CN110904266B

CN110904266B - Identification of maize stalk lodging resistance QTL and development and application of molecular marker

Info

Publication number: CN110904266B
Application number: CN201911365459.0A
Authority: CN
Inventors: 王夏青; 赵久然; 宋伟; 孙轩; 张如养; 吉玉龙; 王继东
Original assignee: Beijing Academy of Agriculture and Forestry Sciences
Current assignee: Beijing Academy of Agriculture and Forestry Sciences
Priority date: 2019-12-26
Filing date: 2019-12-26
Publication date: 2022-05-31
Anticipated expiration: 2039-12-26
Also published as: CN110904266A

Abstract

The invention discloses identification of a maize stalk lodging resistance QTL and development and application of a molecular marker. The invention provides an application of a substance for detecting the genotype of an SNP locus BA _29 on a No. 3 chromosome of corn in identification or auxiliary identification of lodging resistance of corn stalks; experiments prove that the corn produced is used as a research object, an index for evaluating the lodging resistance of corn stalks is developed, QTL influencing the lodging resistance of the stalks is identified, molecular markers of the stalk lodging resistance are developed, and the molecular markers can be used for assisting in identifying the lodging resistance of the corn stalks and serve as the index for evaluating the lodging resistance of the corn stalks.

Description

Identification of corn stalk lodging resistance QTL and development and application of molecular marker

Technical Field

The invention belongs to the technical field of biology, and particularly relates to identification of a corn stalk lodging resistance QTL and development and application of a molecular marker.

Background

Lodging severely affects Corn yield and mechanized harvesting (Zuber M s. evaluation of growth in selection for batch quality. proc Annu corr Sor Res conf.1973.). Lodging is divided into stem folds and root folds, and the damage of stem folds is more serious (Robertson D J, Julianas M, Gardnonia B W, et al. Corn stage cloning: a fornic engineering of propaac provideds inventions into failure patterns and mechanics. crop Science 2015,55(6):2833 + 2841), especially stem folds occurring in the early stage of stamina can cause breaking of tassels, so that selfing or pollination can not be performed. Therefore, it is very important to improve the bending resistance of the stalks.

The corn with higher stalk hardness or stronger flexibility has stronger lodging resistance. At present, the hardness of the stem is researched more internationally, and the flexibility is researched less. The evaluation of the hardness of the stalks is usually evaluated by the puncture strength of the bark and the vertical crushing strength of the stalks (Li K, Yan J, Li J, et al. genetic architecture of rod perpendicularly measuring resistance in two main woven line orientations. BMC plant biology,2014,14(1):152.), but these two indexes cannot evaluate the flexibility of the stalks.

As regards the studies of flexibility, no gene is currently reported in maize, and the mutants identified in rice and Arabidopsis as stalk flexibility are fc1 and irx1(Li X, Yang Y, Yao J, et al. FLEXIBLE CULM 1 encoding a cellulose-alcohol dehydrogenase control in Plant molecular biology 2009,69(6): 685) 697; Journal L, Ennos A R, Turner S R. cloning and catalysis of regulated xylem4(irx4): a mineral lipid-specific mutant of Arabidopsis.the Plant Journal 2001,26(2) 205. 216. lignin content is significantly reduced due to mutations in the pathway. The phenotypes of the two mutants are extreme, and the stems are creeping on the ground and cannot be erected, so that the research results cannot be utilized in production. Therefore, the flexible stalk-breaking resistant material that can be applied to production must first ensure that the stalks are in an erect state and are able to grow normally in the natural environment, not an unfavorable mutant produced by mutagenesis.

Disclosure of Invention

An object of the present invention is to provide the use of a substance for detecting the genotype of SNP site BA _29 on chromosome 3 of maize.

The invention provides an application of a substance for detecting the genotype of an SNP locus BA _29 on a No. 3 chromosome of corn in identification or auxiliary identification of lodging resistance of corn stalks;

the SNP site BA _29 is the 30 th position of the nucleotide sequence shown in the sequence 7.

In the application, the genotype of the SNP locus BA _29 is AA, TT or TA.

The invention also provides application of the substance for detecting the genotype of the SNP locus BA _29 on the No. 3 chromosome of the corn in breeding corn with strong stalk lodging resistance or weak stalk lodging resistance;

The lodging resistance of the stems is embodied by the bending angle of the stems, and the larger the bending angle of the stems is, the stronger the lodging resistance of the stems is.

