KR102461815B1 - TaqMan molecular marker for identifying HMW-GS and use thereof - Google Patents

Abstract

The present invention relates to a TaqMan molecular label for composition analysis of wheat high-molecular-weight glutenin subunits (HMW-GS) and uses thereof.
The TaqMan molecular marker according to the present invention can derive the qualitative composition of HMW-GS by rapidly and precisely analyzing the high-molecular-weight glutenin subunits (HMW-GS) locus. Efficiency can be improved.

Description

TaqMan molecular marker for analyzing the composition of wheat polymer glutenin and its use {TaqMan molecular marker for identifying HMW-GS and use thereof}

The present invention relates to a TaqMan molecular label for composition analysis of wheat high-molecular-weight glutenin subunits (HMW-GS) and uses thereof.

Wheat is a hexaploid (2n=6x=42, AABBDD) crop with an annual production of about 700 million tons worldwide, and provides nutrients to humans through various processed products including bread and noodles. The processing performance of wheat is determined by the quantity and quality of gluten composed of disulfide bonds and non-covalent hydrogen bonds between glutenin and gliadin, the seed storage proteins. Glutenin is classified into high molecular weight glutenin (high-molecular-weight glutenin subunits, HMW-GS) and low-molecular-weight glutenin subunits (LMW-GS) according to protein molecular weight. and determine the strength.

The H MW-GS locus is located on the long arm of chromosome 1, A, B, and D, and is divided into an x-type gene with a large molecular weight and a y-type gene with a low molecular weight. In most varieties, the y-type gene of the Glu-A1 locus is inactivated and no protein is synthesized.

In the initial report of Payne's group, three alleles were reported for the Glu-A1 locus, 11 alleles for the Glu-B1 locus, and 7 alleles for the Glu-D1 locus. With the recent development of protein identification technology and genome information analysis technology, 22, 52, and 36 alleles have been reported at the Glu-A1, Glu-B1, and Glu-D1 loci, respectively, in the Grain Genes 2.2 Database. However, the frequency of the specific Glu-1 allele was high in most of the world's cultivated varieties. In the Glu-A1 locus, the Glu-A1b allele was the highest at 55%, and in the Glu-B1 locus, Glu-B1b, Glu-B1c and Glu -B1i allele frequency was high, and Glu-D1a and Glu-D1d allele frequencies were high at the Glu-D1 locus (Yasmeen et al., Genetic divergence for high-molecular weight glutenin subunits (HMW-GS) in indigenous) landraces and commercial cultivars of bread wheat of Pakistan., Genet Mol Res 14: 4829-4839., 2015). In addition, most varieties with gluten properties suitable for bread had Glu-A1a or Glu-A1b alleles and Glu-D1d alleles at the Glu-A1 and Glu-D1 loci, respectively, and Glu-B1i and Glu-B1i at the Glu-B1 locus, respectively. The cultivar with the Glu-B1al allele had excellent baking aptitude.

Although the SDS-PAGE analysis method has been used until recently to analyze the composition of HMW-GS, the method using DNA molecular labeling is widely used due to the long analysis time and limitations in mass assays. Recently, molecular markers using KASP (Kompetitive allele-specific PCR), which can easily and quickly perform genotyping without electrophoresis using fluorescent substances, have been developed, and mass genotyping is being performed in breeding programs (Tan et al., Development and validation of KASP markers for the greenbug resistance gene Gb7 and the Hessian fly resistance gene H32 in wheat., Theor Appl Genet 130: 1867-1884., 2017; Kang et al., Development and validation of KASP markers for Stv-bi , a rice stripe virus resistance gene in rice ( Oryza sativa L.)., Plant Breed Biotech 8: 196-201., 2020). The highly reliable and inexpensive rhAMP method has been proposed as a method for introducing target traits and analyzing genomic background in wheat, and has been used in domestic also for Pinb-D1 genotyping related to wheat seed hardness.

However, the previously developed KASP molecular marker has a problem in that the reproducibility of the experiment is poor, so additional development is required. As described above, various molecular markers such as STS, SNP, and KASP have been developed for HMW-GS composition analysis, but the use of molecular markers of HMW-GS for developing bread varieties in domestic wheat breeding programs is insufficient.

Under this background, the present inventors performed SDS-PAGE (Sodium dodecyl sulfate polyacrylamide gel electrophoresis), lab-on-a-chip electrophoresis, STS (sequence-tagged site) marker, and KASP to obtain 14 mills. By re-evaluating the known HMW-GS of the variety, the present invention was completed by discovering the Taqman molecular marker marker for HMW-GS composition analysis for the development of bread varieties in domestic wheat breeding programs.

An object of the present invention is to provide a primer set for analyzing the composition of wheat high-molecular-weight glutenin subunits (HMW-GS).

Another object of the present invention is to (a) amplify the genomic DNA using the genomic DNA extracted from wheat to analyze the polymer glutenin as a template, and using the primer set; And (b) determining the composition of the polymer glutenin by comparing the amplified product with the amplified product of the wheat standard variety; it provides a method for analyzing the composition of wheat polymer glutenin, including.

Another object of the present invention is to provide a kit for analyzing the composition of wheat polymer glutenin, including the primer set, DNA polymerase, dNTPs and a buffer solution.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the present invention. In addition, it cannot be considered that the scope of the present invention is limited by the specific descriptions described below.

In addition, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Also, such equivalents are intended to be encompassed by the present invention.

One aspect of the present invention provides a primer set for analyzing the composition of wheat high-molecular-weight glutenin subunits (HMW-GS).

