KR100769367B1 - Ssr primer derived from common millet and use thereof - Google Patents

Ssr primer derived from common millet and use thereof Download PDF

Info

Publication number
KR100769367B1
KR100769367B1 KR1020060094920A KR20060094920A KR100769367B1 KR 100769367 B1 KR100769367 B1 KR 100769367B1 KR 1020060094920 A KR1020060094920 A KR 1020060094920A KR 20060094920 A KR20060094920 A KR 20060094920A KR 100769367 B1 KR100769367 B1 KR 100769367B1
Authority
KR
South Korea
Prior art keywords
seq
nos
pam
primer pairs
pairs represented
Prior art date
Application number
KR1020060094920A
Other languages
Korean (ko)
Inventor
마경호
박용진
이정로
이석영
곽재균
김태산
조은기
조양희
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020060094920A priority Critical patent/KR100769367B1/en
Application granted granted Critical
Publication of KR100769367B1 publication Critical patent/KR100769367B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Abstract

An SSR(simple sequence repeat) primer from Panicum miliaceum L. is provided to be very usefully used for preparing a DNA profile of the Panicum miliaceum L. by effectively detecting the DNA polymorphism of the Panicum miliaceum L. and efficiently evaluate genetic resources of the Panicum miliaceum L., thereby effectively performing redundancy analysis with conventional resources and establishing novelty when a novel genetic resource is introduced and being able to determine the species of the Panicum miliaceum L.. An SSR primer pair derived from Panicum miliaceum L. has two sequences selected from the group consisting of SEQ ID : NOs. 1-62. A method for identifying species of Panicum miliaceum L. comprises the steps of: (a) extracting genome DNAs from Panicum miliaceum L. and a control Panicum miliaceum L. species; (b) performing PCR on each of the extracted genome DNAs using the SSR primer pair; (c) isolating each of the PCR products by size; and (d) comparing the isolation results of the Panicum miliaceum L. and the control Panicum miliaceum L. species. A kit for detecting DNA polymorphism or a kit for identifying species of Panicum miliaceum L. comprises the SSR primer pair.

Description

기장에서 유래한 SSR 프라이머 및 이의 용도{SSR primer derived from common millet and use thereof}SSR primer derived from common millet and its use {SSR primer derived from common millet and use etc}

본 발명은 기장(Common millet; Panicum miliaceum L.)에서 분리한 SSR 프라이머 및 이의 용도에 관한 것으로서, 보다 상세하게는 서열번호 1 내지 서열번호 62로 이루어진 군에서 선택되는 2개의 염기서열을 갖는 SSR 프라이머쌍 및 이를 이용하여 PCR을 수행하는 것을 포함하는 기장의 DNA 다형성 검출 방법에 관한 것이다.The present invention is a millet (Common millet; Panicum SSR primer isolated from miliaceum L.) and its use, and more specifically, SSR primer pair having two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 62 and PCR using the same It relates to a DNA polymorphism detection method of millet comprising the.

육종에 이용되고 있는 대부분의 주요 작물 및 소재배 작물에서 해마다 많은 양의 유전자원이 수집되고 있다. 그러나, 이에 반해 유전자원에 대한 평가는 충분히 이루어지지 않고 있는 실정이다. 수집된 유전자원의 종간 및 아종간 품종의 신속한 판별은 정확한 유전자원의 관리 및 보호를 위하여 매우 중요하다. 또한 품종의 판별과 함께 유전자원의 유형 형질 탐색과 분류, 그리고 유연관계의 규명은 유전자원의 보존이나 신품종의 창출 및 작물의 개량에 있어서 매우 중요하다.Large quantities of genetic resources are collected annually in most major crops and cultivated crops used for breeding. However, on the other hand, the evaluation of genetic resources has not been sufficiently made. Rapid discrimination between species and subspecies varieties of collected genetic resources is very important for accurate management and protection of genetic resources. In addition to the identification of varieties, the identification and classification of trait traits and genetic relationships of genetic resources are very important for the conservation of genetic resources, the creation of new varieties, and the improvement of crops.

최근 분자생물학의 급속한 발전으로 핵산(DNA) 수준에서 유전자원의 다양성(bio-diversity) 연구를 가능케 하는 핵산 지문 분석 방법 및 다양한 DNA 마커들이 개발되었다. 이를 통해 유용 형질 탐색, 생물의 종 판별, 품종 분류·동정 및 집단 개체군의 유연관계 분석을 외부환경 등에 대하여 거의 영향을 받지 않고 간단하고 신속하게 수행할 수 있게 되었다. 지금까지 개발된 PCR(polymerase chain reaction)을 이용한 지문분석법(fingerprinting)에는 RAPD(randomly amplified polymorphic DNAs) 방법, AFLP(amplified fragment length polymorphic DNA) 방법, SSR(simple sequence repeat) 방법 등이 있다. 상기 방법 중 RAPD 방법은 비특이적 PCR 산물이 증폭되므로 재현성이 떨어지는 단점이 있고, AFLP 방법은 높은 DNA 다형성 검출로 각광받고 있지만 재현성이 떨어지는 밴드의 출현과 분석이 복잡하다는 단점이 있다. 이에 반해, SSR 방법은 DNA 반복 배열인 초위성체(microsatellite) 영역의 염기 배열 정보를 근거로 PCR 프라이머를 제작하여 이용하는 방법으로서, 초위성체 분석이 용이하고 높은 재현성을 가지는 장점으로 인하여 생물종의 동정에 자주 사용되고 있다. 특히 SSR 방법은 외부 환경의 영향을 전혀 받지 않는다는 장점이 있다. 이와 같은 SSR 방법의 우수성으로 인해 여러 주요작물 및 소재배 작물에서 SSR 마커를 개발하려는 연구가 한창 진행 중에 있다.Recent rapid advances in molecular biology have led to the development of nucleic acid fingerprint analysis methods and various DNA markers that enable bio-diversity studies at the nucleic acid (DNA) level. This makes it possible to search useful traits, identify species of species, classify and identify varieties, and analyze flexible relationships of populations in a simple and quick manner with little influence on the external environment. Fingerprinting methods using polymerase chain reaction (PCR) developed so far include randomly amplified polymorphic DNAs (RAPD), amplified fragment length polymorphic DNA (AFLP), and simple sequence repeat (SSR). The RAPD method has a disadvantage of poor reproducibility because the non-specific PCR product is amplified, and the AFLP method is spotlighted by high DNA polymorphism detection, but has a disadvantage of complicated appearance and analysis of a low reproducible band. In contrast, the SSR method is a method of constructing a PCR primer based on nucleotide sequence information of a microsatellite region, which is a DNA repeat sequence. Frequently used. In particular, the SSR method has the advantage that it is not affected by the external environment at all. Due to the superiority of this SSR method, studies are underway to develop SSR markers in several major crops and cultivated crops.