In the application, the genotype of the SNP locus BA _29 is AA, TT or TA.

In the application, the substance for detecting the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is 1) or 2):

1) a set of primers;

2) a PCR reagent or kit comprising the set of primers;

the primer set consists of a single-stranded DNA molecule or a derivative thereof shown in 22 th to 44 th sites of a sequence 4 in a sequence table, a single-stranded DNA molecule or a derivative thereof shown in 22 th to 44 th sites of a sequence 5 in the sequence table and a single-stranded DNA molecule shown in a sequence 6 in the sequence table.

In the application, the derivative of the single-stranded DNA molecule shown in the 22 nd to 44 th sites of the sequence 4 in the sequence table is that the 5' end of the single-stranded DNA molecule shown in the 22 nd to 44 th sites of the sequence 4 is connected with a fluorescent sequence, in the embodiment of the invention, the fluorescent sequence is a FAM sequence, and the derivative is the sequence 4;

the derivative of the single-stranded DNA molecule shown in the 22 nd to 44 th sites of the sequence 5 in the sequence table is formed by connecting the 5' end of the single-stranded DNA molecule shown in the 22 nd to 44 th sites of the sequence 5 with another fluorescent sequence, in the embodiment of the invention, the fluorescent sequence is a HEX sequence, and the derivative is the sequence 5.

Another object of the invention is to provide a method for identifying or assisting in identifying the lodging resistance of corn stalks, comprising the following steps: detecting that the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is AA, TT or TA, wherein the stalk lodging resistance of the corn to be detected with the genotype of the SNP site BA _29 site AA is stronger than that of the corn to be detected with the genotype of the SNP site BA _29 site TT or TA;

or the invention also provides a method for breeding corn with strong stalk lodging resistance, which comprises the steps of detecting that the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is AA, TT or TA, breeding the corn to be detected with the genotype of the SNP site BA _29 being AA, and obtaining the corn with strong stalk lodging resistance;

In the method, the method for detecting the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn as AA, TT or TA comprises the following steps A) or B):

A) direct sequencing;

B) and carrying out PCR amplification products on the corn genome DNA to be detected by using the complete set of primers, and carrying out genotyping on the PCR amplification products.

In the method, after the fluorescence scanner Pherastar scans, if the PCR product only shows the color of a fluorescent sequence in a DNA molecule shown in a sequence 4, the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn to be detected is AA; if the PCR product only shows the color of the fluorescent sequence in the DNA molecule shown in the sequence 5, the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is TT; and if the PCR product shows the color of the fluorescent sequence in the DNA molecule shown in the sequence 4 and the color of the fluorescent sequence in the DNA molecule shown in the sequence 5, the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is TA.

It is still another object of the present invention to provide a substance for identifying or assisting in identifying lodging resistance of corn stalks.

The substance provided by the invention is a substance for detecting the genotype of the SNP locus BA _29 on the No. 3 chromosome of the corn in the application.

The corn to be detected is Jing 724, Jing 724A1 or F of Jing 724 and Jing 724A1_2:3A family group.

Experiments prove that the corn produced is used as a research object, an index for evaluating the lodging resistance of the corn stalk is developed, QTL influencing the lodging resistance of the corn stalk is identified, a molecular marker SNP locus BA _29 of the lodging resistance of the corn stalk is developed, and the molecular marker can be used for assisting in identifying the lodging resistance of the corn stalk and is used as the index for evaluating the lodging resistance of the corn stalk.

Drawings

FIG. 1 is a BSA positioning map of the bending angle of the stems; the arrow in the figure indicates the located QTL site; the abscissa is the chromosome number and the ordinate is the delta SNP index.

FIG. 2 is the results of genotyping BA-26 and BA-29 in 80 maize plants.

FIG. 3 is the results of genotyping BA-29 in 45 maize.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Experimental materials in the following examples:

the maize inbred line Jing 724 stem has poor lodging resistance in the early stage of emasculation, the stem is easy to break off when meeting strong wind, and the broken position is the last stem between the first female ear and the growing nodes (Wang X, Zhang R, Shi Z, et al. Multi-omics analysis of the deterioration and the breakage resistance for the mail interconnect scientific reports,2019,9(1): 8183.); jing 724 is an inbred line autonomously bred by corn research center of agriculture and forestry academy of sciences of Beijing, and the new plant variety right is CNA 20110278.8.

