KR100781205B1 - SSR primer isolated from Perilla spp. and use thereof - Google Patents

Abstract

The present invention relates to an SSR primer isolated from Perilla spp. And its use, and more particularly, to an SSR primer pair having two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 26; The present invention relates to a method for detecting DNA polymorphism of perilla plants, including performing PCR. SSR primer pair provided in the present invention can effectively detect the DNA polymorphism of perilla plants, it can be very useful for preparing the DNA profile of perilla plants. In addition, by efficiently evaluating the genetic resources of the genus perilla plants, it is possible to effectively perform redundancy analysis and establishment of novelty with existing resources when introducing new genetic resources.

SSR Primer, Perilla, DNA Polymorphism

Description

SSR primer isolated from perilla plants and its use {SSR primer isolated from Perilla spp. and use kind}             

1 is a part of a PCR result performed to select an efficient SSR primer pair showing genetic polymorphism in 20 cultivated and weed perilla plants among the SSR primer pair designed in the present invention.

M: molecular weight size marker

The present invention relates to an SSR primer isolated from perilla plants and its use, and more particularly, SSR primer pair having two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 26 and PCR using the same The present invention relates to a method for detecting DNA polymorphism of a genus perilla plant.

Large quantities of genetic resources are collected annually in most major crops and cultivated crops used for breeding. However, on the other hand, the evaluation of genetic resources has not been sufficiently made. Rapid discrimination between species and subspecies varieties of collected genetic resources is very important for accurate management and protection of genetic resources. In addition to the identification of varieties, the identification and classification of trait traits and genetic relationships of genetic resources are very important for the conservation of genetic resources, the creation of new varieties, and the improvement of crops.

Recent rapid advances in molecular biology have led to the development of nucleic acid fingerprint analysis methods and various DNA markers that enable bio-diversity studies at the nucleic acid (DNA) level. This makes it possible to search useful traits, identify species of species, classify and identify varieties, and analyze flexible relationships of populations in a simple and quick manner with little influence on the external environment. Nucleic acid fingerprinting using polymerase chain reaction (PCR) developed so far includes randomly amplified polymorphic DNAs (RAPD), amplified fragment length polymorphic DNA (AFLP), and simple sequence repeat (SSR). The RAPD method has a disadvantage of poor reproducibility because the non-specific PCR product is amplified, and the AFLP method is spotlighted by high DNA polymorphism detection, but has a disadvantage of complicated appearance and analysis of a low reproducible band. In contrast, the SSR method is a method of constructing a PCR primer based on nucleotide sequence information of a microsatellite region, which is a DNA repeat sequence. Frequently used. In particular, the SSR method has the advantage that it is not affected by the external environment at all. Due to the superiority of this SSR method, there is an ongoing research to develop SSR markers in several major crops and cultivated crops.

In rice, supersatellite markers have been developed that amplify SSR repeated in the rice genome by PCR technology to identify genotypes of rice varieties (Patent Application No. 2001-34003). Tang's team in the United States published a genetic map of sunflowers that developed 879 SSR markers (Tang et al., Theor. Appl. Genet ., 105: 1124-1136, 2002). In addition, many SSR markers have been developed in barley and soybeans. However, SSR markers have never been developed in Perilla.

Accordingly, the present inventors have completed the present invention by developing SSR primer pairs showing a large number of polymorphic variations in various perilla lines, while continuing to develop SSR markers capable of efficiently evaluating the gene source of perilla.

Accordingly, it is an object of the present invention to provide an SSR marker and its use capable of efficiently evaluating the genetic resources of Perilla spp. Plants.

In order to achieve the above object, the present invention provides an SSR primer pair having two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 26.                     

In order to achieve another object of the present invention, the present invention provides a method for detecting DNA polymorphism of the genus Perilla plants comprising performing PCR using the SSR primer pair.

In order to achieve another object of the present invention, the present invention provides a kit for detecting the DNA polymorphism of the genus Perilla plants comprising the SSR primer pair, DNA polymerase and PCR reaction buffer.

Hereinafter, the present invention will be described in detail.

The present invention is characterized in that it provides an SSR marker that can specifically analyze the genetic diversity of Perilla spp. Plants. In the present invention, SSR markers were developed from perilla plants by a novel method combining AFLP and one way PCR. SSR markers isolated from perilla plants are the first to be provided by the present invention.

