CN111118191B

CN111118191B - KASP molecular marker of wheat head top spikelet fructicity main effect QTL and application thereof

Info

Publication number: CN111118191B
Application number: CN201910938675.3A
Authority: CN
Inventors: 郭杰; 施卫萍; 程顺和; 岳琳祺; 郭佳晖
Original assignee: Shanxi Agricultural University
Current assignee: Shanxi Agricultural University
Priority date: 2019-09-30
Filing date: 2019-09-30
Publication date: 2022-04-22
Anticipated expiration: 2039-09-30
Also published as: CN111118191A

Abstract

The scheme relates to a KASP molecular marker of a wheat ear top spikelet fructicity main effect QTL and application thereof. The invention is obtained by developing the main effect QTL close linkage marker of the wheat head small ear seed setting number, the designed KASP molecular marker has large and stable genetic effect and close linkage with the target QTL, has important practical significance for improving the wheat head small ear seed setting performance, provides excellent gene resources and selection tools for wheat yield character molecular breeding, and greatly improves the selection efficiency.

Description

KASP molecular marker of wheat head top spikelet fructicity main effect QTL and application thereof

Technical Field

The invention belongs to the technical field of molecular genetic breeding, and particularly relates to a KASP molecular marker of a wheat ear top spikelet fructicity main effect QTL and application thereof.

Background

The genetic improvement of wheat in China has been in the history of one hundred years, the variety is changed for 4-6 times, and the yield of wheat is qualitatively leap compared with the initial stage of building the country. However, with the increasing population and the decreasing area of cultivated land in recent years, this goal must be achieved by increasing the yield per unit in order to meet the increasing demand of people. At present, the yield factors of wheat varieties reach a good coordination level, and the grain number per spike is improved to have the greatest synergistic effect on the grain number per unit area. Therefore, the research on the constitutive factors of the grain number of the wheat spike, the discovery of new genes related to the grain number and excellent allelic variation, and the effective application of the novel genes to molecular marker-assisted selective breeding have important significance for improving the wheat breeding level, accelerating the breeding process and improving the yield.

The formation of the number of spikelets and fructification grains at the top of the wheat relates to a series of physiological processes such as differentiation, development, fructification and degeneration of spikelets and florets. In wheat, according to earlier survey on bred varieties, the average values of the top three spikelets of different varieties from top to bottom to the number of the fructification grains are respectively 1.39, 1.54 and 1.78, while the average value of the middle part of the spike can reach 3.75, and in production practice, if other yield factors are not changed, the yield of the wheat per hectare can be improved by about 180 kg when the number of the top spikelets of the spike is increased by 1 grain. Therefore, properly increasing the number of the fructification grains of the small ears at the top of the ears and further increasing the number of the ears is one of the ways of realizing high yield and high yield of the wheat.

At present, the genetic research on the fructification of the top of the ear in main food crops progresses slowly, which indicates that the fructification mechanism of the top of the ear is complex and the research difficulty is high to a certain extent. In the aspect of the fructification of the top of the rice ear, Heng et al (2018) utilize a rice mutant paab1-1 with a degenerated tip floret, and find that the degeneracy is controlled by the occurrence of base mutation of the OsALMT7 gene located on the 2 nd chromosome. In addition, QTL sites that control tassel apical substantivity have been mapped to

chromosomes

3, 4, 8 and 9, respectively. Among them, Cheng et al (2011) finely mapped the gene qpAA8 associated with the apical substantivity of ears on the 68kb segment of chromosome 8. Akter et al (2014) pinpoints a recessive gene paa-h that controls head tip degeneration on chromosome 4 at the 71kb segment. Bai et al (2015) reported a gene TUTOU1 which causes rice panicle top degeneration after mutation and which encodes an inhibitor of cAMP-like receptor protein and plays an important role in actin assembly and panicle development.

KASP (competitive Allele-Specific PCR) is based on the Specific matching of the primer end bases to type SNPs (single nucleotide polymorphisms) and to detect InDels (Insertions and Deletions). The technology can accurately judge SNPs or InDels widely existing in genome DNA, and is an SNP typing technology with high throughput, low cost and low error rate.