The stalks of the improved series Jing 724A1 have stronger lodging resistance and are not easy to break when meeting wind; two inbred lines Jing 724 (new plant variety No. CNA20110278.8) and MC01 (new plant variety No. CNA20151547.7) which are autonomously bred by the corn research center of agriculture and forestry academy of sciences of Beijing 724A1 Beijing City are hybridized and bred for 1 time to form F by taking Jing 724 as a female parent and MC01 as a male parent₁Of the composition F₁Backcrossing with Jing 724 for 1 time, and then selfing for 4 times to obtain Jing 724A 1.

Example 1 discovery of SNP marker for detecting lodging resistance of stalks and establishment of method

313 parts of F of Jing 724 and Jing 724A1 are constructed in order to position QTL influencing the lodging resistance of stalks_2:3The specific construction process of the group is as follows: jing 724 as female parent and Jing 724A1 as male parent, hybridizing to obtain F₁Selfing to obtain 313 parts of F₂Each F₂Plant selfingPlanting one ear row (10 plants) on the later ear to obtain 313 parts of F_2:3And (4) a group.

Measurement of stalk lodging resistance

1. Method for measuring lodging resistance of stalks

The stem bending is that the bending angle of the stem caused by wind power is larger than the maximum bending angle which the stem can bear, so that the bending angle of the stem can represent the lodging resistance of the stem. The greater the angle of stalk bending, the greater the stalk lodging resistance (Murphy HC, Petri F, free KJ. Lodging resistance students in assets. I. Complex methods of testing and sources for strand length h 1.Agronom Journal,1958,50(10):609-611.Sindhu A, Langewisch T, Olek A, et al. Maize Brittle stage 2 encoding a COBRA-like protein expressed in early or variant fiber reinforced for tissue flexibility at the source plant, 2007,145(4): 1444: 1459.). Based on this, the present invention expresses stalk lodging resistance by a stalk bending angle (hereinafter also referred to as stalk bending angle).

For the detection of the stalk bending angle, the inventor uses a modified YYD-1 instrument (purchased from Topynton, Zhejiang) and a digital display goniometer (model Paola): because the original YYD-1 is used for measuring the puncture strength of the stem bark and can display the force applied to the stem, the inventor ties a rope with the length of 20cm and the fixed length on a force-sensing probe of the instrument, and the other end of the rope can be connected to the corn stem. To ensure consistency in the measurement position, the rope was attached to the first ear 60 cm above the first ear. During measurement, the first embedded female ear internodes are fixed by hands, and the modified YYD-1 instrument is pulled by keeping constant force in the horizontal direction until the stems are broken. When a pulling force is applied to the stem, the stem is deviated from the original position, and in order to record the deviation angle of the stem at the moment of fracture, the moving stem needs to be lightly held by one hand and moved along with the moving direction of the stem. The angle of the stem from the original growth direction at the instant of stem breakage was recorded as the stem bending angle (Zhang Z, Zhang X, Lin Z, et al. A large transposon insertion in the stiff1 promoter in strain in main, the Plant Cell,2019.Murphy HC, Petri F, free KJ. Lodging resistance in strains in apparatus.I. comparative method of bending and source for strain in Journal,1958,50(10):609 + 611.).

2. 313 parts of F from Jing 724 and Jing 724A1_2:3Measurement of bending angle of stem of family

By the method of 1 to F_2:3Measuring families, measuring 5 plants in each family, and taking an average value to obtain a corresponding F₂The stem bending angle table value. For the parents jing 724 and jing 724a1, 17 and 23 strains, respectively, were measured.

The stem bending angle results of parent Jing 724 and Jing 724A1 are shown in Table 1: the bending angle of the stem of Jing 724 is 48.96 degrees, the bending angle of the stem of Jing 724A1 is 63.5 degrees, which shows that the stem of Jing 724A1 has stronger lodging resistance.

TABLE 1 bending angle of stalks of Jing 724 and Jing 724A1

313 portions of F combined with Jing 724 and Jing 724A1_2:3The variation range of the stem bending angle of the pedigree is 31.8 degrees to 90.20 degrees, and the average value is 53.4 degrees (table 2). In the whole group, the stem bending angles of 75 families are smaller than that of Jing 724, the stem bending angles of 19 families are larger than that of Jing 724A1, and the stem bending angles of the other 219 families are between the two parents.

