In this specification, the term "substantially complementary sequence" used in relation to a primer sequence refers not only to a completely identical sequence, but also to a sequence that is partially identical to the sequence being compared, to the extent that it can anneal to a specific sequence and serve as a primer. This also includes mismatched sequences.

Among the primer sets and probe sets described above, the primer set represented by SEQ ID NO: 9 and 10 and the probe set represented by SEQ ID NO: 11 have a single nucleotide polymorphism (SNP) at the 151st base of SEQ ID NO: 1 or 2 (ID: SNP#1). ) A and T, the primer set represented by SEQ ID NO: 12 and 13, and the probe set represented by SEQ ID NO: 14 are the single nucleotide polymorphism (SNP) G, which is the 151st base of SEQ ID NO: 3 or 4 (ID: SNP#2) and T, the primer set represented by SEQ ID NO: 15 and 16, and the probe set represented by SEQ ID NO: 17 are single nucleotide polymorphisms (SNPs) A and G, which are the 151st base of SEQ ID NO: 5 or 6 (ID: SNP #6) The primer set represented by SEQ ID NO: 18 and 19 and the probe set represented by SEQ ID NO: 20 distinguish between single nucleotide polymorphism (SNP) G and A, which is the 151st base of SEQ ID NO: 7 or 8 (ID: SNP#7) It is characterized by:

In yet another aspect, the present invention relates to plants of the genus Aquila, including Achyranthes, Dumesiho, Chamsiho, Lighthouse Aster, and Insamidae, including the primer set, the probe set, and a reagent for performing an amplification reaction. Provides a kit to distinguish one or more species from the species.

Reagents for performing the amplification reaction in the kit of the present invention may include DNA polymerase, dNTPs, and buffer. The dNTP mixture includes dATP, dCTP, dGTP, and dTTP, and commercially available heat-resistant polymerases such as Taq DNA polymerase and Tth DNA polymerase can be used as the heat-resistant DNA polymerase. In addition, the kit of the present invention may further include a user guide describing optimal reaction performance conditions. The guide is a printed material that explains how to use the kit, for example, how to prepare PCR buffer, and the suggested reaction conditions. Instructions include information leaflets in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.

Meanwhile, the kit according to the present invention may further include a primer set represented by SEQ ID NO: 26 and 27 and a probe represented by SEQ ID NO: 28 capable of amplifying the rbcL gene, which is an internal control.

The kit is a kit for distinguishing one or more species from the species of plants in the genus Siho, including Siho, Dumesiho, Chamsiho, Lighthouse, and Insect, and is an herbal medicine characterized in that it is amplified together with the above-mentioned internal control. It may be a kit for distinguishing the plant originating from the posthumous name and the country of origin.

The kit uses allele-specific real-time polymerization based on the principle of suppressing the flap endonuclease activity of polymerase to analyze five SNP markers (SNP#1, SNP#2, SNP#6, SNP#7). Using the enzyme chain reaction (FenDEL-qPCR) method, the plant and place of origin of the herbal medicine designation can be determined by combining the presence or absence of amplification of five SNP markers.

In another aspect, the present invention includes the steps of isolating genomic DNA from a plant sample of the genus Shiho; Using the isolated genomic DNA as a template, performing an amplification reaction using the above-described primer set and the above-described probe set to amplify polymorphic nucleotides; and detecting the product of the amplification step. It provides a method for discriminating one or more species from the species of plants in the genus of plants including the genus of the genus of the genus, including the genus of the genus, including the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus, including the genus of the genus of the genus of the genus of the genus of the genus of the genus of the genus.

In the method of the present invention, the method of isolating genomic DNA from a plant sample of the genus Shiho can be accomplished through a common method known in the art, including phenol/chloroform extraction and SDS extraction (Tai et al., Plant Mol Biol. Reporter, 8: 297-303, 1990), CTAB isolation method (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), or using a commercially available DNA extraction kit. It can be done.

The target sequence can be amplified by using the genomic DNA of the isolated Shiho genus plant sample as a template and performing an amplification reaction using one or more primer sets and probe sets according to an embodiment of the present invention. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, There are strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using polymerase. These PCR methods are well known in the art, and commercially available kits can also be used. PCR can be performed using a PCR reaction mixture containing several components known in the art required for the PCR reaction. The PCR reaction mixture contains an appropriate amount of DNA polymerase, dNTP, PCR buffer solution, and water in addition to the genomic DNA extracted from the plant sample of the genus Shiho to be analyzed and the primer set and probe set provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, etc.