Therefore, the major QTL of the fructification of the spikelet top spikelet is explored, and the KASP molecular marker closely linked with the major QTL is developed for screening wheat varieties with excellent fructification of the spikelet top spikelet, and has important value for high-yield auxiliary selective breeding of wheat.

Disclosure of Invention

In order to solve the problems in the prior art, the invention develops and provides a KASP molecular marker of the major QTL of the wheat head spikelet substantivity on the basis of discovering a marker closely linked with the major QTL of the wheat head spikelet substantivity, and the KASP molecular marker can be applied to wheat variety breeding and can be used for identifying or assisting in identifying the spikelet substantivity of the wheat head spikelet, so that excellent gene resources and selection tools are provided for molecular breeding of wheat yield traits, and the selection efficiency is improved.

In order to achieve the purpose, the technical scheme of the invention is as follows:

a KASP molecular marker of wheat ear top spikelet fructicity main effect QTL is used for specifically amplifying a target fragment containing a target SNP site, and at least comprises an upstream primer group and a downstream primer;

wherein the upstream primer group comprises a first upstream primer and a second upstream primer, and the ends of the first upstream primer and the second upstream primer are respectively set to different allelic variation bases based on the target SNP locus.

Preferably, the KASP molecular marker, wherein at least one of the first forward primer and the second forward primer has the same sequence as the target fragment.

Preferably, the KASP molecular marker further comprises a tag sequence for capturing a fluorescent probe in each of the first forward primer and the second forward primer.

Preferably, the KASP molecular marker, wherein the downstream primer has at least a sequence reverse complementary to the target fragment.

Preferably, the KASP molecular marker, wherein the downstream primer is configured to control the length of the amplification product to be 60-120 bp.

Preferably, the KASP molecular marker, wherein the sequence of the first forward primer is 5'-GAAGGTGACCAAGTTCATGCTGGTTGATCAAACGCGCCATACTTCA-3', and the sequence of the second forward primer is 5'-GAAGGTCGGAGTCAACGGATTGGTTGATCAAACGCGCCATACTTCG-3'; the sequence of the downstream primer is 5'-ATGTTGGTTAATTTGTCATGTTGAC-3'.

An application of KASP molecular marker of wheat ear top spikelet fructicity main effect QTL in wheat variety breeding.

The breeding method specifically comprises the following steps:

extracting whole genome DNA of a known wheat variety or strain, taking the DNA as a template, performing PCR amplification by adopting the KASP molecular marker, scanning an obtained amplification product with a fluorescence signal, distinguishing different genotypes according to the fluorescence signal, and obtaining the good and bad conditions of the wheat ear top spikelet compactness corresponding to the different genotypes according to the phenotype of the known wheat variety or strain;

extracting the whole genome DNA of the wheat variety or strain to be detected, using the DNA as a template, adopting the KASP molecular marker to perform PCR amplification, scanning the obtained amplification product with a fluorescent signal, and selecting the genotype with excellent wheat head spikelet fructification according to the fluorescent signal.

The invention has the beneficial effects that: the invention relates to a KASP molecular marker of a wheat ear top spikelet fructicity main effect QTL and application thereof. The KASP molecular marker disclosed by the invention can be used for detecting a plurality of samples in a high-throughput manner, so that the detection efficiency is greatly improved, the time and labor cost are reduced, the large-scale molecular marker in the field is very favorable for assisting in screening the fructification of the wheat breeding material at the top of the spike, and the breeding efficiency is improved.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a diagram showing the result of genome-wide association analysis between the trait of number of spikelets fructifying at the top of wheat ears and SNP markers (P)<3.06×10^-4) (ii) a Wherein, a: GNAS 1; b: GNAS 2; c: GNAS 3; d: GNAS.

FIG. 2 is a diagram of the positioning result of the major QTL QGNAS-5A of the number of the spikelets and fructifying grains at the top of the wheat head on the chromosome.

FIG. 3 is a diagram of the detection result of KASP molecular marker in wheat variety breeding.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In addition, the technical features involved in the different embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

All the primers were synthesized by Shanghai Yingjun Biotechnology GmbH.

The wheat varieties are provided by Yangzhou center of the national wheat improvement center, and the public can obtain the wheat varieties from Yangzhou center of the national wheat improvement center.