The primer set includes a Glu-1Ax1 primer set consisting of oligonucleotides of SEQ ID NOs: 1 to 4; Glu-1Ax2 ^* primer set consisting of oligonucleotides of SEQ ID NOs: 5 to 8; Glu-1Ax Null primer set consisting of oligonucleotides of SEQ ID NOs: 9 to 12; Glu-1Dx5-1 primer set consisting of oligonucleotides of SEQ ID NOs: 13 to 16; Glu-1Dx5-2 primer set consisting of the oligonucleotides of SEQ ID NOs: 17 to 20; And Glu-1Dy10 primer set consisting of the oligonucleotides of SEQ ID NOs: 21 to 24; may include one or more primer sets selected from the group consisting of.

As used herein, the term "high-molecular-weight glutenin subunits (HMW-GS)" is a kind of glutenin constituting the seed storage protein gluten of wheat ( Triticum aestivum L.), and glutenin is the protein weight It is divided into high molecular weight glutenin subunits (HMW-GSs, 70 to 140 kDa) and low molecular weight glutenin subunits (LMW-GSs, 30 to 50 kDa) according to the HMW-GS accounts for about 10% of the total seed storage protein and determines the elasticity and strength of the dough.

The x- and y-type subunits of HMW-GS genetically encode each Glu-1 locus located on the long arm of chromosome 1 in the A, B, and D genomes of bread wheat, with natural alleles for each subunit of the Glu-1 locus. Genetic diversity has been reported. New allelic forms of the Glu-1 locus continue to be discovered in various terrestrial species with the development of analytical instruments. To date, 22 alleles have been identified for Glu-A1, 52 for Glu-B1 and 36 alleles for Glu-D1.

Glu-A1b, encoding 1Ax2 ^* in Glu-A1, is associated with higher dough strength and better baking quality. Glu-A1a, encoding 1Ax1 in Glu-A1, showed a higher gluten index and longer dough formation time than Glu-A1b. Glu-D1 to Glu-D1d (encoding subunit pair 1Dx5 + 1Dy10) positively affects rheological properties and dough quality. However, there remains a need to study the effects of rare alleles that are not yet used in current breeding varieties.

Accordingly, the present invention was performed on 14 wheat varieties by performing SDS-PAGE (Sodium dodecyl sulfate polyacrylamide gel electrophoresis), lab-on-a-chip electrophoresis, STS (sequence-tagged site) marker, and KASP. By re-evaluating the known HMW-GS, it is significant in discovering for the first time a Taqman-based molecular marker marker for HMW-GS composition analysis for the development of bread varieties in a domestic wheat breeding program.

As used herein, the term “primer” refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow synthesis of the extension product to begin, and the specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use such as temperature and ionic strength. something to do. As a specific example, the specific length and sequence of the primer should be determined in consideration of various conditions such as guanine and cytosine contents (GC contents), GC arrangement, annealing temperature, and ionic strength.

The oligonucleotide used as a primer in the present invention may include a nucleotide analogue, as a specific example, phosphorothioate, alkyl phosphorothioate, or peptide nucleic acid, or intercalating agent) and the like.

One or more primer sets selected from the group consisting of the Glu-1Ax1 primer set, the Glu-1Ax2 ^* primer set and the Glu-1Ax Null primer set of the present invention may detect Glu-A1. Specifically, the Glu-1Ax1 primer set is the Glu-1Ax1 allele, the Glu-1Ax2 ^* primer set is the Glu-1Ax2 ^* allele, The Glu-1Ax Null primer set is a Glu-1Ax Null-specific molecular marker, and may detect Glu1-Ax1, Glu1-Ax2 ^* and Glu1-Ax Null, respectively.

One or more primer sets selected from the group consisting of the Glu-1Dx5-1 primer set, the Glu-1Dx5-2 primer set and the Glu-1Dy10 primer set of the present invention may detect Glu-D1. Specifically, the Glu-1Dx5-1 primer set and the Glu-1Dx5-2 primer set are Glu1-Dx5 alleles, and the Glu-1Dy10 primer set is a Glu1-Dy10 allele-specific molecular marker, respectively, Glu1-Dx5 and detecting Glu1-Dy10.

The primer of the present invention may be a TaqMan primer developed by TaqMan analysis, that is, a TaqMan molecular marker marker.

As used herein, the term "TaqMan" refers to an analysis method based on 5' nuclease chemistry that can detect a specific PCR product accumulated in the PCR process using a fluorescent probe, and the analysis method is an allele can be distinguished.

The primer set for HMW-GS composition analysis of the present invention may be used for DNA amplification, and specifically, it may be used for amplification of TaqMan molecular marker markers for HMW-GS composition analysis. The primer set includes a Glu-1Ax1 primer set consisting of oligonucleotides of SEQ ID NOs: 1 to 4; Glu-1Ax2 ^* primer set consisting of oligonucleotides of SEQ ID NOs: 5 to 8; Glu-1Ax Null primer set consisting of oligonucleotides of SEQ ID NOs: 9 to 12; Glu-1Dx5-1 primer set consisting of oligonucleotides of SEQ ID NOs: 13 to 16; Glu-1Dx5-2 primer set consisting of the oligonucleotides of SEQ ID NOs: 17 to 20; And Glu-1Dy10 primer set consisting of the oligonucleotides of SEQ ID NOs: 21 to 24; may be used as one or more primer sets selected from the group consisting of. In addition, if one or more primer sets are used in combination, HMW-GS composition can be analyzed more accurately.

Wheat to be subjected to the HMW-GS composition analysis may be included without limitation as long as it is a wheat variety known in the art, for example, petrel (petrel), Brimstone (Brimstone), regular 5336 (Junggye5336), Chugoku 122 (Chukoku122), Jopoom, Joongmo2008, Jokyung, Cajeme, Kenya-5, Joongmo2012, Norin 61, Soogwang ( Sukwang), Yeonbaek (Younbaek), and may be any one or more selected from the group consisting of BI1102.