벼에서는 벼 게놈에 반복되는 SSR을 PCR 기술로 증폭하여 벼 품종의 유전자형을 동정하는 초위성체 마커들이 개발되었다(대한민국 특허출원번호 제2001-34003호). 미국의 탕(Tang) 박사팀은 879개의 SSR 마커들을 개발하여 해바라기의 유전자 지도를 발표한 바 있다(Tang et al ., Theor . Appl . Genet., 105: 1124-1136, 2002). 이외에도 보리, 콩 등에서 많은 SSR 마커들이 개발되었다. 그러나, 기장에서는 SSR 마커가 아직 국내에서 전혀 개발된 바 없으며, 외국에서도 이와 관련된 연구가 거의 이루어지지 않은 실정이다.In rice, supersatellite markers have been developed that amplify SSR repeated in the rice genome by PCR technology to identify genotypes of rice varieties (Korean Patent Application No. 2001-34003). Tang's team in the United States developed 879 SSR markers and published a genetic map of sunflowers (Tang et al ., Theor . Appl . Genet ., 105: 1124-1136, 2002). In addition, many SSR markers have been developed in barley and soybeans. However, in the millet, the SSR marker has not been developed at all in Korea, and there is little research on this in foreign countries.

이에 본 발명자들은 기장의 유전자원을 효율적으로 평가할 수 있는 SSR 마커를 개발하기 위하여 연구를 거듭하던 중, 다양한 기장 계통들에서 다형성 변이를 많이 나타내는 SSR 프라이머쌍을 개발함으로써 본 발명을 완성하였다. Accordingly, the present inventors have completed the present invention by developing SSR primer pairs that show a large number of polymorphic variations in various millet lines, while continuing to develop SSR markers capable of efficiently evaluating the genetic resources of millet.

따라서, 본 발명의 목적은 기장의 유전자원을 효율적으로 평가할 수 있는 SSR 마커 및 이의 용도를 제공하는 것이다.It is therefore an object of the present invention to provide an SSR marker and its use capable of efficiently evaluating the genetic resources of millet.

상기와 같은 목적을 달성하기 위하여, 본 발명은 서열번호 1 내지 서열번호 62로 이루어진 군에서 선택되는 2개의 염기서열을 갖는 SSR 프라이머쌍을 제공한다.In order to achieve the above object, the present invention provides an SSR primer pair having two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 62.

본 발명의 다른 목적을 달성하기 위하여, 본 발명은 상기 SSR 프라이머쌍을 이용하여 PCR을 수행하는 것을 포함하는 기장의 DNA 다형성 검출 방법 및 기장의 품종 동정 방법을 제공한다.In order to achieve another object of the present invention, the present invention provides a method for detecting DNA polymorphism of the millet and a method for identifying the variety of the millet, including performing PCR using the SSR primer pair.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 상기 SSR 프라이머쌍, DNA 중합효소 및 PCR 반응 완충용액을 포함하는 기장의 DNA 다형성 검출용 키트 및 기장의 품종 동정용 키트를 제공한다.In order to achieve another object of the present invention, the present invention provides a kit for detecting DNA polymorphism of the millet and kit for identifying the variety of millet including the SSR primer pair, DNA polymerase and PCR reaction buffer.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 기장의 유전적 다형성을 특이적으로 분석할 수 있는 SSR 마커를 제공하는 것을 특징으로 한다. The present invention is characterized by providing an SSR marker capable of specifically analyzing the genetic polymorphism of the millet.

본 발명에서는 비오틴-스트렙타비딘 포획(biotin-streptavidin capture; Dixit et al., Mol. Eco. Note, 5: 736-738) 방법으로 기장으로부터 SSR 마커를 개발하였다. 기장에서 분리된 SSR 마커는 본 발명에 의해 처음으로 제공되는 것이다.In the present invention, SSR markers were developed from the millet by biotin-streptavidin capture (Dixit et al., Mol. Eco.Note, 5: 736-738). The SSR marker isolated from the millet is the first to be provided by the present invention.

구체적으로, 본 발명의 SSR 마커는 다음과 같은 방법으로 개발되었다. 기장으로부터 추출한 게놈 DNA를 제한효소로 처리해 DNA 단편을 제조한 후 AP11 및 AP12의 2개의 어댑터와 라이게이션하였다.Specifically, the SSR marker of the present invention was developed by the following method. Genomic DNA extracted from the millet was treated with restriction enzymes to prepare DNA fragments and then ligated with two adapters of AP11 and AP12.

라이게이션 산물을 비오틴이 표지된 SSR 탐침과 혼성화한 후 마그네틱 비드를 이용해 분리하였다. 이를 AP11 프라이머를 이용하여 PCR을 수행하여 증폭한 후 서열을 분석함으로써 기장의 초위성체를 포함하고 있는 500개의 DNA단편을 수득하였다.Ligation products were hybridized with biotin-labeled SSR probes and then separated using magnetic beads. PCR was carried out using AP11 primers to amplify and analyze the sequence to obtain 500 DNA fragments containing the supersatellite of millet.

상기에서 수득한 DNA단편을 분석함으로써 5개 이상의 반복 유닛을 포함하고 있는 단편만을 선발하고 반복 유닛을 포함하는 부분을 기준으로 초위성체를 증폭 할 수 있는 양방향 프라이머 200쌍을 디자인 하였다. 상기 프라이머쌍을 사용하여 다양한 재배형 기장 계통 및 품종들의 PCR을 통한 DNA 프로파일링을 수행함으로써 다형성 변이를 많이 나타내는 31쌍의 SSR 프라이머쌍을 선발하였다.By analyzing the DNA fragments obtained above, 200 pairs of bidirectional primers were designed to select only fragments containing five or more repeating units and to amplify the supersatellite based on the portion containing the repeating unit. Using the primer pairs, DNA profiling through PCR of various cultivated millet lines and varieties was used to select 31 pairs of SSR primer pairs exhibiting many polymorphic variations.