Table 2313 corn stalk bending angle list

Second, discovery of SNP marker for detecting lodging resistance of stalks

1. QTL location of stalk lodging resistance

By usingThe BSA method carries out QTL positioning. At F_2:3In the group, F corresponding to the first 30 families with extremely large and extremely small stem bending angles is respectively selected₂DNA of the individual plants A DNA pool was constructed as a high-value pool (H) and a low-value pool (L). The DNA extraction was performed by CTAB method. And performing second-generation sequencing on the DNA of the two parents and the DNA of the two mixed pools, wherein the sequencing depth of the parents is 10X, and the sequencing depth of the mixed pools is 30X. The sequencing results were aligned to maize reference genome B73-RefGen _ v4, obtaining the location and annotation information for the variation (Wang K, Li M, Hakonson H. ANNOVAR: functional annotation of genetic variants from high-through high-throughput sequencing data. nucleic acids research,2010,38(16): e164-e 164.). The BSA analysis procedure is described in Takagi et al,2013 (Takagi H, Abe A, Yoshida K, et al. QTL-seq: rapid mapping of qualitative track logic in rice by book genome sequencing of DNA from two-wheeled distributed applications, the Plant Journal,2013,74(1): 174-183.).

As a result: 30 parts of high-value mixing tank material subjected to BSA analysis has a stalk bending angle of 60.13-69.6 degrees and 30 parts of low-value mixing tank material has a stalk bending angle of 37.9-46.8 degrees. Based on the delta (SNP-index) method, 4 QTL sites were identified in the genome-wide range, all located on chromosome 3, 14.00-14.70Mb,16.40-16.50Mb,18.40-19.28Mb, and 131.12-131.59Mb (FIG. 1). These 4 intervals contain 37 genes in total.

2. Candidate gene identification method

And (3) identifying the SNP variation type of each gene in the QTL interval, and preferentially selecting the gene which can cause the change of the amino acid information. Secondly, genes with significant differences among parents are screened as candidate genes according to the expression level among the parental internodes.

As a result: among 37 genes, 36 SNPs (nonsynonymous mutation SNPs, early termination SNPs) that cause amino acid changes were identified and distributed among 12 genes. Further, the expression amounts of the 12 genes in the parent stalks are analyzed, and only 7 genes are expressed in the parent stalks, and the expression amounts of 3 genes in the parent stalks are obviously different, however, the expression amounts of 2 genes in the parents are very weak, so that the candidate gene is established as Zm00001d 039769.

3. Development of SNP molecular markers

And selecting SNP (Single nucleotide polymorphism) which can cause amino acid change between parents aiming at the candidate gene in the identified stalk bending angle QTL, and naming the SNP as an SNP locus BA _26 and an SNP locus BA _ 29.

The SNP site BA _29 is the 30 th site of the sequence 7 in the sequence table, the physical position of the SNP site in the genome is the maize genome Chr3:14338239, and the genotype of the site is AA, TT or TA (Table 3).

The SNP site BA _26 is the 28 th site of a sequence 8 in a sequence table, the physical position of the SNP site in a genome is corn genome Chr3:14337719, and the genotype of the site is GG, AA or GA (Table 3);

TABLE 3 SNP information of designed primers

4. Primer of KASP mark and establishment of KASP method

1) KASP-labeled primer

Based on 100bp flanking sequences before and after the SNP site BA _26 and the SNP site BA _29, KASP marker primers of the two SNP sites are designed, and comprise FAM, HEX and Common primers, and the primer sequences are shown in Table 4.

Table 4 shows the KASP primer sequences

In the above-mentioned table, the following,

lower case letters at the 5' end of Primer _ allefam are FAM sequences (gaaggtgaccaagttcatgct, blue);

the lower case letters at the 5' end of Primer _ allehex are HEX sequences (gaaggtcggagtcaacggatt, red).

The primers were synthesized by LGC.

2) Establishment of KASP method

(1) DNA extraction

The genome DNA of the corn to be detected is extracted by adopting a conventional CTAB method, and the concentration is diluted to 10 ng/ul.