In the method of the present invention, the amplified target sequence can be labeled with a detectable labeling substance. The labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. The labeling substance may be FAM or HEX. When amplifying a target sequence, if the 5'-end of the primer is labeled with FAM or HEX and PCR is performed, the target sequence can be labeled with a detectable fluorescent labeling substance. In addition, labeling using a radioactive material may cause radioactivity to be incorporated into the amplification product as the amplification product is synthesized by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution during PCR, thereby causing the amplification product to be radioactively labeled. One or more primer sets and probe sets used to amplify the target sequence are as described above.

In another aspect, the present invention relates to a polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 1 to 8, at least one selected from polymorphic nucleotides consisting of 10 or more consecutive bases including the 151st base, which is each SNP position. Provided is a microarray for species discrimination from one or more species of plants in the genus of plants, including the genus of the genus, including the genus of the genus, including the polymorphic nucleotides or complementary polymorphic nucleotides thereof.

The polymorphic nucleotide may be immobilized on a substrate coated with an active group of amino-silane, poly-L-lysine, or aldehyde, but is not limited thereto. The substrate may be, but is not limited to, a silicon wafer, glass, quartz, metal, or plastic. Methods for immobilizing the polymorphic nucleotide on a substrate include a micropipetting method using a piezoelectric method, a method using a pin-shaped spotter, etc.

The microarray according to the present invention can be prepared by conventional methods known to those skilled in the art using the polymorphic nucleotide according to the present invention or its complementary nucleotide, the polypeptide encoded by it, or its cDNA.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1: Preparation of plant material

In order to develop a marker for distinguishing the plant species and place of origin of the herbal medicine designation, 1 each of the plant materials Bupleurum falcatum , Bupleurum chinense , Bupleurum euphorbioides , and Bupleurum latissimum were provided to the Korea Oriental Medicine Promotion Agency. The base sequences of the chloroplast genomes of the four species of the genus Bupleurum were analyzed through Next Generation Sequencing (NGS).

As a verification sample for marker verification, Siho has 32 points in 3 groups, Dumeshiho has 30 points in 1 group, Lighthouse Siho has 26 points in 6 groups, Seongsiho has 30 points in 3 groups, and Chamsiho has 11 points in 3 groups. , a total of 20 groups and 113 individuals were used (see Table 1).

Table 1 below summarizes the samples used for marker development.

division type Source (group) sample
Appearance quantity ID One Reference sample posthumous Korea Oriental Medicine Promotion Agency satellite One TKMII-33-1 2 Verification sample posthumous Hantaek Botanical Garden (1~9) leaves (living body) 9 TKMII-33-1-1 3 Verification sample posthumous Gicheongsan Arboretum (10~31) leaves (living body) 22 TKMII-33-1-2 4 Verification sample posthumous Ministry of Food and Drug Safety standard product Herbal medicine (powder) One BUFA2010 5 Reference sample Lake Dumesi Korea Oriental Medicine Promotion Agency leaves (living body) One TKMII-33-1C 6 Verification sample Lake Dumesi Gicheongsan Arboretum (1~30) leaves (living body) 30 TKMII-33-1C-1 7 Reference sample lighthouse sign Korea Oriental Medicine Promotion Agency satellite One TKMII-33-2 8 Verification sample lighthouse sign Songnisan Mountain (Cheongju) Leaves (dried) One TKMII-33-2-A 9 Verification sample lighthouse sign Songnisan Mountain (Cheongju) Leaves (dried) One TKMII-33-2-B 10 Verification sample lighthouse sign Songnisan Mountain (Cheongju) Leaves (dried) One TKMII-33-2-C 11 Verification sample lighthouse sign Songnisan Mountain (Cheongju) Leaves (dried) One TKMII-33-2-D 12 Verification sample lighthouse sign Seoraksan Mountain (Daecheongbong Peak) leaves (living body) One TKMII-33-2-4 13 Verification sample lighthouse sign Seoraksan Mountain (Daecheongbong Peak) leaves (living body) One TKMII-33-2-5 14 Reference sample Seomsiho Korea Oriental Medicine Promotion Agency leaves (living body) One TKMII-33-3 15 Verification sample Seomsiho Gicheongsan Arboretum (1~20) leaves (living body) 20 TKMII-33-3-(1) 16 Verification sample Seomsiho Natural Farm (Yeoju) (21~25) leaves (living body) 5 TKMII-33-3-2 17 Verification sample Seomsiho Natural Farm (Yeoju) (26~30) leaves (living body) 5 TKMII-33-3-3 18 Verification sample Chamsiho (China) Herbal medicine (China) (Dongkwang General Products) (31~35) Herbal medicine (eggplant) 5 TKMII-33-1C-2 19 Verification sample Chamsiho (China) Herbal medicine (China) (Youngchang Pharmacy) (36~40) Herbal medicine (eggplant) 5 TKMII-33-1C-3 20 Verification sample True Tiger Ministry of Food and Drug Safety standard product Herbal medicine (powder) One BUSC2010