본 발명에서 제공하는 SSR 마커는 PCR 프라이머쌍을 말하며, 정방향 프라이머와 역방향 프라이머를 포함한다. 본 발명에서 제공되는 SSR 프라이머쌍은 서열번호 1 내지 서열번호 62로 이루어진 군에서 선택되는 2개의 염기서열을 가진다. 바람직하게는 GB-PaM-004(서열번호 1과 2로 표시되는 프라이머쌍), GB-PaM-013(서열번호 3과 4로 표시되는 프라이머쌍), GB-PaM-014(서열번호 5와 6으로 표시되는 프라이머쌍), GB-PaM-023(서열번호 7과 8로 표시되는 프라이머쌍), GB-PaM-025(서열번호 9와 10으로 표시되는 프라이머쌍), GB-PaM-029(서열번호 11과 12로 표시되는 프라이머쌍), GB-PaM-031(서열번호 13과 14로 표시되는 프라이머쌍), GB-PaM-060(서열번호 15와 16으로 표시되는 프라이머쌍), GB-PaM-061(서열번호 17과 18로 표시되는 프라이머쌍), GB-PaM-066(서열번호 19와 20으로 표시되는 프라이머쌍), GB-PaM-073(서열번호 21과 22로 표시되는 프라이머쌍), GB-PaM-083(서열번호 23과 24로 표시되는 프라이머쌍), GB-PaM-085(서열번호 25와 26으로 표시되는 프라이머쌍), GB-PaM-089(서열번호 27와 28으로 표시되는 프라이머쌍), GB-PaM-094(서열번호 29과 30로 표시되는 프라이머쌍), GB-PaM-096(서열번호 31와 32으로 표시되는 프라 이머쌍), GB-PaM-098(서열번호 33과 34로 표시되는 프라이머쌍), GB-PaM-102(서열번호 35과 36로 표시되는 프라이머쌍), GB-PaM-103(서열번호 37과 38로 표시되는 프라이머쌍), GB-PaM-106(서열번호 39과 40로 표시되는 프라이머쌍), GB-PaM-107(서열번호 41과 42로 표시되는 프라이머쌍), GB-PaM-111(서열번호 43과 44로 표시되는 프라이머쌍), GB-PaM-115(서열번호 45과 46로 표시되는 프라이머쌍), GB-PaM-116(서열번호 47과 48로 표시되는 프라이머쌍), GB-PaM-117(서열번호 49과 50로 표시되는 프라이머쌍), GB-PaM-119(서열번호 51과 52로 표시되는 프라이머쌍), GB-PaM-121(서열번호 53과 54로 표시되는 프라이머쌍), GB-PaM-126(서열번호 55과 56로 표시되는 프라이머쌍), GB-PaM-133(서열번호 57과 58로 표시되는 프라이머쌍), GB-PaM-134(서열번호 59과 60로 표시되는 프라이머쌍) 및 GB-PaM-145(서열번호 61과 62로 표시되는 프라이머쌍)로 이루어진 군에서 선택된다. 본 발명에서 제공되는 프라이머쌍 및 이들에 의해 증폭되는 초위성체에 존재하는 반복 모티브(repeat motif), 증폭되는 초위성체의 크기, Tm(℃) 및 초위성체가 존재하는 염색체 대립인자에 대한 정보를 하기 표 1에 기재하였다.The SSR marker provided by the present invention refers to a pair of PCR primers, and includes a forward primer and a reverse primer. SSR primer pair provided in the present invention has two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 62. Preferably GB-PaM-004 (primer pairs represented by SEQ ID NOs: 1 and 2), GB-PaM-013 (primer pairs represented by SEQ ID NOs: 3 and 4), GB-PaM-014 (SEQ ID NOs: 5 and 6) Primer pairs shown in the following figures), GB-PaM-023 (primary pairs shown in SEQ ID NOs: 7 and 8), GB-PaM-025 (primary pairs shown in SEQ ID NOs: 9 and 10), and GB-PaM-029 (SEQ ID NO: Primer pairs represented by numbers 11 and 12), GB-PaM-031 (primer pairs represented by SEQ ID NOs: 13 and 14), GB-PaM-060 (primer pairs represented by SEQ ID NOs: 15 and 16), GB-PaM -061 (primary pairs represented by SEQ ID NOs: 17 and 18), GB-PaM-066 (primary pairs represented by SEQ ID NOs: 19 and 20), GB-PaM-073 (primary pairs represented by SEQ ID NOs: 21 and 22) , GB-PaM-083 (primary pairs represented by SEQ ID NOs: 23 and 24), GB-PaM-085 (primary pairs represented by SEQ ID NOs: 25 and 26), GB-PaM-089 (denoted by SEQ ID NOs 27 and 28) Primer pair), GB-PaM-094 (SEQ ID NOs: 29 and 30) Primer pairs shown), GB-PaM-096 (primer pairs shown as SEQ ID NOs: 31 and 32), GB-PaM-098 (primer pairs shown as SEQ ID NOS: 33 and 34), GB-PaM-102 (SEQ ID NO: Primer pairs represented by numbers 35 and 36), GB-PaM-103 (primer pairs represented by SEQ ID NOs: 37 and 38), GB-PaM-106 (primer pairs represented by SEQ ID NOs: 39 and 40), GB-PaM -107 (primary pairs represented by SEQ ID NOs: 41 and 42), GB-PaM-111 (primary pairs represented by SEQ ID NOs: 43 and 44), and GB-PaM-115 (primary pairs represented by SEQ ID NOs: 45 and 46) , GB-PaM-116 (primary pairs represented by SEQ ID NOs: 47 and 48), GB-PaM-117 (primary pairs represented by SEQ ID NOs: 49 and 50), and GB-PaM-119 (SEQ ID NOs: 51 and 52) Primer pairs), GB-PaM-121 (primary pairs represented by SEQ ID NOs: 53 and 54), GB-PaM-126 (primary pairs represented by SEQ ID NOs: 55 and 56), GB-PaM-133 (SEQ ID NO: 57 And primer pair represented by 58), GB-PaM-134 (SEQ ID NO: 5 Primer pairs represented by 9 and 60) and GB-PaM-145 (primer pairs represented by SEQ ID NOs: 61 and 62). Information on the primer pairs provided in the present invention and the repeat motifs present in the supersatellites amplified by them, the size of the supersatellites to be amplified, the Tm (° C.) and the chromosomal alleles in which the supersatellites are present are given below. It is shown in Table 1.