Example 1:

[ digging significant association sites for controlling the fructification of spikelets at the tops of the spikes through genome-wide association analysis ]:

test materials: the natural population used for association analysis consisted of 220 wheat varieties, of which 213 were from china and 7 were from foreign countries. Of 7 parts of material from abroad, italian 3 parts, us 1 part, mexico 1 part, chile 1 part, japan 1 part; among 213 parts of materials from china, 65 parts of jiangsu, 25 parts of henna, 19 parts of shandong, 18 parts of shanxi, 16 parts of sichuan, 13 parts of anhui, 10 parts of hunan, 6 parts of hunbei, 7 parts of beijing, 7 parts of henbei, 4 parts of gansu, 3 parts of zhejiang, 3 parts of fujian, 3 parts of shanxi, 2 parts of black dragon river, 1 part of hengxi, 1 part of guizhou and 1 part of Yunnan, and 9 parts of unknown material sources are available.

And (3) field test: the natural population to be tested is respectively planted in two environments of Hubei Jingzhou and Jiangsu Yangzhou in 2013-2014 and 2014-2015, and is planted in Henan New county in 2015-2016. In the field test, three repetitions are set according to a random block design, wherein each repetition comprises 3 rows of planted materials, 50 grains per row, 2 meters of planted materials, and 0.25 meter of planted materials. And (3) surveying the basic seedling number of the target row in the seedling stage, thinning the target row with more seedlings, and controlling the basic seedling number to be about 40 plants. In the mature period of the wheat, 30 ears are selected from the middle 1 m of the middle row of each material for character investigation.

And (3) phenotype identification: the measured traits comprise the grain number per spike (KNPS), the fructification of the top of the spike investigates the sum (GNAS1) of the first spikelet fructification grain number at the top of the spike, the second spikelet fructification grain number at the top of the spike (GNAS2), the third spikelet fructification grain number at the top of the spike (GNAS3) and the three spikelet fructification grain numbers at the top of the spike from top to bottom in sequence.

Whole genome association analysis: the iSelect Wheat 90K SNP marker is detected by an Illumina SNP Genotyping technology test platform and a microbead chip technology by a plant science system biotechnology test center of Davis university of California, USA. Data correction and reading were performed using Genomestudio v2011.1 software. Genetic mapping information for SNP markers is referenced to Cavanagh et al (2013). Using Structure V2.3.2 software to evaluate the genetic Structure of natural population, and determining the number of the sub-population by using a delta K model; based on a Q + K model, the total genome association analysis is carried out on the spike number and the SNP markers by using the TASSEL 5.0 software, and the threshold value P of the association signal is set to be 1/the number of the SNP markers without considering the SNP sites with the frequency lower than 0.05(1/20037＝4.99×10^-5) I.e. P < 4.99X 10^-5，-LogP＞4.30。

The trait of the number of the spikelets fructifying grains at the top of the spike and the SNP marker whole genome are analyzed and discovered, and 33 significant association sites (P) are detected<3.06×10^-4). The SNP marker Excalibur _ c7729_144 is significantly associated in two or more environments, and the phenotype interpretation rate is between 10.16 and 18.18 percent, which indicates that the site can be stably inherited and has a large phenotype contribution. More importantly, Excalibur _ c7729_144 was significantly associated with four spikelet fruiting traits simultaneously (GNAS1, GNAS2, GNAS3 and GNAS), further indicating that the site is significantly associated with the spikelet fruiting grain number trait at the top of the spike, and the results are shown in FIG. 1.

Example 2:

[ main effect QTL for positioning and controlling the number of small-ear fructification grains at the top of the ear ]:

test materials: yangmai No. 17 and Ningmai No. 9 are both main varieties of winter wheat in the middle and lower reaches of Yangtze river in China, the Yangmai No. 17 is excellent in comprehensive agronomic characters, but the fructification at the top of the spike is poor, and one of the main characteristics of Ningmai No. 9 is that the fructification at the top of the spike is good. The invention takes Yangmai 17 as a female parent and takes Ningmai No. 9 as a male parent to construct F_2：7The generation RIL group contains 190 families.