In one embodiment of the present invention, the TaqMan molecular marker marker was verified by analyzing the HMW-GS composition of domestic and foreign wheat varieties (Example 3). As a result, it was confirmed that genotyping could be performed using the TaqMan molecular marker ( FIGS. 4 to 8 ).

Another aspect of the present invention comprises the steps of: (a) using genomic DNA extracted from wheat to analyze the polymer glutenin as a template, and amplifying the genomic DNA using the primer set; And (b) determining the composition of the polymer glutenin by comparing the amplified product with the amplified product of the wheat standard variety; it provides a method for analyzing the composition of wheat polymer glutenin, including.

The terms used herein are the same as described above.

The method of extracting genomic DNA of domestic wheat in step (a) may be performed by a conventional method known in the art. For example, a CRAB method, a phenol/chloroform extraction method, an SDS extraction method, etc. may be used, or a commercially available DNA extraction kit may be used, but is not limited thereto.

In step (a), the primer set refers to one or more primer sets selected from the group consisting of the oligonucleotides of SEQ ID NOs: 1 to 24 described above. The primer set for HMW-GS composition analysis may be used in one set or more, two sets or more, three sets or more, four sets or more, five sets or more, or all six sets. composition can be analyzed.

The primer of the present invention may be a TaqMan primer developed by TaqMan analysis, that is, a TaqMan molecular marker marker.

복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법을 제한없이 사용할 수 있다. 이 중에서, PCR이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 세트로부터 표적 핵산을 증폭하는 방법이며, 이러한 PCR 방법은 당업계에 잘 알려져 있고, 상업적으로 이용 가능한 키트를 사용할 수도 있다. 상기 PCR 반응 혼합액은 국내 밀 품종에서 추출된 게놈 DNA와 본 발명에 따른 프라이머 세트, 적당량의 DNA 중합효소, dNTP, PCR 완충용액 및/또는 물을 포함할 수 있으며, 이에 제한되지 않는다. 또한 상기 PCR 완충용액은 Tris-HCl, MgCl₂, KCl 등을 포함할 수 있으나, 이에 제한되는 것은 아니다.In addition, the amplification of genomic DNA in step (a) is a polymerase chain reaction (PCR), a ligase chain reaction, a nucleic acid sequence-based amplification, and a transcription-based amplification system (transcription). -based amplification system), strand displacement amplification or Q

Amplification via replicas or any other suitable method for amplifying nucleic acid molecules known in the art can be used without limitation. Among them, PCR is a method of amplifying a target nucleic acid from a primer set that specifically binds to the target nucleic acid using a polymerase, and such a PCR method is well known in the art, and a commercially available kit may be used. The PCR reaction mixture may include genomic DNA extracted from domestic wheat varieties, a primer set according to the present invention, an appropriate amount of DNA polymerase, dNTP, a PCR buffer and/or water, but is not limited thereto. In addition, the PCR buffer may include Tris-HCl, MgCl ₂ , KCl, and the like, but is not limited thereto.

Step (b) may include analyzing the amplification product. Preferably, the analysis of the amplified product may be performed by a DNA chip, electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement method, but is not limited thereto. As one of the methods for detecting the amplification product, lab-on-a-chip electrophoresis may be performed. In addition, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used for gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the primer with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactive measurement method includes adding a radioisotope such as ³² P or ³⁵ S to the PCR reaction solution during PCR to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter or liquid scintillation. The radioactivity can be measured using a liquid scintillation counter. In addition, it can be visualized using a silver staining kit (Bioneer, Daejeon, Korea).

In step (b), the composition of the polymer glutenin may be determined by comparing the amplified product with the amplified product of a standard wheat variety.

Wheat to be subjected to the HMW-GS composition analysis may be included without limitation as long as it is a wheat variety known in the art, for example, petrel (petrel), Brimstone (Brimstone), regular 5336 (Junggye5336), Chugoku 122 (Chukoku122), Jopoom, Joongmo2008, Jokyung, Cajeme, Kenya-5, Joongmo2012, Norin 61, Soogwang ( Sukwang), Yeonbaek (Younbaek), and may be any one or more selected from the group consisting of BI1102.

Another aspect of the present invention provides a kit for analyzing the composition of wheat polymer glutenin, comprising the primer set, DNA polymerase, dNTPs and a buffer solution.

The terms used herein are the same as described above.

In the kit, the primer set may be one or more primer sets from the group consisting of any one or more primer sets selected from the group consisting of the oligonucleotides of SEQ ID NOs: 1 to 24 described above.

In addition, a buffer solution may be required for the PCR reaction, which has a composition commonly known in the art, and may include, for example, Tris-HCl, MgCl ₂ , KCl, and the like.

The kit for analyzing the composition of wheat HMW-GS according to the present invention may further include components necessary for electrophoresis to determine whether or not the PCR product is amplified.

Another aspect of the present invention provides a method for selecting wheat varieties suitable for baking, using the primer set.

The TaqMan molecular marker according to the present invention can derive the qualitative composition of HMW-GS by rapidly and precisely analyzing the high-molecular-weight glutenin subunits (HMW-GS) locus. Efficiency can be improved.