본 발명의 SSR 프라이머쌍 및 이로부터 증폭되는 초위성체의 특성Characteristics of SSR Primer Pairs of the Present Invention and Supersatellites Amplified therefrom 프라이머명Primer Name 서열order 서열 번호Sequence number 반복모티브Repeating motif 증폭되는 초위성체의 크기의 범위(bp)Range of size of supersatellite to be amplified (bp) Tm(℃)Tm (℃) 대립인자의 수Number of alleles GB-PaM-004GB-PaM-004 F : GCAAGAGCGTGTGTGTGAF: GCAAGAGCGTGTGTGTGA 1One (AC)n(AG)n (AC) n (AG) n 201-205201-205 5555 33 R : TGGTGTCAGGAACATTAAGGAR: TGGTGTCAGGAACATTAAGGA 22 GB-PaM-013GB-PaM-013 F : AGGGGTAGGGCTGATGAAF: AGGGGTAGGGCTGATGAA 33 (ACG)n (ACG) n 234-264234-264 5555 44 R : ATAGTGATCGCGACCGTGR: ATAGTGATCGCGACCGTG 44 GB-PaM-014GB-PaM-014 F : GGGAGACGCAGTGTGGTAF: GGGAGACGCAGTGTGGTA 55 (ACG)n (ACG) n 278-302278-302 5555 33 R : TACAGGTCCTGCGTGAGGR: TACAGGTCCTGCGTGAGG 66 GB-PaM-023GB-PaM-023 F : GCTAGCTTGTTGTTGCCGF: GCTAGCTTGTTGTTGCCG 77 (AG)n (AG) n 206-230206-230 5555 66 R : GATGCGTACCGCTTGTGTR: GATGCGTACCGCTTGTGT 88 GB-PaM-025GB-PaM-025 F : CTTGTGCTGGGCTAGGTGF: CTTGTGCTGGGCTAGGTG 99 (AC)n (AC) n 189-193189-193 5555 33 R : AATGTGGTTGGCATTGGAR: AATGTGGTTGGCATTGGA 1010 GB-PaM-029GB-PaM-029 F : AGCTCCTGGCTCAGCTCTF: AGCTCCTGGCTCAGCTCT 1111 (ACG)n (ACG) n 189-213189-213 5353 22 R : CTTGCTGTCGTCGTCCTCR: CTTGCTGTCGTCGTCCTC 1212 GB-PaM-031GB-PaM-031 F : AAACGGGATCGGTGTAGCF: AAACGGGATCGGTGTAGC 1313 (AGC)n (AGC) n 174-180174-180 5555 22 R : AATGAGGCACTGACAGCCR: AATGAGGCACTGACAGCC 1414 GB-PaM-060GB-PaM-060 F : TCGTGACAGAGCGTCCTTF: TCGTGACAGAGCGTCCTT 1515 (ACTG)n (ACTG) n 181-189181-189 5555 22 R : TCGATCTCGGTCTGCTGTR: TCGATCTCGGTCTGCTGT 1616 GB-PaM-061GB-PaM-061 F : CTCCGCAGCAAGACATTTF: CTCCGCAGCAAGACATTT 1717 (AGG)n (AGG) n 289-292289-292 5555 22 R : TTTCGATCCGAGGAGGATR: TTTCGATCCGAGGAGGAT 1818 GB-PaM-066GB-PaM-066 F : TAATGCCAAACCAAGCGTF: TAATGCCAAACCAAGCGT 1919 (AGC)n (AGC) n 228-231228-231 5858 22 R : GGTACAAGTACAAGCCCGCR: GGTACAAGTACAAGCCCGC 2020 GB-PaM-073GB-PaM-073 F : GCTCTCACCGTCTGATCGF: GCTCTCACCGTCTGATCG 2121 (AG)n(ACGC)n (AG) n (ACGC) n 292-310292-310 5555 33 R : CGCATTCTCTTCCCCTTTR: CGCATTCTCTTCCCCTTT 2222 GB-PaM-083GB-PaM-083 F : TATAGGGTCGGATCGGCTF: TATAGGGTCGGATCGGCT 2323 (AAAG)n (AAAG) n 181-185181-185 5555 22 R : GTCTAGGCCCCACCTGTCR: GTCTAGGCCCCACCTGTC 2424 GB-PaM-085GB-PaM-085 F : CAGCCCATCACACTCGATF: CAGCCCATCACACTCGAT 2525 (AGG)n (AGG) n 236-262236-262 5555 66 R : CTTCTTCGTCGTCCCTCCR: CTTCTTCGTCGTCCCTCC 2626 GB-PaM-089GB-PaM-089 F : TTGCACACCTCTGCTCCTF: TTGCACACCTCTGCTCCT 2727 (ACC)n (ACC) n 266-269266-269 5555 22 R : GCCACCACCGCCATAR: GCCACCACCGCCATA 2828 GB-PaM-094GB-PaM-094 F : AAGAGCGAGGGCTAGCATF: AAGAGCGAGGGCTAGCAT 2929 (AT)n (AT) n 238-244238-244 5555 22 R : CGGCAGCAACTCATCAATR: CGGCAGCAACTCATCAAT 3030 GB-PaM-096GB-PaM-096 F : GGCCTATGGGCTTTTTGTF: GGCCTATGGGCTTTTTGT 3131 (CCG)n (CCG) n 185-188185-188 5555 22 R : GCGTTCGGAACAACTGAAR: GCGTTCGGAACAACTGAA 3232 GB-PaM-098GB-PaM-098 F : TGCCAGGCACTACACCATF: TGCCAGGCACTACACCAT 3333 (AGC)n (AGC) n 175-202175-202 5555 33 R : CATCTCTTCGCTGTCCCAR: CATCTCTTCGCTGTCCCA 3434 GB-PaM-102GB-PaM-102 F : ACGCGTCTGTACACGTCCF: ACGCGTCTGTACACGTCC 3535 (AC)n(ATCC)n (AC) n (ATCC) n 175-183175-183 5858 22 R : GCCTGCCATAACTCACCAR: GCCTGCCATAACTCACCA 3636 GB-PaM-103GB-PaM-103 F : ACGCGTCTGTACACGTCCF: ACGCGTCTGTACACGTCC 3737 (ACAG)n (ACAG) n 286-310286-310 5858 44 R : CACAGCTCACCTTCCGTCR: CACAGCTCACCTTCCGTC 3838 GB-PaM-106GB-PaM-106 F : AGCGAGAGGAAACAGCGTF: AGCGAGAGGAAACAGCGT 3939 (AG)n (AG) n 217-255217-255 5858 66 R : ATAGGCGTCGGAGATGGTR: ATAGGCGTCGGAGATGGT 4040 GB-PaM-107GB-PaM-107 F : CTCAGCTCGCCCCTTATTF: CTCAGCTCGCCCCTTATT 4141 (AG)n (AG) n 243-257243-257 5555 33 R : GCACCGGAATATGCAAGAR: GCACCGGAATATGCAAGA 4242 GB-PaM-111GB-PaM-111 F : GTTCGAGGCTGATGCAAGF: GTTCGAGGCTGATGCAAG 4343 (AG)n (AG) n 270-272270-272 5858 22 R : CGCATCACACGTCACATCR: CGCATCACACGTCACATC 4444 GB-PaM-115GB-PaM-115 F : GCACGTCACACTCACACGF: GCACGTCACACTCACACG 4545 (AG)n (AG) n 267-277267-277 5555 44 R : TGGGTGTATCAGGGCTTGR: TGGGTGTATCAGGGCTTG 4646 GB-PaM-116GB-PaM-116 F : CATCCGAAGCCTTACGCF: CATCCGAAGCCTTACGC 4747 (ACAT)n(AC)n (ACAT) n (AC) n 285-403285-403 5555 1111 R : CGTGGCGTCCAATCTTACR: CGTGGCGTCCAATCTTAC 4848 GB-PaM-117GB-PaM-117 F : GTGAGGGTGATCACGAGGF: GTGAGGGTGATCACGAGG 4949 (AG)n (AG) n 281-303281-303 5858 22 R : CCACGCCAAACTCAAATCR: CCACGCCAAACTCAAATC 5050 GB-PaM-119GB-PaM-119 F : TGTACTCCAAACACCATTTGCF: TGTACTCCAAACACCATTTGC 5151 (AG)n (AG) n 189-199189-199 5050 22 R : CTCGACGGGACAGAACAGR: CTCGACGGGACAGAACAG 5252 GB-PaM-121GB-PaM-121 F : GGACATACGCATGGTGGTF: GGACATACGCATGGTGGT 5353 (AT)n(ACAT)n (AT) n (ACAT) n 215-227215-227 5555 33 R : ACGATCGAATGAGCGAGAR: ACGATCGAATGAGCGAGA 5454 GB-PaM-126GB-PaM-126 F : CTTCCATAGGGTGCCTCCF: CTTCCATAGGGTGCCTCC 5555 (AG)n(AAG)n (AG) n (AAG) n 260-273260-273 5555 88 R : CATCGCAATTGGGAAAGAR: CATCGCAATTGGGAAAGA 5656 GB-PaM-133GB-PaM-133 F : TCTCAGTGCTTTACGCCGF: TCTCAGTGCTTTACGCCG 5757 (AGG)n (AGG) n 290-299290-299 5555 33 R : AGGAACCGGAACCACCTAR: AGGAACCGGAACCACCTA 5858 GB-PaM-134GB-PaM-134 F : CAGGCTCTGGCAAAGATGF: CAGGCTCTGGCAAAGATG 5959 (AG)n (AG) n 233-263233-263 5555 77 R : CAAGGTCAGGGGAACCATR: CAAGGTCAGGGGAACCAT 6060 GB-PaM-145GB-PaM-145 F : TCCAAGAGCAGCACGGF: TCCAAGAGCAGCACGG 6161 (AGC)n (AGC) n 189-198189-198 5555 22 R : AGACGTCGTGCCAAGAGAR: AGACGTCGTGCCAAGAGA 6262