Example 2: Genomic DNA extraction

Genomic DNA of each sample prepared in Example 1 was extracted using NucleoSpin Plant II (MACHEREY-NAGEL GmbH & Co. KG) according to the manufacturer's instructions. The amount of extracted genomic DNA was measured using the Qubit dsDNA BR Assay Kit (Invitrogen). The total DNA concentration of the samples for next-generation sequencing (NGS) was more than 200 ng, and the samples for marker verification were prepared at a minimum of 0.5 ng/μl.

Example 3: Next Generation Sequencing (NGS)

An NGS analysis library was created for the genomic DNA of each sample obtained in Example 2 using the NEBNext Ultra™ Ⅱ DNA Library Prep Kit for Illumina (NEBNext-NGS Kit). Index adapters were used for each sample subject to NGS analysis, and the detailed library production process was performed according to the product manual. The status of each produced library was analyzed using TapStation HSD5000 (Agilent), and its suitability for NGS analysis was determined.

The Illumina platform was used to produce a large amount of genome sequence data using NGS, and the analysis lead shape and length were analyzed using the Pair-end, 151 method. A data volume of 1 Gb was generated per sample.

Example 4: Assembly and gene prediction of chloroplast genome sequence of plant specimen

The entire chloroplast genome sequence of each sample, analyzed for the genomic DNA of each sample obtained in Example 2, was completed using the 'Organelle Genome Sequence Assembly and Verification System' of Genotech Co., Ltd. (Figure 1 reference). The length of the chloroplast genome sequence of each sample for which assembly and verification was completed is 155,833 bp for Siho, 155,547 bp for Dumesi Lake, 154,871 bp for Lighthouse Lake, and 155,568 bp for Seomsi Lake (see Table 2), and gene prediction of each chloroplast genome. As a result of the analysis, it was confirmed that the order and direction of genes are very well conserved between species (see Figure 1). It was confirmed that the chloroplast genome of plants in the genus Shiho consists of 82 to 85 protein-making genes (CDS), 30 to 33 tRNA genes, and 4 rRNA genes, and has one large single copy region (LSC) in structure. , it was confirmed to have one small single copy region (SSC), and two inverted repeat regions (IR).

Table 2 below summarizes the chloroplast genome sequence assembly results for each sample.

division plant name ID total lead
(Total reads) Sorted leads
(Aligned reads) Organelle Genome %
(Organelle genome %) Cov.
(x) Genome length (bp) genome morphology One posthumous TKMII-33-1 9,516,474 216,728 2.28 210 155,833 circle 2 Lake Dumesi TKMII-33-1C 10,425,730 1,240,796 11.9 1,205 155,547 circle 3 lighthouse sign TKMII-33-2 9,377,516 579,716 6.18 565 154,871 circle 4 Seomsiho TKMII-33-3 9,191,820 189,400 2.06 184 155,568 circle

Example 5: Analysis of chloroplast genome sequence variation between species and selection of candidate gene markers

Based on the nucleotide sequence information of Dioscorea polystachya chloroplast (GenBank DB No. KM207676), the chloroplast genome sequences of four species of plants in the genus were compared 1:1 to identify single nucleotide polymorphisms (Single nucleotide polymorphisms) that can be used as species and origin distinguishing markers. Nucleotide polymorphism (SNP) and insertion-deletion (InDel) mutations were analyzed (see Table 3).