1 is a composition analysis result of high-molecular-weight glutenin subunits (HMW-GS) of a standard variety. (A) HMW-GS was analyzed by SDS-PAGE using 3-8% Criterion XT Tris-acetate protein gel. 10 ml of each protein extracted from one seed was loaded into the gel. Photos were taken after coomassie brilliant blue dyeing and bleaching. (B) HMW-GS analysis result by lab-on-a-chip electrophoresis. The HMW-GS composition was analyzed according to the relative molecular weight.
2 is a molecular marker evaluation result for genotype analysis of the Glu-A1 locus. (A) Evaluation results of the molecular marker UMN19 for Glu1-Ax2 ^* . (B and C) Scatter plots for Glu-Ax1/2 ^* _SNP and Glu-Ax2 ^* _IND analyzes show cultivar clusters on the X- (FAM) and Y- (HEX) axes. (B) Red indicates Glu1-Ax1 and Glu1-Ax2 ^* alleles and blue indicates Glu1-Ax Null alleles of each strain. (C) Red indicates Glu1-Ax2 ^* alleles and blue indicates Glu1-Ax1 and Glu1-Ax Null alleles of each cultivar. All experiments were independently repeated three times.
3 is a molecular marker evaluation result for genotyping of the Glu-D1 locus. (AC) Molecular markers, UMN25 (A), Dx5-1 (B) and UMN26 (C) were investigated after agarose gel electrophoresis. (D) Scatter plot for Glu-D1d_SNP. Red indicates the Glu1-Dx5 allele and blue indicates the Glu1-nonDx5 allele of each cultivar. All experiments were independently repeated three times.
4 shows the results of primer assay and genotyping analysis of TaqMan molecularly labeled Glu-1Ax1.
5 is a result of primer assay and genotyping analysis of TaqMan molecular label Glu-1Ax2 ^* .
6 shows the results of primer assay and genotyping analysis of TaqMan molecularly labeled Glu-1Ax Null.
7 shows the results of primer assay and genotyping analysis of TaqMan molecularly labeled Glu-1Dx5-1.
8 shows the results of primer assay and genotyping analysis of TaqMan molecularly labeled Glu-1Dx5-2.
9 shows the results of primer assay and genotyping analysis of TaqMan molecularly labeled Glu-1Dy10.

Hereinafter, the present invention will be described in more detail through Examples and Experimental Examples. However, these Examples and Experimental Examples are for illustrative purposes of the present invention, and the scope of the present invention is not limited to these Examples and Experimental Examples.

Example 1. Glutenin composition assay of standard variety for the development of TaqMan molecular label

A total of 14 domestic and foreign cultivars with known compositions of high-molecular-weight glutenin subunits (HMW-GS) (Petrel, Brimstone, Junggi5336 (Junggye5336), Chugoku122 ( Chukoku122), Jopoom, Joongmo2008, Jokyung, Cajeme, Kenya-5, Joongmo2012, Norin 61, Sukwang , Younbaek and BI1102) were used. One seed was removed from the pear, the endosperm was ground with a mortar, and the protein of wheat HMW-GS was extracted. Specifically, 1,000 ml of extraction buffer (50% 1-propanol, 80 mM TrisHCl pH 8.0) is added to the pulverized seeds, and the supernatant containing gliadin and albumin after centrifugation (12,000 rpm, 5 minutes) was removed. 500 ml of denaturation buffer (50% 1-propanol, 1% (w/v) dithiothreitol, 80 mM TrisHCl pH 8.0) was added to the precipitate, left at 60 °C for 30 minutes, and centrifuged (12,000 rpm, 10 minutes). The supernatant containing HMW-GS was transferred to a new tube and stored in a cryogenic freezer until use.

For the protein composition analysis of HMW-GS, a Criterion vertical electrophoresis cell (Criterion XT Tris-acetate protein gel) (Bio-Rad, USA) was used to SDS-PAGE electrophoresis in Criterion vertical electrophoresis cells (BioRad, USA) was performed according to the manual. The same amount of Laemmli sample buffer_ was added to the extracted 10 ml HMW-GS protein and electrophoresed at 150 V for 4 hours. After staining with Coomassie brilliant blue staining solution, the gel picture was taken. secured.

For composition analysis of HMW-GS using a lab-on-a-chip, 1 ml of the extracted HMW-GS protein was put into a Protein 230 (Agilent Technologies, USA) chip according to the manufacturer's manual, and a 2100 bioanalyzer (Agilent Technologies, USA) for electrophoresis. The composition of HMW-GS is described in Mondal et al., Use of near-isogenic wheat lines to determine the glutenin composition and functionality requirements for flour tortillas. J Agr Food Chem 56: 179-184.2008). Protein quantification of HMW-GS was performed using a 2100 bioanalyzer (Agilent Technologies, USA) program.

The HMW-GS compositions of 14 varieties are shown in Table 1 and FIG. 1 below.

The SDS-PAGE method mainly uses a large gel with a size of 15 Х 15 cm or more. If the size is large, the HMW-GS composition can be clearly read, but it has a disadvantage in that it takes a long time for electrophoresis. To overcome this, the gel size was reduced to 13 Х 8.7 cm, and various gel concentrations including concentration gradients (3-8 %) were treated and analyzed (7.5%, 10%, 12%, 15%). In 7.5%, 10% and 12%, the electrophoresis time was reduced to 3-5 hours, but it was impossible to distinguish between Glu-D1y10 and Glu-D1y12 at the Glu-D1 locus. For the 15% concentration, the electrophoresis time was longer than 8 hours. In the case of the gradient gel, the electrophoresis time was within 4 hours, and it was possible to distinguish between Glu-D1y10 and Glu-D1y12 ( FIG. 1 ). As a result of using the concentration gradient SDS-PAGE, the HMW-GS composition of the 14 varieties used in this study was consistent with the previously reported results (Table 1 and FIG. 1).