F: 정방향 프라이머 R: 역방향 프라이머F: forward primer R: reverse primer

본 발명에서 제공되는 SSR 프라이머쌍은 기장에서 DNA 다형성을 검출하고 유전적 다양성을 분석하는데 유용하게 사용될 수 있다. 본 발명에 따른 SSR 프라이머를 이용하여 기장의 유전자원을 효율적으로 평가 및 보존할 수 있다. 따라서 본 발명은 상기 SSR 프라이머쌍을 이용하여 PCR을 수행하는 것을 포함하는 기장의 DNA 다형성 검출 방법을 제공한다. SSR primer pairs provided in the present invention can be usefully used for detecting DNA polymorphism in the field and analyzing genetic diversity. SSR primers according to the present invention can be used to efficiently evaluate and preserve the genetic resources of millet. Accordingly, the present invention provides a method for detecting DNA polymorphism of a millet comprising performing PCR using the SSR primer pair.

구체적으로 기장의 DNA 다형성 검출 방법은 Specifically, the method of detecting DNA polymorphism of millet

(a) 기장으로부터 게놈 DNA를 추출하는 단계; (a) extracting genomic DNA from the millet;

(b) 추출된 게놈 DNA를 주형으로 하고 본 발명에서 제공하는 SSR 프라이머쌍을 이용하여 PCR을 수행하는 단계; 및(b) performing PCR using the extracted genomic DNA as a template and the SSR primer pair provided by the present invention; And

(c) PCR 산물을 크기별로 분리하는 단계를 포함한다.(c) separating the PCR products by size.

상기 (a) 단계에서 게놈 DNA의 추출은 당업계에서 통상적으로 사용되는 페놀/클로로포름 추출법, SDS 추출법(Tai et al., Plant Mol . Biol . Reporter, 8: 297-303, 1990), CTAB 분리법(Cetyl Trimethyl Ammonium Bromide; Murray et al ., Nuc . Res ., 4321-4325, 1980) 또는 상업적으로 판매되는 DNA 추출 키트를 이용하여 수행할 수 있다. Extraction of genomic DNA in step (a) is phenol / chloroform extraction, SDS extraction (Tai et. al ., Plant Mol . Biol . Reporter , 8: 297-303, 1990), CTAB separation method (Cetyl Trimethyl Ammonium Bromide; Murray et al . , Nuc . Res . , 4321-4325, 1980) or commercially available DNA extraction kits.

또한 상기 (b) 단계에서 PCR은 PCR 반응에 필요한 당업계에 공지된 여러 성분을 포함하는 PCR 반응 혼합액을 이용하여 수행될 수 있다. 상기 PCR 반응 혼합액에는 분석하고자 하는 기장에서 추출된 게놈 DNA와 본 발명에서 제공되는 SSR 프라이머쌍 이외에 적당량의 DNA 중합효소, dNTP, PCR 완충용액 및 물(dH2O)을 포함한다. 상기 PCR 완충용액은 트리스-HCl(Tris-HCl), MgCl2, KCl 등을 포함한다. 이 때 MgCl2 농도는 증폭의 특이성과 수량에 크게 영향을 주며, 바람직하게는 1.5-2.5 mM의 범위로 사용될 수 있다. 일반적으로 Mg2 +가 과량인 경우는 비특이적인 PCR 증폭산물이 증가하고, Mg2 +가 부족한 경우 PCR 산물의 산출율이 감소한다. 상기 PCR 완충용액에는 적당량의 트리톤 X-100(Triton X-100)이 추가로 포함될 수도 있다. 또한 PCR은 94-95℃에서 주형 DNA를 전변성시킨 후, 변성(denaturation); 결합(annealing); 및 증폭(extension)의 사이클을 거친 후, 최종적으로 72℃에서 연장(elongation)시키는 일반적인 PCR 반응 조건에서 수행될 수 있다. 상기에서 변성 및 증폭은 94-95℃ 및 72℃에서 각각 수행될 수 있으며, 결합시의 온도는 프라이머의 종류에 따라 달라질 수 있다. 바람직하게는 52-57℃이며, 보다 바람직하게는 55℃이다. 각 단계의 시간과 싸이클 수는 당업계에 일반적으로 행해지는 조건에 따라 정해질 수 있다. 본 발명에 따른 SSR 프라이머쌍을 이용한 PCR 수행시의 최적의 반응 조건은 다음과 같다: 95℃에서 3분간 주형 DNA를 전변성시킨 후, 95℃에서 30초; 55℃에서 30초; 및 72℃에서 1분 30초를 36 싸이클 반복 수행한 후, 최종적으로 72℃에서 5분간 반응시킨다. In addition, the PCR in the step (b) may be performed using a PCR reaction mixture containing a variety of components known in the art required for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer and water (dH 2 O) in addition to genomic DNA extracted from the field to be analyzed and the SSR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl 2 , KCl, and the like. At this time, the MgCl 2 concentration greatly affects the specificity and yield of amplification, and may be preferably used in the range of 1.5-2.5 mM. In general, when Mg 2 + is insufficient if the excess is increased nonspecific PCR amplification products and, Mg 2 + PCR The yield of the product is reduced. The PCR buffer may further include an appropriate amount of Triton X-100. PCR also denatured the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. The denaturation and amplification may be performed at 94-95 ° C. and 72 ° C., respectively, and the temperature at the time of binding may vary depending on the type of primer. Preferably it is 52-57 degreeC, More preferably, it is 55 degreeC. The time and number of cycles in each step can be determined according to the conditions generally made in the art. The optimal reaction conditions when performing PCR using the SSR primer pair according to the present invention are as follows: After denature the template DNA for 3 minutes at 95 ℃, 30 seconds at 95 ℃; 30 seconds at 55 ° C .; And repeating 36 cycles of 1 minute 30 seconds at 72 ° C., and finally reacting at 72 ° C. for 5 minutes.