The SSR marker provided by the present invention refers to a pair of PCR primers, and includes a forward primer and a reverse primer. SSR primer pair provided in the present invention has two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 26. Preferably, KWPE-1 (primary pairs represented by SEQ ID NOs: 1 and 2), KWPE-5 (primary pairs represented by SEQ ID NOs: 3 and 4), KWPE-19 (primary pairs represented by SEQ ID NOs: 5 and 6) , KWPE-25 (primary pairs represented by SEQ ID NOs: 7 and 8), KWPE-26 (primary pairs represented by SEQ ID NOs: 9 and 10), KWPE-29 (primary pairs represented by SEQ ID NOs: 11 and 12), KWPE -32 (primary pairs represented by SEQ ID NOs: 13 and 14), KWPE-39 (primary pairs represented by SEQ ID NOs: 15 and 16), KWPE-48 (primary pairs represented by SEQ ID NOs: 17 and 18), KWPE-51 (Primary pairs represented by SEQ ID NOs: 19 and 20), KWPE-53 (primary pairs represented by SEQ ID NOs: 21 and 22), KWPE-57 (primary pairs represented by SEQ ID NOs: 23 and 24), and KWPE-58 (SEQ ID NO: Primer pairs represented by numbers 25 and 26). Information on the primer pairs provided in the present invention and the repeat motifs present in the supersatellites amplified by them, the size of the supersatellites to be amplified, the Tm (° C.) and the chromosomal alleles in which the supersatellites are present are given below. It is shown in Table 1.

Table 1

Characteristics of SSR Primer Pairs of the Present Invention and Supersatellites Amplified therefrom

Primer Name order SEQ ID NO: Repeat motif Expected size of the supersatellite being amplified Tm (℃) No. of alleles One KWPE-1 ^a F-CAAAAGCCTTACAACTTTGA One (GAA) ₁₈  198 55 5 ^b R-AGCGTTTGTATTTCATGGAC 2 2 KWPE-5 F-ATCTCCAAGCTTATGAATGC 3 (ATG) ₆ , (GA) ₅   195 55 6 R-CTGGTAGTGAGCCTGTTCAT 4 3 KWPE-19 F-CAACCCTTCACGATCACTAT 5 (ACG) ₇  215 55 4 R-AAATAACGGCCGATTCTAC 6 4 KWPE-25 F-ACATTTAAGAGAGAGAGCAAG 7 (GT) ₈ , (GA) ₁₄  212 55 7 R-ACGAACGGGCTTCAATCTT 8 5 KWPE-26 F-GAGGCAATGCTGGTACTTC 9 (AG) ₆ , (GT) ₇ , (GA) ₁₃  243 55 7 R-GAACGGGCTTCAATCTTC 10 6 KWPE-29 F-AAGACAAGGAGGAAGATGC 11 (GAA) ₅   164 55 6 R-ATAGGTGTTCGCTCTCCTGTG 12 7 KWPE-32 F-AGAACAACATTGTAGCTCGG 13 (CCT) ₄ 225 55 4 R-ACGACCAACCAGTAGATGAT 14 8 KWPE-39 F-AGAACAACATTGTAGCTCGG 15 (CCT) ₄ 298 55 3 R-GACGAACCAGCAAACGAC 16 9 KWPE-48 F-CACCCCATCTTTTTGGAT 17 (GA) ₉ 215 55 3 R-AGCAGGATGGTGGTGGTC 18 10 KWPE-51 F-CCATACCTGGAACAAACATT 19 (A (N)) ₉ 184 55 6 R-GACCCTAGCTTCTCTCCATT 20 11 KWPE-53 F-ACTCACCAGAAGAGAAGAAGA 21 (CT) ₁₆ 187 55 9 R-GCCACTGACCTGTTAATATCTG 22 12 KWPE-57 F-ATCACATCTCTCTCTTTCTGGA 23 (CT) ₁₆ 156 55 9 R-CCAGTCACTCCATCATCTCTA 24 13 KWPE-58 F-AGAGAGTTACCTGCGATTTTC 25 (GA (T)) ₂₁ 162 55 7 R- CTTCAATATTCGGCCATCTT 26

^a F: forward primer ^b R: reverse primer

SSR primer pairs provided in the present invention can be usefully used for detecting DNA polymorphism and analyzing genetic diversity in perilla plants. The SSR primer according to the present invention can be used to efficiently evaluate and preserve the genetic resources of the genus Perilla. Accordingly, the present invention provides a method for detecting DNA polymorphism of a perilla plant comprising performing PCR using the SSR primer pair.