As a result of analyzing HMW-GS of 14 varieties with lab-on-a-chip, the results were the same as those of SDS-PAGE analysis (Table 1 and FIG. 1).

Variety name Glu-A1 Locus Glu-B1 Locus Glu-D1 Locus Reported SDS-PAGE DNA Marker Reported SDS-PAGE DNA Marker Reported SDS-PAGE DNA Marker Petrel Null Null Null 7 7 - 5+10 5+10 5+10 Brimstone Null Null Null 6+8 6+8 6+8 2+12 2+12 - Junggye5336 Null Null Null 7+8 7+8 7+8 2.2+12 2.2+12 - Chukoku122 Null Null Null 7+9 7+9 7+9 2.2+12 2.2+12 - Jopum Null Null Null 13+16 13+16 - 2.2+12 2.2+12 - Joongmo2008 Null Null Null 17+18 17+18 17+18 5+10 5+10 5+10 Jokyoung One One One 7+8 7+8 7+8 5+10 5+10 5+10 Cajeme One One One 17+18 17+18 17+18 5+10 5+10 5+10 Kenya-5 One One One 13+16 13+16 - 5+10 5+10 5+10 Joongmo2012 2 ^* 2 ^* 2 ^* 7+8 7+8 7+8 5+10 5+10 5+10 Norin 61 2 ^* 2 ^* 2 ^* 7+8 7+8 7+8 2.2+12 2.2+12 - Sukwang 2 ^* 2 ^* 2 ^* 13+16 13+16 - 2.2+12 2.2+12 - Younbaek 2 ^* 2 ^* 2 ^* 13+16 13+16 - 2.2+12 2.2+12 - Bl1102 2 ^* 2 ^* 2 ^* 17+18 17+18 17+18 5+10 5+10 5+10

Example 2. Evaluation of molecular markers for genotyping of the Glu-A1 locus and the Glu-D1 locus

For DNA extraction, leaves of seedlings 21 days old after sowing were collected and extracted by CTAB (cetyltrimethyl ammonium bromide) method. Among the previously developed gel-based HMW-GS molecular markers, agarose-based molecular markers and KASP (Kompetitive allele-specific PCR) molecular markers reviewed in many literatures were selected (Tables 2 and 3).

PCR of gel-based molecular label was performed by adding 50 ng of isolated gDNA, 0.5 nmole of gene-specific primer, 0.3 ml of Taq polymerase, 200 mM dNTP, and 1 Х PCR buffer. As a PCR device, Veriti Thermal Cycler (Applied biosystem, Carlsbad, USA) was used. PCR reaction using previously reported KASP molecular markers (Tables 2 and 3) was performed by adding 50 ng of gDNA, 1 Х KASP Master mixture, and 0.056 ml of primers. PCR of gel-based molecular label and KASP molecular label is a touch-down method, starting at 65 ° C, lowering the temperature by 0.6 ° C each time, and performing PCR 10 times, followed by PCR at 56 ° C for 30 seconds and 72 ° C. The reaction was terminated after repeating a total of 30 times for 45 seconds and processing at 72 °C for 5 minutes. The PCR product of the gel-based molecular label was electrophoresed on a 3% agarose gel for 1 hour, and a photograph was obtained through a gel documentary system. KASP molecular markers were genotyped using FAM and HEX filters through a 7500 fast Real-Time PCR system (Applied biosystems, USA).

2-1. Glu-A1 locus genotyping molecular marker assay results

The y-type gene of the Glu-A1 locus is not expressed due to gene silencing, and only the x-type alleles Glu1-A1a, Glu1-A1b and Glu1-A1c are expressed. Two types of agarose gel-based STS molecular markers (UMN19, Ax2 ^* ) (Table 2) and two types of fluorescence-based KASP molecular markers (Glu-Ax1/Ax2 ^* _SNP and GLu-Ax2 ^* _IND) (Table 3) was assayed. The co-dominant STS molecular marker, UMN19, can distinguish Glu1-A1b (344 bp) from Glu1-A1a and Glu1-A1c (362 bp), and the dominant STS molecular marker Ax2 ^* also Glu1 -A1b can be specifically distinguished. These molecular markers were able to distinguish between Geumgang with Glu1-A1b, landscape with Glu1-A1a, and Jungmo 2008 with Glu1-A1c, but could not differentiate between landscape and Jungmo 2008 among domestic varieties (FIG. 2A). As a result of applying the KASP molecular markers Glu-Ax1/x2 ^* _SNP and Glu-Ax2 ^* _IND to solve this problem, the cultivar with Glu1-A1c was found to be the SNP "A" allele, Glu1-A1a and Glu1- The cultivar with A1b appeared as the SNP "G" allele (Table 3).

Glu-Ax2 ^* _IND molecular marker, which is known to discriminate Glu-A1b, did not clearly differentiate the fluorescence responses of FAM and HEX along the X and Y axes in the experimental method used in this study.

Summarizing the above results, in order to distinguish the Glu-A1 genotype in domestic wheat breeding, it seems to be effective to use the STS molecular marker UMN19 and the KASP molecular marker Glu-Ax1/x2 ^* _SNP in parallel.

2-2. Glu-D1 locus genotyping molecular marker assay

Glu-D1a, Glu-D1d, and Glu-D1f alleles exist in the Glu-D1 locus of domestic varieties. Glu-D1d has Glu-D1x5 and Glu-D1y10, alleles that must be possessed by a variety suitable for baking aptitude. is known as Among domestic varieties, Geumgang, Baekgang, Jojo, Tapdong, Hwanggeum and Jungmo 2008 have the Glu-D1d allele, most of the varieties have the Glu-D1f allele, and some varieties have the Glu-D1a allele. Four and two species capable of discriminating Glu1-Dx5 and Glu1-Dy10 of the Glu-D1d allele were tested, respectively.