(2) KASP amplification

And using the genome DNA of the sample to be detected as a template, and performing KASP amplification by using a KASP amplification system containing the SNP site BA _26 or the SNP site BA _29 respectively.

The KASP amplification system was 1ul (using 1536 microwell plates) and consisted of 30ng of oven-dried DNA, 0.5 ul of KASP2xMasterMix (LGC, model KBS-1016-011), 0.486 ul of deionized or ultra-pure water, and 0.014 ul of primer working solution.

The primer working solution consists of FAM primer, HEX primer and Common primer labeled by each KASP, and the concentrations of the FAM primer and the HEX primer are both 12 mu M/L and the concentration of the Common primer is 30 mu M/L.

The KASP amplification procedure was as follows: preheating at 95 ℃ for 15 min; 94 ℃ for 20s, 61-55 ℃ for 1min (0.6 ℃ per cycle), 10 cycles; at 94 ℃ for 20s, at 55 ℃ for 1min, 32 cycles, and end.

Fluorescence scanning: and scanning the PCR which finishes the PCR program by using a fluorescence scanner Pheastar instrument, and reading and outputting a typing result by using Kraken software.

Judging the genotype of the SNP site BA _26 according to the amplification product of the SNP site BA _26, and if the PCR product only shows the color (FAM fluorescence, blue) of the 5' end fluorescence sequence in the DNA molecule shown in the sequence 1, the genotype of the SNP site BA _26 of the corn to be detected is GG; if the PCR product only shows the color (HEX fluorescence, red) of the 5' end fluorescence sequence in the DNA molecule shown in the sequence 2, the genotype of the SNP BA _26 site of the corn to be detected is AA; and if the PCR product shows the color of the 5 'end fluorescent sequence in the DNA molecule shown in the sequence 1 and the color (green) of the 5' end fluorescent sequence in the DNA molecule shown in the sequence 2, the genotype of the SNP BA _26 site of the corn to be detected is GA.

Judging the genotype of the SNP site BA _29 according to the amplification product of the SNP site BA _29, judging the genotype of the BA _29, and if the PCR product only shows the color (FAM fluorescence, blue) of the 5' end fluorescence sequence in the DNA molecule shown in the sequence 4, judging the genotype of the SNP site BA _29 of the corn to be detected to be AA; if the PCR product only shows the color (HEX fluorescence, red) of the 5' end fluorescence sequence in the DNA molecule shown in the sequence 5, the genotype of the SNP BA _29 locus of the corn to be detected is TT; and if the PCR product shows the color of the 5 'end fluorescent sequence in the DNA molecule shown in the sequence 4 and the color (green) of the 5' end fluorescent sequence in the DNA molecule shown in the sequence 5, the genotype of the SNP BA _29 site of the corn to be detected is TA.

Third, detecting the relation between the SNP mark of the stalk lodging resistance and the stalk bending angle phenotype

F consisting of 80 Beijing 724A1 pairs of KASP primers of BA _26 and KASP primers of BA _29_2:3The DNA of the population is detected, and the detection method and the primers are shown in the second step 4. Blank control is no DNA added.

As shown in FIG. 2, it can be seen that the KASP primer of BA 29 has better typing effect, can effectively distinguish between homozygous and heterozygous, and has higher amplification efficiency; the BA-26 has poor typing effect, and only one homozygous type and one heterozygous type can be identified; this result indicates that the amplification efficiency of BA26 was not high enough.

F consisting of 80 Jing 724A1_2:3The genotypes of the SNP locus BA _26 and the SNP locus BA _29 of the population are integrated with the corresponding stalk bending degrees detected in the first step, and the result lists are shown in tables 5 and 6:

TABLE 5 typing results of BA-29 in 80 parts of maize material

As can be seen from Table 5, BA 29 successfully amplified all 80 samples and differentiated both homozygous and heterozygous. The average value of the stem break angles of the AA genotype in the marker is 60.08 degrees, the average value of the stem break angles of the TT genotype is 49.87 degrees, the average value of the stem break angles of the TA genotype is 55.30 degrees, and the stem break angles corresponding to the AA genotype are larger than those corresponding to the TT and the TA, so that the stalk lodging resistance of the corn to be detected with the SNP locus BA _29 genotype of AA is higher than that of the corn to be detected with the SNP locus BA _29 genotype of TT or TA.