Table 3 below summarizes the chloroplast genome sequence mutations of Siho, Dumesiho, Deungdaesiho, and Seomsiho.

reference genome
(GenBank #) comparison target Genetic mutation (dog) SNP InDel total KM207676 posthumous 36 31 67 Lake Dumesi 413 181 594 lighthouse sign 508 180 688 Seomsiho 342 146 488

After integrating the base sequence of the reference genome (GenBank DB No. KM207676) and the analysis results for each comparison target, a species-specific SNP marker set (SNP Barcode marker) consisting of 9 SNPs was created using Genotech's 'SNP Barcode Generator'. That is, candidate genetic markers were selected (see Table 4).

Table 4 below summarizes the species-specific SNP marker sets of Shiho, Dumeshiho, Lighthouse Shiho, and Island Shiho.

SNP# locus
(Locus) location ^*
(Position) KM207676 posthumous Lake Dumesi lighthouse sign Seomsiho SNP1 matK 2375 A A A T A SNP2 rpoC2 19802 G T G G G SNP3 psbD 34740 A C C C C SNP4 atpB 54645 C C C A C SNP5 rpl20 70341 A A A T A SNP6 rpl20 70396 T T A T T SNP7 petB 77612 G G G G A SNP8 rps8 81907 G G G G A SNP9 ndhA 124136 C T T T T

(Position ^* : Position based on reference genome chloroplast base sequence)

Example 6: Verification of candidate genetic markers for each verification sample group and selection of final SNP markers

Using the NGS analysis method performed in Example 3, 20 groups and 113 samples (33 Siho, 31 Dumesiho, 7 Lighthouse Siho, 31 Island Siho, and 11 True Siho) were prepared for marker verification using the NGS analysis method performed in Example 3. The genotypes for 9 SNPs for each group were analyzed (see Table 5), and based on the results, 4 SNP markers were confirmed as markers that can identify the plant and place of origin of herbal medicine designations (see Table 6) .

Table 5 below summarizes the SNP marker genotyping results for each verification sample group. Additionally, the final selected SNP molecular markers and genotypes are summarized in Table 6 below.

type Collective ID SNP01 SNP02 SNP03 SNP04 SNP05 SNP06 SNP07 SNP08 SNP09 posthumous TKMII-33-1 A T C C A T G G T TKMII-33-1-1 A T C C A T G G T TKMII-33-1-2 A T C C A T G G T BUFA2010 A T C C A T G G T Lake Dumesi TKMII-33-1C A G C C A A G G T TKMII-33-1C-1 A G C C A A G G T lighthouse sign TKMII-33-2 T G C A T T G G T TKMII-33-2-A T G C A T T G G T TKMII-33-2-B T G C A T T G G T TKMII-33-2-C T G C A T T G G T TKMII-33-2-D T G C A T T G G T TKMII-33-2-4 T G C A T T G G T TKMII-33-2-5 T G C A T T G G T Seomsiho TKMII-33-3 A G C C A T A A T TKMII-33-3-(1) A G C C A T A A T TKMII-33-3-2 A G C C A T A A T TKMII-33-3-3 A G C C A T A A T True Tiger TKMII-33-1C-2 A G C A A T G G T TKMII-33-1C-3 A G C A A T G G T BUSC2010 A G C C A T G G T

division posthumous Lake Dumesi lighthouse sign Seomsiho True Tiger SNP1 A A A T A SNP2 T G G G G SNP6 T A T T T SNP7 G G G G A

Example 7: Development of a kit for determining the plant origin and origin of herbal medicine designations based on FenDEL-qPCR

To analyze the SNP marker genotype for each sample using the FenDEL_qPCR method, primer and probe sets as shown in Table 7 below were used. Primer and probe sets were produced using Genotech's oligonucleotide synthesis system.