Three types of STS molecular markers (UMN25, Dx5-1 and Dx5-2) and one type of KASP molecular marker (Glu-D1d_SNP) were used to distinguish between Glu1-Dx5. 281 bp was amplified in Jungmo 2008 and Petrel et al., which have Glu1-Dx5 with UMN25, a co-dominant molecular marker, an agarose gel-based molecular marker, and 299 bp was amplified in other genotypes, so Glu1-Dx5 could be identified (Fig. 3A). As for the dominant molecular markers, Dx5-1 and Dx5-2, cultivars with Glu1-Dx5 were amplified by fragments of 478 bp and 450 bp, respectively. As a result of the KASP molecular marker Glu-D1d_SNP assay for Glu1-Dx5 discrimination, the cultivar with Glu1-Dx5 displayed "G" (HEX) SNP, and the cultivar with Glu1-Da and Glu1-D1f alleles showed "C" ( FAM) SNPs ( FIG. 3C ).

In order to discriminate Glu1-Dy10 and Glu1-Dy12, which are the y-types of the Glu-D1 allele, two types of STS molecular markers (UMN26, Dy-10) were assayed. In the case of the co-dominant molecular marker UMN26, a DNA fragment of 397 bp was amplified in the cultivar with Glu1-Dy10, and a DNA fragment of 415 bp in the cultivar with Glu1-Dy12 (Fig. 3D). Previous Glu1-Dy10 discriminant molecular markers (Ahmad M. Molecular marker-assisted selection of HMW glutenin alleles related to wheat bread quality by PCR-generated DNA markers. Theor Appl Genet 101: 892-896. 2002.) were It appeared as a band pattern and was difficult to use for discrimination.

Therefore, it is possible to discriminate the Glu-D1d allele using UMN25 and UMN26, but the difference between the amplified DNA fragments is small and it is expected to be difficult when used in a mass assay in a breeding program. was judged to be preferable.

Locus Gene type Primer name Marker type Target Allele PCR size
(bp) Forward primer sequence (5'-3') Reverse primer sequence (5'-3') Glu-A1 x-type UMN19 co-dominant 2 ^* CGAGACAATATGAGCAGCAAG (SEQ ID NO: 25) non-2 ^* 362 CTGCCATGGAGAAGTTGGA (SEQ ID NO: 26) Glu-Ax2 ^* Dominant 2 ^* 1200 ATGACTAAGCGGTTGGTTTCTT (SEQ ID NO: 27) non-2 ^* no band ACCTTGCTCCCCTTGTCTTT (SEQ ID NO: 28) Glu-D1 x-type UMN25 co-dominant Dx2 299 GGGACAATACGAGCAGCAAA (SEQ ID NO: 29) Dx5 281 CTTGTTCCGGTTTGTTGCCA (SEQ ID NO: 30) Dx-5-1 Dominant Dx5 478 CGTCCCTATAAAAGCCTAGC (SEQ ID NO: 31) non-Dx5 no band AGTATGAAACCTGCTGCGGAC (SEQ ID NO: 32) Dx-5-2 Dominant Dx5 450 GCCTAGCAACCTTCACAATC (SEQ ID NO: 33) non-Dx5 no band GAAACCTGCTGCGGACAAG (SEQ ID NO: 34) y-type UMN26 co-dominant Dy10 397 CGCAAGACAATATGAGCAAACT (SEQ ID NO: 35) Dy12 415 TTGCCTTTGTCCTGTGTGC (SEQ ID NO: 36) Dy-10 co-dominant Dy10 576 GTTGGCCGGTCGGCTGCCATG (SEQ ID NO: 37) Dy12 612 TGGAGAAGTTGGATAGTACC (SEQ ID NO: 38)

Loci Primer Name Target Allele SNP Primer sequence (5'-3') Glu-A1 Glu-Ax1/2 ^* _SNP Ax1, Ax2 ^* G FAM AAGTGTAACTTCTCCGCAACG (SEQ ID NO: 39) Ax-Null A HEX ACCTAAGTGTAACTTCTCCGCAACA (SEQ ID NO: 40) Common CGAAGAAGCTTGGCCTGGATAGTAT (SEQ ID NO: 41) Glu-Ax2 ^* _IND Ax1, Ax-Null Indel FAM ATTCTTGTTGTCCTTGTCCTGGCT (SEQ ID NO: 42) Ax2 ^* HEX CTTGTTGTCCTTTGTCCTGGCC (SEQ ID NO: 43) Common GGTTTCATACTATCCAGGCCAAGCTT (SEQ ID NO: 44) Glu-D1 Glu-D1d_SNP non-Dx5 C FAM ATAGTATGAAACCTGCTGCGGAG (SEQ ID NO: 45) Dx5 G HEX ATAGTATGAAACCTGCTGCGGAC (SEQ ID NO: 46) Common TACTAAAAAGGTATTACCCAAGTGTAACTT (SEQ ID NO: 47)

Example 3. Development of a high molecular weight glutenin gene-specific TaqMan molecular label

In the same manner as in Example 2, 3 types of TaqMan molecular markers for the locus of Glu-A1 (Glu-1Ax1, Glu-1Ax2 ^* , Glu-1Ax Null) and 4 types of TaqMan molecular markers for the locus of Glu-D1 (Glu- 1Dx5-1, Glu-1Dx5-2, Glu-1Dy10) for probe design, primer assay was performed, and genotype analysis was performed using each molecular marker.