Specifically, the method of the present invention

(a) extracting genomic DNA from the perilla plant to be analyzed;

(b) performing PCR using the extracted genomic DNA as a template and the SSR primer pair provided by the present invention; And

(c) electrophoresis of the PCR product.

Extraction of genomic DNA in step (a) is phenol / chloroform extraction or SDS extraction commonly used in the art (Tai et al ., Plant Mol. Biol. Reporter , 8: 297-303, 1990) or sold commercially DNA extraction kits can be used.

In addition, the PCR in the step (b) may be performed using a PCR reaction mixture containing a variety of components known in the art required for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer and water (dH ₂ O) in addition to genomic DNA extracted from perilla plants to be analyzed and the SSR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl and the like. At this time, the concentration of MgCl ₂ greatly affects the specificity and quantity of amplification. Preferably in the range of 1.5-2.5 mM. In general, when Mg ²⁺ is excessive, nonspecific PCR amplification products increase, and when Mg ²⁺ is insufficient, PCR The yield of the product is reduced. The PCR buffer may further include an appropriate amount of Triton X-100. PCR also denatured the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. The denaturation and amplification may be performed at 94-95 ° C. and 72 ° C., respectively, and the temperature at the time of binding may vary depending on the type of primer. Preferably it is 52-57 degreeC, More preferably, it is 55 degreeC. The time and number of cycles in each step can be determined according to the conditions generally made in the art. The optimal reaction conditions when performing PCR using the SSR primer pair according to the present invention are as follows: After denature the template DNA for 3 minutes at 95 ℃, 30 seconds at 95 ℃; 30 seconds at 55 ° C .; And repeating 36 cycles of 1 minute 30 seconds at 72 ° C., and finally reacting at 72 ° C. for 5 minutes.

PCR amplification results can be confirmed by agarose gel (agarose gel) or polyacrylamide gel (polyacrylamide gel) electrophoresis (step (c)). Preferably it can be confirmed by polyacrylamide gel electrophoresis, more preferably by modified polyacrylamide gel electrophoresis. Electrophoresis results can be analyzed by silver staining after electrophoresis. General PCR performance and resulting analysis methods are well known in the art.

In another aspect, the present invention provides a kit for detecting DNA polymorphism of perilla plants comprising SSR primer pair, DNA polymerase and PCR reaction buffer according to the present invention. The composition of the PCR reaction buffer is as described above. In addition, the components necessary for performing electrophoresis capable of confirming amplification of PCR products may be further included in the kit of the present invention.

Perilla in plants which can be applied to the present invention, perilla fruit test sense (Perilla frutescens), perilla sheet Rio Dora (Perilla citriodora), perilla Nevsehir telra (Perilla hirtella), perilla Seto N-Sys (Perilla setoyensis) and their It may be a variant, but is not limited thereto. Preferably perilla frutescens var. Frutescens and perilla frutescens var. Crispa .

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

<Example 1>

Genomic DNA Extraction

According to: (297-303, 1990 Tai et al , Plant Mol Biol Reporter, 8...): Cultivation type perilla (Cultivated type of frutescens var.) Method using the SDS from (Rural Development Administration genetic resources and, Accession No. KOR17) Genomic DNA was extracted. 0.5 g of leaf tissues were taken from young perilla plants at 1 month of growth and placed in a 1.5 ml tube and quenched with liquid nitrogen. The leaf was then ground finely with a plastic rod immediately. 750 μl of extraction buffer (200 mM Tris-HCl pH8.0, 200 mM NaCl, 25 mM EDTA, 0.5% SDS) was added before the leaf sections were dissolved. The same amount of phenol (chloro): chloroform: isoamylalchol (25: 24: 1) was further added, and then gently shaken by hand for about 5 minutes. The mixed solution was stored at 65 ° C. for 15 minutes, and then centrifuged at 13,000 rpm for 15 minutes. The supernatant was taken and transferred to a new tube. The same amount of isopropanol stored at -20 ° C was added to the tube, and stored at -20 ° C for 1 hour. Thereafter, the mixture was centrifuged at 13,000 rpm for 15 minutes. Precipitated DNA was washed with 70% ethanol. After the DNA was dried, it was sufficiently dissolved by adding TE buffer solution (10 mM Tris-Cl, 1 mM EDTA, pH7.4) containing about 300 µl of RNase (50 µg / ml), followed by 1 hour at 37 ° C. It was stored about.