Table 7 below summarizes the primer and probe sets for molecular marker analysis.

division marker id
(Marker ID) locus
(Locus) Primer/Probe Sequence (5'-3')
[Primer/Probe Sequence(5'-3')] order
number SNP marker
set SNP#1 matK F: ACGACCAAATCGGCCAACAtTA 9 R: TACGCAGTCAAATGCTAGAAAATG 10 P: FAM-TAGGATGCCCCAATACGTTACA-BHQ1 11 SNP#2 rpoC2 F: ATGTGAGATTAGAACGAAAAGTcTG 12 R: CGCTCGTTCTTTTTCTGTCAAG 13 P: FAM-CCGAACTAAAGAAATTGTGTCTCA-BHQ1 14 SNP#6 rpl20 F: CTGTTTCTTATATAGGTCGTGTtTT 15 R:AGAGCTTTGGTTTCGTCTCATC 16 P: Q670-CTATTTCACGAATTGCCGCGTT-BHQ3 17 SNP#7 petB F: CGATGACTTTTTACTATCGTCaG 18 R: AATCCACCGGTGAGATACACC 19 P: FAM-TCAATACATAATGACTGAAGCTAATTTT-BHQ1 20 Internal Control IC IC-F: CAAATCATTGATACAAATAATATCCAA 21 IC-R: CAAGTTTTTTCCTTGACCTTTCC 22 IC-P: TAMRA-TACGCCTTCTAGATAACCTTCG-BHQ2 23

* Forward primer: F

* Reverse Primer: R

* Probe: P

In addition, for FenDEL-qPCR reaction, reactants were prepared for each SNP marker under the conditions shown in Table 8 below, and real-time polymerase chain reaction was performed. PCR was performed using the ABI7500 Real-Time PCR System.

Table 8 below summarizes the FenDEL-qPCR analysis reactant composition and reaction conditions.

Reactant composition PCR reaction conditions division usage ·95℃ - 5 minutes
·40 cycles:
95℃ - 30 seconds
55℃* - 40 seconds SNP# (10 pmol/㎕) forward primer (F primer)
(10 pmol/㎕) Reverse primer (R primer)
(5 pmol/㎕) Probe 1㎕
1㎕
1㎕ interior
Control
(IC) (5 pmol/㎕) IC forward primer (F primer)
(5 pmol/㎕) IC reverse primer (R primer)
(5 pmol/㎕) IC Probe 1㎕
1㎕
1㎕ 2ㅧ FenDEL-qPCR Master Mix
(0.5 ng/μl) gDNA
PCR Grade water 10㎕
1㎕
3㎕ Total 20 μl

Example 8. Species discrimination using SNP marker genotype combination

In Example 7, the genotypes for each of the four SNP markers analyzed by the FenDEL-qPCR method were determined as '-' or '+' based on the ΔRn value (y-axis) of the internal control (IC) and were then determined as 'Siho Origin Plant Discrimination Table' (Refer to Table 9)' to determine the species. The + and - traits of each SNP marker are the ΔRn value (y-axis) of 'FAM' fluorescence (red amplification curve) and the ΔRn value (y-axis) of 'TAMRA' fluorescence (blue amplification curve) confirmed by FenDEL-qPCR results. was judged by comparing (see Figure 2). That is, if the ΔRn value (y-axis) of the SNP marker amplification curve was greater than the ΔRn value (y-axis) of the internal control amplification curve, it was judged as '+', and if it was smaller than the ΔRn value (y-axis) of the internal control amplification curve, it was judged as '+'.

Table 9 below summarizes the plant identification table of the origin of the posthumous name.

Specifically, according to analysis by the FenDEL-qPCR method, if SNP1, SNP6, and SNP7 among the four SNP markers (SNP1, SNP2, SNP6, and SNP7) are amplified, it is determined to be Bupleurum falcatum , and SNP1, SNP2, and SNP6 When this was amplified, it was determined to be Bupleurum chinense . In addition, when SNP1, SNP2, SNP6, and SNP7 were amplified, it was judged to be true marigold ( Bupleurum scorzonerifolium ), and when SNP2, SNP6, and SNP7 were amplified, it was judged to be lighthouse marigold ( Bupleurum euphorbioides ). The case was determined to be Bupleurum latissimum . Through this, it is possible to determine the origin plant and place of origin of the herbal medicine designation.