Glu1-Ax1 allele-specific TaqMan molecular markers for Glu-A1 locus Glu-1Ax1, Glu1-Ax2 ^* Allele-specific TaqMan molecular markers Glu-1Ax2 ^* , Glu1-Ax Null Allele-specific TaqMan molecular markers Glu- 1Ax Null primer assay and genotyping results are shown in FIGS. 4 to 6 .

The results of primer assay and genotyping of Glu1-Dx5 allele-specific TaqMan molecular markers Glu-1Dx5-1 and Glu-1Dx5-2 and Glu1-Dy10 allele-specific molecular markers Glu-1Dy10 for the locus of Glu-D1 are shown in FIG. 7 to 9 are shown.

Primer information of Glu-1Ax1, Glu-1Ax2 ^* and Glu-1Ax Null is shown in Table 4 below, and primer information of Glu-1Dx5-1, Glu-1Dx5-2, and Glu-1Dy10 is shown in Table 5 below.

Test Name Target allele Primer information Allele SNP Position Name Sequences position Ax-1 Ax1-For TAACTTCTCCGCAACAGTC (SEQ ID NO: 1) 437-455 Ax1-Rev CCTCGTTCTGGTTGCTG (SEQ ID NO: 2) 736-752 Ax1 T 618 Ax1-HEX TCCTTGTCTTAGTTGCTGA (SEQ ID NO: 3) 618-636 Non Ax1 G Ax1-FAM CCTTGTCTTAGTTGCTGC (SEQ ID NO: 4) 618-636 Ax-2 ^* Ax2-For AGACAATATGAGCAGCAAG (SEQ ID NO: 5) 202-220 Ax2-Rev TGCAATGTTCTGGCTG (SEQ ID NO: 6) 559-575 Ax2 ^* A Ax2 ^* -HEX ATAGTACCCTGGTTGCTT (SEQ ID NO: 7) 526-543 Non Ax2 ^* G Ax2 ^* -FAM ATAGTACCCTGGTTGCTC (SEQ ID NO: 8) 526-543 Ax-Null Ax2-For AGACAATATGAGCAGCAAG (SEQ ID NO: 9) 202-220 Ax2-Rev TGCAATTGTTCTGGCTG (SEQ ID NO: 10) 559-575 Ax Null G AxN-HEX CCTGGATAGTATGAAACCC (SEQ ID NO: 11) 353-372 Non Ax Null A AxN-FAM CCTGGATAGTATGAAACCT (SEQ ID NO: 12) 353-372

Test Name Target allele Primer information Allele SNP Position Name Sequences position Dx5-1 Dx5-For_1 TCTGAGCAACTACAGTGTGAG (SEQ ID NO: 13) 76-96 Dx5-Rev_1 GATTTGCTGCTCGTATTGTC (SEQ ID NO: 14) 212-231 Dx5 A 156 Dx5-HEX_1 CAGCAGGTCATGGACCAA (SEQ ID NO: 15) 138-156 Non Dx5 G Dx5-FAM_1 AGCAGGTCATGGACCAG (SEQ ID NO: 16) 139-156 Dx5-2 Dx5-For_2
(UMN25-F) GGGACAATACGAGCAGCAAA (SEQ ID NO: 17) 211-229 Dx5-Rev_2
(UMN25-R) CTTGTTCCGGTTTGTTGCCA (SEQ ID NO: 18) 490-508 Dx5 G Dx5-HEX_2 TATGAAACCTGCTGCGGAC (SEQ ID NO: 19) 353-369 Non Dx5 C Dx5-FAM_2 TATGAAACCTGCTGCGGAG (SEQ ID NO: 20) 353-369 Dy10 Dy10-For TGCCAGCAGCTCCGAG (SEQ ID NO: 21) 196-211 Dy10-Rev GGCACCACAGTTTGCTCAT (SEQ ID NO: 22) 263-281 Dy10 C 234 Dy10-HEX GCCAAGTGCCGCTCC (SEQ ID NO: 23) 220-234 Non 10 T Dy10-FAM GCCAAGTGCCGCTC T G (SEQ ID NO: 24) 220-235

As can be seen from the results of the above examples, the TaqMan molecular marker according to the present invention can quickly and precisely analyze the HMW-GS locus to derive the qualitative composition of HMW-GS, so that the breeding efficiency for improving wheat quality will be improved. can

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims described below and their equivalents.