<Example 2>

Ligation with Adapters

About 500 ng / μl of genomic DNA obtained in Example 1 was double cut into Eco RI and Taq I. After cleaved DNA was electrophoresed in a 1.2% agarose gel, only DNA fragments of about 300-1500 bp size were eluated from the gel. Thereafter, the affected DNA fragment was ligated overnight at 22 ° C. with four adapters having base sequences complementary to the restriction enzymes. Ligation was performed using T4 DNA ligase. The sequence of each adapter is shown in Table 2 below.

TABLE 2

Adapter used in the present invention

Adapter name Sequence SEQ ID NO: Eco RⅠ-1 ATC GTA GAC TGC GTA CC 27 Eco RⅠ-2 AAT TGG TAC GCA GTC TAC 28 Taq Ⅰ-1 GAC GAT GAG TCC TGA G 29 Taq Ⅰ-2 CGC TCA GGA CTC AT 30

<Example 3>

One-way PCR

In Example 2, one-way PCR was performed using only one Taq I adapter primer (PRTP-0, SEQ ID NO: 31) having a DNA ligated with the adapter as a template and a phosphate attached to the 5 ′ end. The composition of the PCR reaction mixture (50 μl) is as follows: 250 ng adapter-ligated DNA, 0.5 μM Taq I adapter primer, 2 mM dNTP, 2 units Taq DNA polymerase, 5 μl 10 μs buffer. PCR reactions were heated at 72 ° C. for 2 minutes, 94 ° C. for 3 minutes, and then at 94 ° C. for 30 seconds; 30 seconds at 56 ° C .; And 1 minute at 72 ° C. was repeated for 60 cycles, and finally at 72 ° C. for 5 minutes.

<Example 4>

Selection and Isolation of DNA Fragments Containing Supersatellites

<4-1> Preparation of Magnetic Bead-Oligo Probe Conjugate

Magnetic beads (Roche magnetic particles) were washed 1 times with 5 × SSC and then dissolved in 50 μl 5 SSC. On the other hand, the fourteen oligo probes described in Table 3 were labeled with biotin according to conventional methods known in the art. Then, 50 μl of magnetic beads dissolved in 5 × SSC, 1.3 μl of each oligo probe, 25 μl of 10 × SSC, and 23.7 μl of distilled water were mixed. The mixture was allowed to stand at room temperature for 15 minutes to induce binding of the magnetic beads and the oligo probe. Magnetic bead-oligoprobe conjugates were washed three times with 100 μl 5 × SSC. The washing was performed by precipitating the conjugate under the tube using the magnetic force of a magnetic separator (Promega). Purity of the magnetic beads-oligoprobe conjugate with increased purity was again dissolved in 50 μl of 10 × SSC and stored at room temperature for a while.

TABLE 3

Sequence of Oligo-Probe for Separation of Supersatellites of Perilla Plants

order SEQ ID NO: One (AT) ₁₂ 32 2 (AG) ₁₂ 33 3 (CA) ₁₂ 34 4 (AAC) ₈ 35 5 (AAG) ₈ 36 6 (ACG) ₈ 37 7 (AGC) ₈ 38 8 (AGG) ₈ 39 9 (CCG) ₈ 40 10 (CTC) ₈ 41 11 (TAA) ₈ 42