<110> National Institute for Korean Medicine Development <120> Marker derived from complete sequencing of chloroplast genome of Bupleurum genus, primer set for discrimination of Bupleurum genus and uses it <130> PA-20-0262 <160> 23 <170> KoPatentIn 3.0 <210> 1 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> SNP#1_matK_A <400> 1 agcacgtaca gtacttttgt gtttacgagc caaagttcta gcacaagaaa gtcgaagtat 60 atactttat cgatacaaac tccttttttg tgaggatcca ctataataat gagaaagatt 120 tctgcatata cgaccaaatc ggccaacaat atcagaatct gaaaaaatcgg cccaaacagc 180 cttactaata ggatgcccca atacgttaca aaatctcgcc ttagccaatg atccaatcag 240 aggaacaatt ggaacaatag tatcgaactt cttaatagcc ttatcaatta gaaatgcatt 300 300 <210> 2 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> SNP#1_matK_T <400> 2 agcacgtaca gtacttttgt gtttacgagc caaagttcta gcacaagaaa gtcgaagtat 60 atactttat cgatacaaac tccttttttg tgaggatcca ctataataat gagaaagatt 120 tctgcatata cgaccaaatc ggccaacaat ttcagaatct gaaaaaatcgg cccaaacagc 180 cttactaata ggatgcccca atacgttaca aaatctcgcc ttagccaatg atccaatcag 240 aggaacaatt ggaacaatag tatcgaactt cttaatagcc ttatcaatta gaaatgcatt 300 300 <210> 3 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> SNP#2_rpoC2_G <400> 3 cgatagagat acccgaaaag ggcattagtt cgttctcgca ttcttgaatt gcttggagtg 60 gaataatgaa tctttttctt cgtctctttg ctaataaatc ataattcgcg tggagaatga 120 tcggatatgt gagattagaa cgaaaagttt gattaagttc tgaataatca gggcgttttt 180 tttccttttt accataaaaa cccgaactaa agaaattgtg tctcacttta tcattagtta 240 ctgagaggtt aaaggtagat cttttcttga cagaaaaaga acgagcgttc atttgatctt 300 300 <210> 4 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> SNP#2_rpoC2_T <400> 4 cgatagagat acccgaaaag ggcattagtt cgttctcgca ttcttgaatt gcttggagtg 60 gaataatgaa tctttttctt cgtctctttg ctaataaatc ataattcgcg tggagaatga 120 tcggatatgt gagattagaa cgaaaagttt tattaagttc tgaataatca gggcgttttt 180 tttccttttt accataaaaa cccgaactaa agaaattgtg tctcacttta tcattagtta 240 ctgagaggtt aaaggtagat cttttcttga cagaaaaaga acgagcgttc atttgatctt 300 300 <210> 5 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> SNP#6_rpl20_T <400> 5 cttcgtttaa attattccgg tggattcttt acaatagact tcttttatga tctcattgga 60 aatcatataa atacaatttt tatttgatat agctaattgt gcaagtattt tacgattaag 120 aagcacctgt ttcttatata ggtcgtgtat taatctacta taactatagg atactcctat 180 ttcacgaatt gccgcgttta ttcgagtaat ccaaaacgt cgaaaatgtc tcttttgcct 240 atccctatcc cgatgagacg aaaccaaagc tcttattctc tgttgagtaa ttgttcgagt 300 300 <210> 6 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> SNP#6_rpl20_A <400> 6 cttcgtttaa attattccgg tggattcttt acaatagact tcttttatga tctcattgga 60 aatcatataa atacaatttt tatttgatat agctaattgt gcaagtattt tacgattaag 120 aagcacctgt ttcttatata ggtcgtgtat aaatctacta taactatagg atactcctat 180 ttcacgaatt gccgcgttta ttcgagtaat ccaaaacgt cgaaaatgtc tcttttgcct 240 atccctatcc cgatgagacg aaaccaaagc tcttattctc tgttgagtaa ttgttcgagt 300 300 <210> 7 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> SNP#7_petB_G <400> 7 acgtctcgag attcaggcga ttgcggatga tataactagt aaatacgttc ctcctcatgt 60 caacatattt tattgtctag gaggcattac acttacttgt tttttagtac aagtggctac 120 gggatttgcg atgacttttt actatcgtcc gaccgttacg gacgcttttg cttcggttca 180 atacataatg actgaagcta attttggttg gttaatccga tcagttcatc gatggtcggc 240 aagtatgatg gttctaatga tgatcttgca tgtatttcgg gtgtatctca ccggtggatt 300 300 <210> 8 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> SNP#7_petB_A <400> 8 acgtctcgag attcaggcga ttgcggatga tataactagt aaatacgttc ctcctcatgt 60 caacatattt tattgtctag gaggcattac acttacttgt tttttagtac aagtggctac 120 gggatttgcg atgacttttt actatcgtcc aaccgttacg gacgcttttg cttcggttca 180 atacataatg actgaagcta attttggttg gttaatccga tcagttcatc gatggtcggc 240 aagtatgatg gttctaatga tgatcttgca tgtatttcgg gtgtatctca ccggtggatt 300 300 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SNP#1 <400> 9 acgaccaaat cggccaacat ta 22 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SNP#1 <400> 10 tacgcagtca aatgctagaa aatg 24 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Probe for SNP#1 <400> 11 taggatgccc caatacgtta ca 22 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SNP#2 <400> 12 atgtgagatt agaacgaaaa gtctg 25 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SNP#2 <400> 13 cgctcgttct ttttctgtca ag 22 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Probe for SNP#2 <400> 14 ccgaactaaa gaaattgtgt ctca 24 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SNP#6 <400> 15 ctgtttctta tataggtcgt gtttt 25 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SNP#6 <400> 16 agagctttgg tttcgtctca tc 22 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Probe for SNP#6 <400> 17 ctatttcacg aattgccgcg tt 22 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SNP#7 <400> 18 cgatgacttt ttactatcgt cag 23 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SNP#7 <400> 19 aatccaccgg tgagatacac c 21 <210> 20 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Probe for SNP#7 <400> 20 tcaatacata atgactgaag ctaatttt 28 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Internal Control <400> 21 caaatcattg atacaaataa tatccaa 27 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Internal Control <400> 22 caagtttttt ccttgacctt tcc 23 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Probe for Internal Control <400> 23 tacgccttct agataacctt cg 22