<110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> TaqMan molecular marker for identifying HMW-GS and use thereof <130> KPA201270-KR <160> 47 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Ax1-For <400> 1 taacttctcc gcaacagtc 19 <210> 2 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Ax1-Rev <400> 2 cctcgttctg gttgctg 17 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Ax1-HEX <400> 3 tccttgtctt agttgctga 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Ax1-FAM <400> 4 ccttgtctta gttgctgc 18 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Ax2-For <400> 5 agacaatatg agcagcaag 19 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Ax2-Rev <400> 6 tgcaattgtt ctggctg 17 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Ax2*-HEX <400> 7 atagtaccct ggttgctt 18 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Ax2*-FAM <400> 8 atagtaccct ggttgctc 18 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Ax2-For <400> 9 agacaatatg agcagcaag 19 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Ax2-Rev <400> 10 tgcaattgtt ctggctg 17 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AxN-HEX <400> 11 cctggatagt atgaaaccc 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AxN-FAM <400> 12 cctggatagt atgaaacct 19 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Dx5-For_1 <400> 13 tctgagcaac tacagtgtga g 21 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dx5-Rev_1 <400> 14 gatttgctgc tcgtattgtc 20 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Dx5-HEX_1 <400> 15 cagcaggtca tggaccaa 18 <210> 16 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Dx5-FAM_1 <400> 16 agcaggtcat ggaccag 17 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dx5-For_2 (UMN25-F) <400> 17 gggacaatac gagcagcaaa 20 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Dx5-Rev_2 (UMN25-R) <400> 18 cttgttccgg ttgttgcca 19 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Dx5-HEX_2 <400> 19 tatgaaacct gctgcggac 19 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Dx5-FAM_2 <400> 20 tatgaaacct gctgcggag 19 <210> 21 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Dy10-For <400> 21 tgccagcagc tccgag 16 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Dy10-Rev <400> 22 ggcaccacag tttgctcat 19 <210> 23 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Dy10-HEX <400> 23 gccaagtgcc gctcc 15 <210> 24 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Dy10-FAM <400> 24 gccaagtgcc gctctg 16 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> UMN19_2* <400> 25 cgagacaata tgagcagcaa g 21 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> UMN19_non-2* <400> 26 ctgccatgga gaagttgga 19 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Glu-Ax2*_2* <400> 27 atgactaagc ggttggttct t 21 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glu-Ax2*_non-2* <400> 28 accttgctcc ccttgtcttt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UMN25_Dx2 <400> 29 gggacaatac gagcagcaaa 20 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> UMN25_Dx5 <400> 30 cttgttccgg ttgttgcca 19 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dx-5-1_Dx5 <400> 31 cgtccctata aaagcctagc 20 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Dx-5-1_non-Dx5 <400> 32 agtatgaaac ctgctgcgga c 21 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dx-5-2_Dx5 <400> 33 gcctagcaac cttcacaatc 20 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Dx-5-2_non-Dx5 <400> 34 gaaacctgct gcggacaag 19 <210> 35 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> UMN26_Dy10 <400> 35 cgcaagacaa tatgagcaaa ct 22 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> UMN26_Dy12 <400> 36 ttgcctttgt cctgtgtgc 19 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Dy-10_Dy10 <400> 37 gttggccggt cggctgccat g 21 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dy-10_Dy12 <400> 38 tggagaagtt ggatagtacc 20 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Glu-Ax1/2*_SNP_FAM <400> 39 aagtgtaact tctccgcaac g 21 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Glu-Ax1/2*_SNP_HEX <400> 40 acctaagtgt aacttctccg caaca 25 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Glu-Ax1/2*_SNP_Common <400> 41 cgaagaagct tggcctggat agtat 25 <210> 42 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Glu-Ax2*_IND_FAM <400> 42 attcttgttg tccttgtcct ggct 24 <210> 43 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Glu-Ax2*_IND_HEX <400> 43 cttgttgtcc ttgtcctggc c 21 <210> 44 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Glu-Ax2*_IND_Common <400> 44 ggtttcatac tatccaggcc aagctt 26 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1d_SNP_FAM <400> 45 atagtatgaa acctgctgcg gag 23 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1d_SNP_HEX <400> 46 atagtatgaa acctgctgcg gac 23 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1d_SNP_Common <400> 47 tactaaaaag gtattaccca agtgtaactt 30

Claims (9)

Glu-1Ax1 primer set consisting of oligonucleotides of SEQ ID NOs: 1 to 4; Glu-1Ax2 ^* primer set consisting of oligonucleotides of SEQ ID NOs: 5 to 8; Glu-1Ax Null primer set consisting of oligonucleotides of SEQ ID NOs: 9 to 12; Glu-1Dx5-1 primer set consisting of oligonucleotides of SEQ ID NOs: 13 to 16; Glu-1Dx5-2 primer set consisting of the oligonucleotides of SEQ ID NOs: 17 to 20; And a primer set for composition analysis of wheat polymer glutenin (high-molecular-weight glutenin subunits, HMW-GS), comprising a combination of the Glu-1Dy10 primer set consisting of the oligonucleotides of SEQ ID NOs: 21 to 24.
The primer set according to claim 1, wherein the Glu-1Ax1 primer set, the Glu-1Ax2 ^* primer set and the Glu-1Ax Null primer set detect Glu-A1.
The primer set according to claim 1, wherein the Glu-1Dx5-1 primer set, the Glu-1Dx5-2 primer set and the Glu-1Dy10 primer set detect Glu-D1.
The primer set according to claim 1, wherein the primers of the primer set are TaqMan primers.
According to claim 1, wherein the wheat is Petrel, Brimstone, Junggye5336 (Junggye5336), Chukoku122, Jopoom, Jungmo2008 (Joongmo2008), Jokyung, Cajeme (Cajeme), Kenya-5 (Kenya-5), Jungmo 2012 (Joongmo2012), Norin 61 (Norin 61), Sugwang (Sukwang), Yeonbaek (Younbaek) and any one or more selected from the group consisting of BI1102, primer set.
(a) using the genomic DNA extracted from wheat to be analyzed for the polymer glutenin as a template, and amplifying the genomic DNA using the primer set of claim 1; and
(B) determining the composition of the polymer glutenin by comparing the amplified product with the amplified product of the standard wheat variety; Containing, Wheat polymer glutenin composition analysis method.
The method of claim 6 , wherein the primers of the primer set are TaqMan primers.
The method of claim 6, wherein the wheat is Petrel, Brimstone, Junggye5336 (Junggye5336), Chukoku122, Jopoom, Joongmo2008 (Joongmo2008), Jokyung, Cajeme (Cajeme), Kenya-5 (Kenya-5), Jungmo 2012 (Joongmo2012), Norin 61 (Norin 61), Sugwang (Sukwang), Yeonbaek (Younbaek) and any one or more selected from the group consisting of BI1102, Way.
A kit for analyzing the composition of wheat polymer glutenin, comprising the primer set of claim 1, DNA polymerase, dNTPs and a buffer.

Images