상기 (c) 단계에서는 당업계에서 널리 공지된 방법에 따라 PCR 산물의 DNA를 크기별로 분리할 수 있다. 바람직하게는 아가로스 겔(agarose gel) 또는 폴리아크릴아미드 겔(polyacrylamide gel) 전기영동 또는 형광분석장치(ABI prism 3100 genetic analyzer-electropherogram)에 의해 확인할 수 있다. 이 때, 형광분석장치를 이용하기 위해서는 당업계에 공지된 형광 다이(dye)를 붙인 프라이머쌍을 이용하여 상기 (b)단계에서 PCR을 수행한다. PCR 증폭 결과는 바람직하게는 폴리아크릴아미드 겔 전기영동, 보다 바람직하게는 변성 폴리아크릴아미드 겔 전기영동에 의해 확인할 수 있다. 전기영동 후 실버 염색(silver staining)으로 전기영동 결과를 분석할 수 있다. 일반적인 PCR 수행 및 그 결과 분석 방법에 대해서는 당업계에 잘 알려져 있다.In step (c), DNAs of PCR products may be separated according to sizes according to methods well known in the art. Preferably it can be confirmed by an agarose gel (agarose gel) or polyacrylamide gel electrophoresis or fluorescence analysis (ABI prism 3100 genetic analyzer-electropherogram). At this time, in order to use the fluorescence analyzer PCR is performed in the step (b) using a primer pair attached to a fluorescent die known in the art. PCR amplification results can be preferably confirmed by polyacrylamide gel electrophoresis, more preferably modified polyacrylamide gel electrophoresis. Electrophoresis results can be analyzed by silver staining after electrophoresis. General PCR performance and resulting analysis methods are well known in the art.

아울러, 본 발명은 상기 SSR 프라이머쌍을 이용하여 PCR을 수행하는 것을 포함하는 기장의 품종 동정 방법을 제공한다. In addition, the present invention provides a method for identifying a variety of millet, including performing PCR using the SSR primer pair.

구체적으로 기장의 품종 동정 방법은 Specifically, how to identify the variety of millet

(a) 기장 및 대조군 기장 품종으로부터 게놈 DNA를 추출하는 단계; (a) extracting genomic DNA from millet and control millet varieties;

(b) 추출된 각 게놈 DNA를 주형으로 하고 본 발명에서 제공하는 SSR 프라이머쌍을 이용하여 PCR을 수행하는 단계;(b) performing PCR using each of the extracted genomic DNA as a template and the SSR primer pair provided by the present invention;

(c) 각 PCR 산물을 크기별로 분리하는 단계; 및 (c) separating each PCR product by size; And

(d) 상기 (c) 단계의 각각의 크기별 분리 결과를 서로 비교하는 단계를 포함한다.(d) comparing the separation results for each size of step (c) with each other.

(a) 내지 (c) 단계의 게놈 DNA 추출, PCR 수행 및 PCR 산물의 크기별 분리는 상기에서 기재한 바와 같으며, 상기 (d) 단계에서 기장 및 대조군 기장 품종에 대한 비교는 동일한 조합의 SSR 프라이머쌍에 대한 시료가 되는 기장과 대조군 기장 품종의 각각의 PCR 산물의 크기를 서로 비교하는 방법으로 수행된다. 각 SSR 프라이머쌍에 대한 크기 비교 결과를 종합하여 시료가 되는 기장과 대조군 기장 품종의 결과와 모두 일치하면 시료가 되는 기장은 대조군 기장 품종과 동일한 품종으로 동정할 수 있다. 이와 같은 품종의 동정 방법은 신규 유전자원 도입시 중복여부 판단 및 원산지 확인을 통한 원산지 표시 위반 여부의 판정 등 품종의 동정이 필요한 경우에 유용하게 이용될 수 있다.Genomic DNA extraction, PCR execution and isolation of PCR products by size of steps (a) to (c) are as described above, and in step (d) the comparison of millet and control millet varieties is the same combination of SSR primers This is done by comparing the size of each PCR product of the millet and control millet varieties that are samples for the pair. If the size comparison results for each pair of SSR primer pairs are consistent with the results of both the sampled and the control millet varieties, the sampled millet can be identified as the same varieties as the control millet varieties. The identification method of the variety can be useful when the identification of the breed, such as judging whether there is a violation of the labeling of origin through judging whether the overlapping when introducing a new genetic resource and confirm the origin.

대조군 기장 품종에 대한 게놈 DNA 추출, PCR 수행 및 PCR 산물의 크기별 분리는 시료가 되는 기장과 동시에 수행될 수도 있으나, 시료가 되는 기장 보다 이전에 수행되어 동정의 기준표(reference)로 작성될 수도 있다. 이러한 기준표를 이용하면 시료가 되는 기장에 대한 게놈 DNA 추출, PCR 수행 및 PCR 산물의 크기별 분리만을 수행하여 기준표와 비교할 수 있어 유용하게 이용할 수 있다.Genomic DNA extraction, PCR, and size separation of PCR products for control millet varieties may be performed simultaneously with the sampled millet, but may be performed prior to the sampled millet and prepared as a reference for identification. Using this reference table can be useful because it can be compared with the reference table by performing genomic DNA extraction, PCR and separation of the size of the PCR product for the sample to be a sample.

또한 본 발명은 본 발명에 따른 SSR 프라이머쌍을 포함하는 기장의 DNA 다형성 검출용 키트를 제공한다. 이외에 PCR 반응을 용이하게 수행할 수 있기 위해 DNA 중합효소 및 상기에서 기재한 조성의 PCR 반응 완충용액이 추가로 포함될 수 있으며, PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성성분들이 본 발명의 키트에 추가로 포함될 수 있다. In another aspect, the present invention provides a kit for detecting DNA polymorphism of a millet comprising the SSR primer pair according to the present invention. In addition, DNA polymerase and a PCR reaction buffer of the above-described composition may be additionally included in order to easily perform a PCR reaction, and components necessary for performing electrophoresis to confirm amplification of a PCR product are present. It may be further included in the kit of the invention.

또한, 본 발명은 본 발명에 따른 SSR 프라이머쌍을 포함하는 기장의 품종 동정용 키트를 제공한다. 품종 동정 방법은 상기에서 기재한 바와 같다. 이외에 PCR 반응을 용이하게 수행할 수 있기 위해 DNA 중합효소 및 상기에서 기재한 조성의 PCR 반응 완충용액을 추가로 포함될 수 있으며, PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성성분 또는 공지된 품종에 대한 동정 기준표들이 본 발명의 키트에 추가로 포함될 수 있다. The present invention also provides a kit for identifying a variety of millet comprising the SSR primer pair according to the present invention. The breed identification method is as described above. In addition to the DNA polymerase and the PCR reaction buffer of the above-described composition in order to be able to easily perform the PCR reaction may be further included, the components or known to perform electrophoresis to confirm whether the PCR product amplification or not Identification criteria for selected varieties may be further included in the kits of the present invention.