<4-2> hybridization

The PCR product obtained in Example 3 for hybridization was prepared as follows: 10 μl of the PCR product was mixed with 40 μl of distilled water and left for 5 minutes in boiling water for denaturation. It was then transferred directly to ice for DNA fixation. 50 μl of the denatured PCR product was mixed with 50 μl of the oligo probe bound to the magnetic beads, and then reacted at 30 ° C. for 20 minutes to induce hybridization. Thereafter, the mixture was washed four times for 5 minutes with 100 μl of 2 × SSC, and again for 4 minutes at 30 ° C. with 100 μl of 1 × SSC. 20 μl of 0.15 M NaOH was treated for 20 minutes at room temperature. The oligoprobe bound to the magnetic beads by NaOH treatment is separated separately (chemical denature). The remaining oligo probe was removed again using a magnetic separator. Chemical denaturation was neutralized by adding 2.2 μl 10 × TE buffer and 1.3 μl of 1.24 M acetic acid. Thereafter, the PCR product was desalted using a PCR purification kit or ethanol precipitation.

Desalted PCR products were amplified again for sequencing. At this time, PCR was performed using Eco RI-0 primer (SEQ ID NO: 43) together with the primer used in Example 3. PCR was performed under the same conditions as in Example 3, except that the total number of cycles of the PCR was reduced to 24 cycles. In this manner, about 500 DNA fragments containing supersatellites were isolated in the present invention.

<Example 5>

Sequencing and Primer Design of Isolated DNA Fragments

DNA fragments containing the supersatellite isolated in Example 4 were cloned into pGEM T-easy vector vector (Promega, USA) to analyze their sequences. Sequence analysis was performed by requesting Macrogen. Only fragments containing 5 or more repeat units were selected based on the analyzed sequences. Based on the part containing the repeating unit, a primer in both directions was designed to amplify the supersatellite. A total of 68 primer pairs were designed. The base sequences of each primer pair and the properties of the supersatellites amplified therefrom are shown in Tables 4 to 7. In Tables 4 to 7, F represents a forward primer and R represents a reverse primer.                     

Table 4

Designed SSR Primer Pairs (Nos. 1-20) and Characteristics of Supersatellites Amplified therefrom

Table 5

Designed SSR Primer Pair (Nos.21-40) and Characterization of Supersatellites Amplified from It

Table 6

Designed SSR Primer Pairs (Nos. 41-60) and Characteristics of Supersatellites Amplified therefrom

TABLE 7

Designed SSR Primer Pair (Nos. 61-68) and Characterization of Supersatellites Amplified from It

<Example 6>

Selection of SSR Markers

In order to select SSR primer combinations showing a large number of polymorphic variation in various perilla strains among the primer pairs designed in Example 5, DNA profiles through PCR for 20 cultivated or weed perilla plants shown in Table 8 below. Profiling analysis was performed.

Table 8

Perilla plants used for SSR analysis

Deposit number Depositary Institution country Type One CH1 Rural Development Administration China Cultivated type of var.frutescens 2 CH2 Rural Development Administration  China Cultivated Perilla 3 CH3 Rural Development Administration  China Cultivated Perilla 4 KOR17 Rural Development Administration   Republic of Korea Cultivated Perilla 5 KOR19 Rural Development Administration   Republic of Korea Cultivated Perilla 6 KOR20 Rural Development Administration   Republic of Korea Cultivated Perilla 7 KOR21 Rural Development Administration   Republic of Korea Cultivated Perilla 8 KOR22 Rural Development Administration   Republic of Korea Cultivated Perilla 9 JA30 Rural Development Administration  Japan Cultivated Perilla 10 JA31 Rural Development Administration  Japan Cultivated Perilla 11 JA32 Rural Development Administration Japan Weeds type perilla (weedy type of var. Frutescens) 12 CH40 Rural Development Administration  China Weed perilla 13 CH41 Rural Development Administration  China Weed perilla 14 KOR49 Rural Development Administration   Republic of Korea Weeds type shiso (weedy type of var. Crispa) 15 KOR50 Rural Development Administration   Republic of Korea Weed 16 CH4 Rural Development Administration  China Cultivated Perilla 17 KOR24 Rural Development Administration   Republic of Korea Cultivated Perilla 18 JA67 Rural Development Administration Japan Cultured type of var. Crispa 19 JA68 Rural Development Administration  Japan Cultivation Aperture 20 JA72 Rural Development Administration Japan Cultivation Aperture

The composition of the PCR reaction mixture (20 μl) is as follows: 20 ng of perilla genomic DNA, 0.5 μM of each primer, 200 μM of dNTPs, 1 × PCR reaction buffer (10 mM Tris-HCl pH 8.8, 1.5 mM MgCl ₂ , 50 mM KCl, 0.1% Triton X-100), 1 unit DNA polymerase and remaining distilled water. PCR reaction was performed after denaturing the template DNA for 3 minutes at 95 ℃, 30 seconds at 95 ℃; 30 seconds at 55 ° C .; And 1 minute 30 seconds at 72 ° C. was repeated for 36 cycles, and finally at 72 ° C. for 5 minutes.