TABLE 6 typing results of BA-26 in 80 parts of corn material

As can be seen from table 6, BA _26 was only successful in detecting genotypes of 67 materials, no genotypes were detected for 13 materials, and only homozygous GG and heterozygous AG were detected, no homozygous AA material was detected. Homozygous GG corresponds to a mean stem break angle of 58.24 ° and heterozygous AG corresponds to a mean stem break angle of 50.36 °.

After 80 genotypes of the materials are corresponding to the stalk bending phenotype, the single-factor anova analysis shows that 2 pairs of marker-divided phenotypes have extremely significant differences (P <0.01), but BA _29 (Table 7) shows that the genotype and the phenotype are better correlated from the significance level.

TABLE 7 significance of KASP markers associated with phenotypes

Combining the amplification efficiency of the markers and the results of genotyping and phenotypic significance, it is believed that BA _29 is a KASP marker that is good for stalk bending angle typing.

Therefore, the corn stalk lodging resistance can be identified or assisted to be identified by detecting the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn, and the stalk lodging resistance of the corn to be detected with the genotype of the SNP site BA _29 site being AA is stronger than that of the corn to be detected with the genotype of the SNP site BA _29 being TT or TA.

The genotype detection of the SNP locus BA _29 on the maize chromosome 3 can be carried out by the following method:

1) directly sequencing the genotype of the locus;

2) carrying out PCR amplification products on corn genome DNA to be detected by using a set of primers, and carrying out genotyping on the PCR amplification products;

The genotyping method comprises the steps of scanning by a fluorescence scanner Pheastar, and if a PCR product only displays the color of a 5' end connecting fluorescence sequence in a DNA molecule shown by a sequence 4, determining the genotype of the SNP locus BA _29 on the No. 3 chromosome of the corn to be detected as AA; if the PCR product only shows the color of the 5' end connecting fluorescence sequence in the DNA molecule shown in the sequence 5, the genotype of the SNP locus BA _29 on the No. 3 chromosome of the corn is TT; and if the PCR product shows the color of the 5 'end connecting fluorescent sequence in the DNA molecule shown in the sequence 4 and the color of the 5' end connecting fluorescent sequence in the DNA molecule shown in the sequence 5, the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is TA.

Example 2 application of KASP marker primer of SNP site BA _29

Stalk bending detection

F consisting of 45 Jing 724 and Jing 724A1 was detected by the detection method in the first embodiment 1 of the invention_2:3Population, results are shown in table 8 below. Jing 724 and Jing 724A1 were used as controls.

Second, detection of KASP marker primer of SNP site BA _29

F derived from Jing 724 and Jing 724A1 was detected by method 4 of example 1_2:3The genotypes of the SNP sites BA _29 of 45 maize lines in the population, the results are shown in Table 8 below and FIG. 3.

TABLE 8 genotype and stalk break angle of BA-29 in 45 maize

Will be derived from F_2:3The list of mean stalk break angles for each genotype of 45 maize lines in the population is shown in table 9.

TABLE 9 significance between BA-29 genotype and phenotype

As can be seen from the above, the stalk lodging resistance (stalk folding angle) of the corn to be detected with the SNP locus BA _29 genotype of AA is greater than that of the corn to be detected with the SNP locus BA _29 genotype of TT or TA.

As can be seen, the detection result of the SNP locus BA _29 genotype is consistent with the detection result of the stalk bending degree. Indicating the correctness of the method of the invention.

SEQUENCE LISTING

<110> agriculture and forestry academy of sciences of Beijing City

<120> identification of maize stalk lodging resistance QTL and development and application of molecular marker

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 47

<212> DNA

<213> Artificial sequence

<400> 1

gaaggtgacc aagttcatgc tggttattat gttggaagtt cttccag 47

<210> 2

<211> 49

<212> DNA

<213> Artificial sequence

<400> 2

gaaggtcgga gtcaacggat tctggttatt atgttggaag ttcttccaa 49

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence

<400> 3

gagttgcatt tggctgcaca gagtt 25

<210> 4

<211> 44

<212> DNA

<213> Artificial sequence

<400> 4

gaaggtgacc aagttcatgc tccaaccaca ggatagtaag ccct 44

<210> 5

<211> 44

<212> DNA

<213> Artificial sequence

<400> 5

gaaggtcgga gtcaacggat tccaaccaca ggatagtaag ccca 44

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<400> 6

caggtatgac tagcagggtc ccaa 24

<210> 7

<211> 52

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (30)..(30)