본 발명에 적용될 수 있는 기장은 Panicum miliaceum L., Panicum miliaceum cv. aureum Alef, Panicum miliaceum cv . sanguineum Alef, Panicum miliaceum var . flavum Schur 및 이들의 변종일 수 있으며, 이에 제한되는 것은 아니다. 바람직하게는 Panicum miliaceum subsp . miliaceum 일 수 있다.The millet that can be applied to the present invention is Panicum miliaceum L., Panicum miliaceum cv. aureum Alef, Panicum miliaceum cv . sanguineum Alef, Panicum miliaceum var . flavum Schur and variations thereof, but are not limited to such. Preferably Panicum miliaceum subsp . miliaceum Can be.

이하, 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

<< 실시예Example 1>  1> 게놈 Genome DNADNA 추출 extraction

재배종 기장(농업생명공학연구원 유전자원과, 보존번호 : 103301)로부터 SDS를 이용한 방법(Tai et al., Plant Mol . Biol . Reporter, 8: 297-303, 1990)에 따라 게놈 DNA를 추출하였다. 이를 상세히 설명하면 다음과 같다. 생육 1개월째의 어린 기장 식물체로부터 0.5 g의 잎 조직을 채취하여 1.5 ㎖ 튜브에 넣고 액체질소로 급냉시켰다. 이후, 즉시 플라스틱 막대로 잎을 곱게 마쇄하였다. 마쇄된 잎이 녹기 전에 추출 완충용액(200 mM Tris-HCl (pH 8.0), 200 mM NaCl, 25 mM EDTA, 0.5% SDS) 750 ㎕를 첨가하고, 혼합액을 65℃에서 30분간 보관하였다. 여기에 동량의 페놀(phenol):클로로포름(chloroform):이소아밀알코올(isoamylalchol) (25:24:1) 용액을 추가로 첨가한 후, 약 15분간 교반하였다. 이를 13,000 rpm에서 15분간 원심분리하였다. 상등액을 취하여 새 튜브에 옮겼다. 상기 튜브에 동량의 이소프로판올(-20℃)을 첨가하고, -20℃에서 1시간 보관하였다. 이후, 13,000 rpm에서 15분간 원심분리하였다. 상등액을 버린 후 침전된 DNA를 70% 에탄올로 세척하였다. DNA를 건조시킨 후, 약 300 ㎕의 RNase (50 ㎍/㎖)를 함유하는 TE 완충용액(10 mM Tris-Cl, 1 mM EDTA, pH 7.4)을 첨가하여 충분히 녹인 후, 37℃에서 1시간동안 보관하였다. Method using SDS from cultivation millet (Dept. of Genetic Resources, Agricultural Biotechnology Research Institute, Conservation No .: 103301) (Tai et al ., Plant Mol . Biol . Genomic DNA was extracted according to Reporter , 8: 297-303, 1990). This will be described in detail as follows. 0.5 g of leaf tissues were taken from young millet plants at 1 month of growth and placed in a 1.5 ml tube and quenched with liquid nitrogen. The leaf was then ground finely with a plastic rod immediately. Before the ground leaves were dissolved, 750 μl of extraction buffer (200 mM Tris-HCl, pH 8.0), 200 mM NaCl, 25 mM EDTA, 0.5% SDS) was added and the mixture was stored at 65 ° C. for 30 minutes. An equivalent amount of a phenol (chloro): chloroform: isoamylalchol (25: 24: 1) solution was further added thereto, followed by stirring for about 15 minutes. It was centrifuged for 15 minutes at 13,000 rpm. The supernatant was taken and transferred to a new tube. Equal amount of isopropanol (-20 ° C.) was added to the tube and stored at −20 ° C. for 1 hour. Thereafter, the mixture was centrifuged at 13,000 rpm for 15 minutes. After discarding the supernatant, the precipitated DNA was washed with 70% ethanol. After the DNA was dried, it was sufficiently dissolved by adding TE buffer (10 mM Tris-Cl, 1 mM EDTA, pH 7.4) containing about 300 µl of RNase (50 µg / ml), followed by 1 hour at 37 ° C. Stored.

<< 실시예Example 2>  2> 어댑터와의 라이게이션(Ligation with adapters ( ligationligation ))

상기 실시예 1에서 얻은 게놈 DNA 500 ng을 각 제한효소 제조사의 지침에 따라 EcoRV, DraI, SmaI, PvuI, AluI, HaeIII 및 RsaI로 절단하였다. 절단된 DNA를 1.2% 아가로스 겔에 전기영동한 후, 약 300-1500 bp 크기의 DNA 단편만을 겔로부터 일루션(elution)하여 수득하였다. 이후, 수득된 DNA 단편을 2개의 어댑터(adapter; AP-11 및 AP-12, 각 50ng)와 T4 DNA 라이게이즈(ligase; Promega, 미국)를 이용하여 12℃에서 하룻밤 동안 라이게이션시켰다. 이 때 라이게이션 효율을 높이기 위해 AP-12 어댑터는 알칼라인 포스파타제(alkaline phosphatase, Promega, 미국)로 5’ 말단을 인산화하였으며, 라이게이션시의 반응용액의 조성은 다음과 같다: 1X 라이게이션 버퍼(Promega, 미국), 50ng AP11 어댑터, 50ng AP12 어댑터, 150ng DNA 단편, 3 Unit T4 라이게이즈(Promega, 미국).500 ng of genomic DNA obtained in Example 1 was digested with Eco RV, Dra I, Sma I, Pvu I, Alu I, Hae III and Rsa I according to the instructions of each restriction enzyme manufacturer. After cleaved DNA was electrophoresed in a 1.2% agarose gel, only DNA fragments of about 300-1500 bp size were obtained by elution from the gel. The DNA fragments obtained were then ligated overnight at 12 ° C. using two adapters (AP-11 and AP-12, 50 ng each) and a T4 DNA ligase (Promega, USA). To increase ligation efficiency, the AP-12 adapter phosphorylated the 5 'end with alkaline phosphatase (Promega, USA), and the composition of the reaction solution during ligation is as follows: 1X ligation buffer (Promega). , USA), 50 ng AP11 adapter, 50 ng AP12 adapter, 150 ng DNA fragment, 3 Unit T4 ligation (Promega, USA).

본 발명에서 사용한 어댑터Adapter used in the present invention 어댑터 명Adapter name 염기서열Sequence 서열번호SEQ ID NO: AP-11AP-11 5'-CTCTTGCTTAGATCTGGACTA-3'5'-CTCTTGCTTAGATCTGGACTA-3 ' 6363 AP-12AP-12 5'-TAGTCCAGATCTAAGCAAGAGCACA-3'5'-TAGTCCAGATCTAAGCAAGAGCACA-3 ' 6464

<< 실시예Example 3>  3> 초위성체를Supersatellite 포함하고 있는  Containing DNADNA 단편의 선발 및 분리 Selection and Separation of Fragments

<3-1> 마그네틱 비드 준비<3-1> Magnetic Bead Preparation

마그네틱 비드(magnetic bead; SA-PMPs, Promega, 미국; 1 mg/ml) 0.6 ml를 마그네틱 분리기(magnetic stand; Promega, 미국)로 수집한 후 용액을 제거하였다. 여기에 0.5x SSC(Saline-Sodium Citrate) 버퍼 0.6 ml를 넣어 세척을 하고 다시 마그네틱 분리기로 수집한 후 용액을 제거하였다. 0.5x SSC 버퍼를 이용한 세척은 3회 반복하여 실시하였다. 세척한 마그네틱 비드에 0.5x SSC 버퍼 100 ㎕를 넣은 후 30분이내에 사용하였다.The solution was removed after collecting 0.6 ml of magnetic beads (SA-PMPs, Promega, USA; 1 mg / ml) with a magnetic stand (Promega, USA). 0.6 ml of 0.5x Saline-Sodium Citrate (SSC) buffer was added thereto, washed, and collected again using a magnetic separator to remove the solution. Washing with 0.5 × SSC buffer was performed three times. 100 μl of 0.5 × SSC buffer was added to the washed magnetic beads and used within 30 minutes.