2 μl of the amplified PCR product was mixed with 4 μl of 6 × loading buffer (10 mM NaOH, 95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol FF). The mixed solution was heated at 95 ° C. for 5 minutes, and then 3 μl of the mixed solution was taken and a 6% denaturing polyacrylamide gel (acrylamide: bisacrylamide (19: 1), 7.5 M urea, 1, previously heated to 55 ° C.). TBE buffer (0.89 M Tris-HCl pH 8.0, 0.89 M boric acid, 0.02 M EDTA pH 8.0). Then, electrophoresis was performed for 1 hour and 30 minutes at 1800V, 60W. The results were analyzed by silver staining.

As a result, 13 primer pairs (KWPE-1, KWPE-5, KWPE-19, KWPE-25, KWPE-26, KWPE-29, KWPE-32, KWPE) out of a total of 68 primer pairs designed in Example 5 -39, KWPE-48, KWPE-51, KWPE-53, KWPE-57 and KWPE-58) showed polymorphism in 20 cultivated or weed perilla plants. Representative results are shown in FIG. 1.

FIG. 1 shows that KWPE-53, KWPE-57, KWPE-58, KWPE-29 and KWPE-26 primer pairs show polymorphism in 20 cultivated or weed perilla plants. The KWPE-53 primer pair amplified DNA fragments of about 150-200 bp in 20 perilla lines, and the number of alleles observed was nine. KWPE-57 primer pairs amplified DNA fragments of about 170-220 bp size and the number of alleles observed was nine. In addition, KWPE-58 primer pairs amplified DNA fragments of about 160-180 bp in size, and the number of alleles was seven. KWPE-29 primer pairs amplified DNA fragments of about 230-260 bp size and the number of alleles observed was six. Finally, the KWPE-26 primer pair amplified DNA fragments of about 240-260 bp in size, with seven alleles observed.

As described above, in the present invention, the first SSR marker was developed in perilla. SSR primer pairs provided in the present invention can be very useful for effectively detecting the DNA polymorphism of perilla to create a DNA profile of the genus perilla. By efficiently evaluating the genetic resources of perilla plants, it is possible to effectively conduct redundancy analysis and establish novelty with existing resources when introducing new genetic resources.

Attach sequence list electronic file  

Claims (5)

SSR primer pair having two nucleotide sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 26. The method of claim 1, wherein the primer pair represented by SEQ ID NO: 1 and 2; Primer pairs represented by SEQ ID NOs: 3 and 4; Primer pairs represented by SEQ ID NOs: 5 and 6; Primer pairs represented by SEQ ID NOs: 7 and 8; Primer pairs represented by SEQ ID NOs: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12; Primer pairs represented by SEQ ID NOs: 13 and 14; Primer pairs represented by SEQ ID NOs: 15 and 16; Primer pairs represented by SEQ ID NOs: 17 and 18; Primer pairs represented by SEQ ID NOs: 19 and 20; Primer pairs represented by SEQ ID NOs: 21 and 22; Primer pairs represented by SEQ ID NOs: 23 and 24; And an SSR primer pair selected from the group consisting of primer pairs represented by SEQ ID NOs: 25 and 26. The SSR primer pair according to claim 1 or 2, which is derived from a Perilla spp. Plant. (a) extracting genomic DNA from the perilla plant to be analyzed; (b) using the extracted genomic DNA as a template and performing PCR using the SSR primer pair of claim 1; And (c) A method for detecting DNA polymorphism of a perilla plant comprising electrophoresis of a PCR product. A kit for detecting DNA polymorphism in a perilla plant comprising the SSR primer pair of claim 1 or 2, a DNA polymerase and a PCR reaction buffer.

Images