Claims (9)

delete SNP (single nucleotide polymorphism) where the 151st base is A in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 1;
SNP where the 151st base is T in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 2;
SNP where the 151st base is G in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 3;
SNP where the 151st base is T in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 4;
SNP where the 151st base is T in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 5;
SNP where the 151st base is A in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 6;
SNP where the 151st base is G in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 7; and
Including a SNP where the 151st base is A in the polymorphic nucleotide consisting of the base sequence of SEQ ID NO: 8,
Distinguishing one or more species from the species of the genus plants, which includes Bupleurum falcatum, Bupleurum chinense , Bupleurum scorzonerifolium , Bupleurum euphorbioides , and Bupleurum latissimum composition for. Primer sets represented by SEQ ID NOs: 9 and 10; Primer sets represented by SEQ ID NOs: 12 and 13; Primer sets represented by SEQ ID NOs: 15 and 16; And a primer set represented by SEQ ID NOs: 18 and 19; A primer set for distinguishing one or more species from the species of plants in the genus, including Shiho, Dumeshi, Chamsi, Lighthouse, and Sumish. delete Distinguishing one or more species from the species of plants in the genus, including the genus of the genus, including the genus of the genus, including the primer set, the probe set, and the reagent for performing the amplification reaction of claim 3, As a kit to do this,
The probe is a probe represented by SEQ ID NO: 11; A probe represented by SEQ ID NO: 14; A probe represented by SEQ ID NO: 17; and a probe represented by SEQ ID NO: 20. The kit according to claim 5, wherein the reagents for performing the amplification reaction include DNA polymerase, dNTPs, and buffer. The kit according to claim 5, further comprising a primer set represented by SEQ ID NO: 21 and 22, and a probe represented by SEQ ID NO: 23. Isolating genomic DNA from a plant sample of the genus Shiho;
Using the isolated genomic DNA as a template, performing an amplification reaction using the primer set and probe set of claim 3 to amplify polymorphic nucleotides; and
Detecting the product of the amplification step,
The probe is a probe represented by SEQ ID NO: 11; A probe represented by SEQ ID NO: 14; A probe represented by SEQ ID NO: 17; And a probe represented by SEQ ID NO: 20; A method for discriminating one or more species from the species of plants in the genus, including the genus of the genus, including the genus of the genus, the double-breasted, the true-toothed, the light-striped, and the snail-shaped. delete