<223> n is a or t

<400> 7

caggtatgac tagcagggtc ccaacagggn gggcttacta tcctgtggtt gg 52

<210> 8

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (28)..(28)

<223> n is a, or g

<400> 8

ctggttatta tgttggaagt tcttccanca ctcagccatc taactctgtg cagccaaatg 60

caactc 66

Claims

1. The application of the substance for detecting the genotype of the SNP locus BA _29 on the No. 3 chromosome of the corn in identifying or assisting in identifying the lodging resistance of the corn stalks,

the SNP locus BA _29 is the 30 th position of a nucleotide sequence shown in a sequence 7;

the substance for detecting the genotype of the SNP locus BA _29 on the No. 3 chromosome of the corn is 1) or 2):

1) a set of primers;

2) a PCR reagent or kit comprising the set of primers;

the primer set consists of a single-stranded DNA molecule shown in 22 th to 44 th sites of a sequence 4 in a sequence table, a single-stranded DNA molecule shown in 22 th to 44 th sites of a sequence 5 in the sequence table and a single-stranded DNA molecule shown in a sequence 6 in the sequence table;

the 5' end of the single-stranded DNA molecule shown in the 22 nd-44 th site of the sequence 4 in the sequence table is connected with FAM fluorescent group,

the 5' end of the single-stranded DNA molecule shown in the 22 th-44 th site of the sequence 5 in the sequence table is connected with a HEX fluorescent group;

the genotype of the SNP locus BA _29 is AA, TT or TA;

the stalk lodging resistance of the corn to be detected with the genotype of the SNP locus BA _29 locus as AA is stronger than that of the corn to be detected with the genotype of the SNP locus BA _29 locus as TT or TA;

the lodging resistance of the stalks is reflected by the bending angle of the stalks;

the corn is a filial generation of a corn inbred line Jing 724 and a corn improved line Jing 724A 1.

2. The application of the substance for detecting the genotype of the SNP locus BA _29 on the No. 3 chromosome of the corn in the breeding of the corn with strong stalk lodging resistance,

1) a set of primers;

2) a PCR reagent or kit comprising the set of primers;

the 5' end of the single-stranded DNA molecule shown in the 22 nd to 44 th sites of the sequence 4 in the sequence table is connected with FAM fluorescent group,

the SNP site BA _29 is the 30 th position of the nucleotide sequence shown in the sequence 7;

the genotype of the SNP locus BA _29 is AA, TT or TA;

breeding the corn to be tested with the genotype of the SNP locus BA _29 being AA to obtain the corn with strong stalk lodging resistance;

3. A method for identifying or assisting in identifying lodging resistance of corn stalks comprises the following steps: detecting whether the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is AA, TT or TA, wherein the stalk lodging resistance of the corn to be detected with the genotype of the SNP site BA _29 site AA is stronger than that of the corn to be detected with the genotype of the SNP site BA _29 site TT or TA;

the lodging resistance of the stalks is embodied by the bending angle of the stalks;

4. The method of claim 3, wherein:

the method for detecting whether the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is AA, TT or TA comprises the following steps A) or B):

A) direct sequencing;

B) performing PCR amplification on corn genome DNA to be detected by using the primer set as claimed in claim 1, and genotyping the PCR amplification product.

5. The method of claim 4, wherein:

after the fluorescent scanner scans, if the PCR product only shows the color of a fluorescent group connected with the 5' end of the DNA molecule shown in the 22 nd-44 th site of the sequence 4, the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn to be detected is AA; if the PCR product only shows the color of a fluorescent group connected with the 5' end of the DNA molecule shown in the 22 nd to 44 th sites of the sequence 5, the genotype of the SNP locus BA _29 on the No. 3 chromosome of the corn is TT; and if the PCR product shows the color of a fluorescent group connected with the 5 'end of the DNA molecule shown in the 22 nd to 44 th sites of the sequence 4 and the color of a fluorescent group connected with the 5' end of the DNA molecule shown in the 22 nd to 44 th sites of the sequence 5, the genotype of the SNP site BA _29 on the No. 3 chromosome of the corn is TA.