And (3) field test: the test genetic group comprising 190 families and the parents thereof are respectively identified with the phenotypic characters in three areas of Yangzhou, Nanjing and Yingsu of Jiangsu in 2017-2019. In the field test, three repetitions are set according to a random block design, wherein each repetition comprises 3 rows of planted materials, 50 grains per row, 2 meters of planted materials, and 0.25 meter of planted materials. And (3) surveying the basic seedling number of the target row in the seedling stage, thinning the target row with more seedlings, and controlling the basic seedling number to be about 40 plants. In the mature period of the wheat, 30 ears are selected from the middle 1 m of the middle row of each material for character investigation.

QTL localization and discovery of linked markers: an iSelect Wheat 90K SNP chip is used for scanning an RIL group of Yangmai No. 17/Nigmai No. 9, and genome studio V2011.1 is used for reading and manually correcting SNP typing data to screen out a marker with polymorphism between parents. By applying QTL IiMapping V4.1, redundant markers are removed through a Binning function, and meanwhile, the marker deletion rate (less than 20%) and the singular separation deletion ratio (0.35) are set so as to realize the further screening of the markers. Linkage mapping was performed using Mst Map software using Kosambi function, QTL mapping using ICIM, and alignment detection to set LOD threshold (3.0). The mapping results are shown in FIG. 2, a major QTL controlling the number of fruiting grains at the top of ear is present on the long arm of chromosome 5A, which is named as QGNAS-5A, and the left and right markers are Excalibur _ c7729_144 and BS00075959_51 respectively, and the locus explains that the phenotypic variation reaches 13.78-17.13%, and the synergistic allele is from Ningmai No. 9, and the results are shown in Table 1. After a large amount of sequence analysis, alignment and preliminary experiments, the flanking sequences of the SNP marker Excalibur _ c7729_144 are found to have specificity on the 5A chromosome, so that the SNP marker is converted into a KASP marker for molecular marker-assisted selective breeding.

TABLE 1 genetic Effect of wheat head spikelet fructification major QTL QGNAS-5A

Example 3:

[ development of KASP molecular markers for wheat head top spikelet fructicity major QTL ]:

according to the SNP mutation information characteristics, a specific set of KASP primers is designed, and the set of KASP primers consists of a first upstream primer, a second upstream primer and a downstream primer. The 3' end of the upstream primer group is allelic variant base A/G, and the sequence of the downstream primer is selected to ensure that the length of the amplification product is 60-120 bp. The sequence of the first upstream primer is 5'-GAAGGTGACCAAGTTCATGCTGGTTGATCAAACGCGCCATACTTCA-3', and the sequence of the second upstream primer is 5'-GAAGGTCGGAGTCAACGGATTGGTTGATCAAACGCGCCATACTTCG-3'; the sequence of the downstream primer is 5'-ATGTTGGTTAATTTGTCATGTTGAC-3'. Wherein, the 5 'end of the first upstream primer is connected with FAM fluorescent tag sequence' GAAGGTGACCAAGTTCATGCT ', and the 5' end of the second upstream primer is connected with HEX fluorescent tag sequence 'GAAGGTCGGAGTCAACGGATT'.

All primers were synthesized by Shanghai Yingjun Biotechnology Co., Ltd.

Example 4:

[ application of KASP molecular marker in wheat variety breeding ]:

test material and genomic DNA extraction: f constructed by Yangmai 17 and Ning0569 (the difference of the number of the small spike fructification grains at the top of the double-parent spike is obvious, and the number of the small spike fructification grains at the top of the Ning0569 spike is high) and the preparation combination thereof₂The population was the test group, and was 192 in total. Taking leaf tissues of wheat to be detected, and extracting whole genome DNA by adopting a CTAB method.

Preparing a KASP molecular marker primer working solution: mu.l (100. mu.M) of each of the forward primer and the reverse primer was taken and supplemented with sterile ultrapure water to 100. mu.l, and used as a KASP molecular marker primer working solution.

PCR amplification reaction System: the DNA template contained in the sample was 2. mu.l (20-30 ng/. mu.l), the primer working solution was 0.08. mu.l, and KASP 2 × Master Mix 2.5. mu.l (LGC Co., catalog number: KBS-1016-017), and the sample was supplemented with sterile ultrapure water to 5. mu.l. The KASP 2 xMaster Mix consists of a fluorescent probe A, a fluorescent probe B, a quenching probe A, a quenching probe B, high-fidelity Taq enzyme, dNTP and the like.

Reaction procedure: first, pre-denaturation at 94 ℃ for 15 min; second step 94 deg.C denaturation for 20s, 61-55 deg.C (0.6 deg.C per cycle) for 60s, 10 cycles; thirdly, denaturation at 94 ℃ for 20s, renaturation at 55 ℃ for 60s, and 28 cycles; storing at 10 deg.C.

In the experiment, sterile ultrapure water without template DNA added in the reaction system is set as blank control, and 1 or more blank controls are set for each PCR plate.

Detection of KASP molecular marker: the detection result is shown in figure 3, the sterile ultrapure water is used as a blank control, and the typing result is gathered at the lower left corner of the fluorescence signal coordinate system and is displayed in black; the typing results of the parent Yangmai 17 and the other 37 offspring are aggregated and displayed to be blue, and the genotype is AA; the results of typing of the parent Ning 0569 and another 149 offspring were aggregated and shown to be red, and the genotype was GG; the genotype of the sample showing green color in the middle was AG, and there were 4. Specifically, the results of detecting the genotypes of 192 test groups by using the KASP molecular markers are shown in table 2, and the results of measuring the number of spikelet fructification grains at the top of spikes of 192 test groups are also shown in table 2. The PROC TTEST model in the international general SAS 9.2 statistical software is adopted to carry out F test on the number of spikelet fructification grains at the top of 192 parts of different genotype materials, and the results are shown in Table 2 and show that: the average improvement of the number of spikelets and fructification grains at the top of the wheat ear is 3.46-3.64% compared with that of the progeny with the genotype of GG and AA, and the significant difference exists on the level that p is less than 0.01, which indicates that the KASP molecular marker can be used for molecular-assisted selective breeding aiming at improving the top fructification of the wheat ear.

The KASP molecular marker of the wheat ear top spikelet fructification main effect QTL and the application thereof are obtained by developing the wheat ear top spikelet fructification main effect QTL close linkage marker.

TABLE 2 statistical descriptive analysis of the number of spikelets bearing at the top of the test group

Note: (X) increase in number of seed grains_GG-total average number of particles)/total average number of particles

Wherein the total average number of particles is ═ X [ (. sup._AA*N_AA)+(X_AG*N_AG)+(X_GG*N_GG)]/(N_AA+N_AG+N_GG)

Full length of the amplification sequence with primers:

GGTTGATCAAACGCGCCATACTTC[A/G]GCTTCTTCAGTAACTGTCTCAAATGGTCAACATGACAAATTAACCAACAT

while embodiments of the invention have been described above, it is not limited to the applications set forth in the description and the embodiments, which are fully applicable in various fields of endeavor to which the invention pertains, and further modifications may readily be made by those skilled in the art, it being understood that the invention is not limited to the details shown and described herein without departing from the general concept defined by the appended claims and their equivalents.

Sequence listing

<110> Shanxi university of agriculture

<120> KASP molecular marker of wheat ear top spikelet fructicity main effect QTL and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

GAAGGTGACCAAGTTCATGCTGGTTGATCAAACGCGCCATACTTCA 46

<210> 2

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

GAAGGTCGGAGTCAACGGATTGGTTGATCAAACGCGCCATACTTCG 46

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ATGTTGGTTAATTTGTCATGTTGAC 25

<210> 4

<211> 80

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

GGTTGATCAAACGCGCCATACTTC[A/G]GCTTCTTCAGTAACTGTCTCAAATGGTCAACATGACAAATTAACCAACAT 80

Claims

1. The application of the KASP molecular marker of the wheat ear top spikelet fructicity main effect QTL in wheat variety breeding is characterized in that the KASP molecular marker comprises a first upstream primer, a second upstream primer and a downstream primer, the sequence of the first upstream primer is 5'-GAAGGTGACCAAGTTCATGCTGGTTGATCAAACGCGCCATACTTCA-3', and the sequence of the second upstream primer is 5'-GAAGGTCGGAGTCAACGGATTGGTTGATCAAACGCGCCATACTTCG-3'; the sequence of the downstream primer is 5'-ATGTTGGTTAATTTGTCATGTTGAC-3'; the number of the fructification grains of the small ears at the top of the wheat ear with the genotype of GG is higher than that of the wheat with the genotype of AA.