<3-2> 혼성화<3-2> hybridization

상기 실시예 2에서 제조한 라이게이션 산물에 증류수를 넣어 500 ㎕가 되도록 한 후 65℃에서 10분간 변성(denature)시켰다. 여기에 바로 비오틴(biotin)이 표지된 SSR 탐침 1.5 ㎕(20ng)와 20x SSC 버퍼 13 ㎕를 넣고 상온에서 10분간 방치하여 결합을 유도하였다. 혼성화에 사용된 8개의 SSR 탐침은 하기 표 3에 기재하였으며, SSR 탐침은 당업계에 공지된 통상의 방법에 따라 비오틴으로 표지하였다.Distilled water was added to the ligation product prepared in Example 2 to 500 μl, and then denatured at 65 ° C. for 10 minutes. Biotin-labeled SSR probe 1.5 μl (20ng) and 20 μl SSC buffer 13 μl were added thereto and left for 10 minutes at room temperature to induce binding. The eight SSR probes used for hybridization are listed in Table 3 below, and the SSR probes were labeled with biotin according to conventional methods known in the art.

기장의 초위성체를 분리하기 위한 탐침의 서열Sequence of probe for separating supersatellite of millet 서열order 서열번호SEQ ID NO: Biotin-(GA)20 Biotin- (GA) 20 6565 Biotin-(AT)20 Biotin- (AT) 20 6666 Biotin-(CA)20 Biotin- (CA) 20 6767 Biotin-(AGC)15 Biotin- (AGC) 15 6868 Biotin-(GGC)15 Biotin- (GGC) 15 6969 Biotin-(AAG)15 Biotin- (AAG) 15 7070 Biotin-(AAC)15 Biotin- (AAC) 15 7171 Biotin-(AGG)15 Biotin- (AGG) 15 7272

혼성화 반응을 통하여 게놈 DNA 단편 중 상기 반복염기서열을 가지고 있는 DNA 단편들은 비오틴이 표지된 SSR 탐침들과 상보적 결합을 할 것이고, 이를 SSR 탐침-템플릿(template) 혼성체(hybrid)라고 한다.Through hybridization reaction, DNA fragments having the repeat base sequence of genomic DNA fragments will complementarily bind to biotin-labeled SSR probes, which are called SSR probe-template hybrids.

<3-3> 템플릿의 분리<3-3> Separation of Template

<3-1>에서 제조한 마그네틱 비드 용액을 <3-2>에서의 SSR 탐침-템플릿 혼성체 용액에 넣고 상온에서 10분간 방치시킨다. 반응용액에서 마그네틱 분리기로 SSR 탐침-템플릿 혼성체가 결합된 마그네틱 비드를 수집하고 상등액을 제거하였다. 상기 SSR 탐침-템플릿 혼성체가 결합된 마그네틱 비드를 0.1x SSC 300 ㎕로 4회 세척한 후 증류수 50 ㎕를 넣고 90℃에서 5분간 가열하여 하기 템플릿을 분리하였다.The magnetic bead solution prepared in <3-1> was placed in the SSR probe-template hybrid solution in <3-2> and allowed to stand at room temperature for 10 minutes. Magnetic beads in which the SSR probe-template hybrid was bound were collected by using a magnetic separator in the reaction solution, and the supernatant was removed. The magnetic beads combined with the SSR probe-template hybrid were washed four times with 300 μl of 0.1 × SSC, and then 50 μl of distilled water was added and heated at 90 ° C. for 5 minutes to separate the template.

<3-4> PCR 반응<3-4> PCR reaction

<3-3>에서 분리한 템플릿에 대해 AP-11 어댑터를 프라이머로 이용하여 PCR 반응을 수행하였다. PCR 반응 혼합물(20㎕)의 조성은 다음과 같다: 250 ng 어댑터-라이게이션된 DNA, 10 pmol AP11 프라이머, 2 mM dNTP, 2 units Taq DNA 중합효소, 5 ㎕ 10× 완충용액. PCR 반응은 72℃에서 2분, 94℃에서 3분동안 가열한 후 94℃에서 30초; 56℃에서 30초; 및 72℃에서 1분을 24 싸이클(cycle)로 반복 수행하고, 마지막으로 72℃에서 10분의 조건으로 수행하였다.The PCR reaction was performed using the AP-11 adapter as a primer on the template isolated in <3-3>. The composition of the PCR reaction mixture (20 μl) is as follows: 250 ng adapter-ligated DNA, 10 pmol AP11 primer, 2 mM dNTP, 2 units Taq DNA polymerase, 5 μl 10 × buffer. PCR reactions were heated at 72 ° C. for 2 minutes, 94 ° C. for 3 minutes, and then at 94 ° C. for 30 seconds; 30 seconds at 56 ° C .; And 1 minute at 72 ° C. for 24 cycles, and finally at 72 ° C. for 10 minutes.

이와 같은 방법으로 본 발명에서는 초위성체를 함유하고 있는 500개의 DNA 단편을 분리하였다. In this manner, in the present invention, 500 DNA fragments containing supersatellites were isolated.

<< 실시예Example 4>  4> 분리된 Separated DNADNA 단편의 서열분석 및  Sequencing of fragments and 프라이머primer 디자인 design

상기 실시예 3에서 분리된 초위성체를 함유하고 있는 DNA 단편들을 pGEM T-easy vector 벡터(Promega, 미국)에 클로닝하여 이들의 서열을 분석하였다. 염기서열 분석은 (주)제노텍에 의뢰하여 수행하였다. 분석된 서열을 기초로 하여 5개 이상의 반복 유닛(repeat unit)을 포함하고 있는 단편만을 선발하였다. 반복 유닛을 포함하는 부분을 기준으로 하여 초위성체를 증폭할 수 있는 양 방향의 프라이머를 디자인하였다. 총 200쌍의 프라이머쌍을 디자인하였다(결과미도시).DNA fragments containing the supersatellite isolated in Example 3 were cloned into pGEM T-easy vector vector (Promega, USA) to analyze their sequence. Sequence analysis was performed by requesting from Genotech. Only fragments containing 5 or more repeat units were selected based on the analyzed sequences. Based on the part containing the repeating unit, a primer in both directions was designed to amplify the supersatellite. A total of 200 pairs of primer pairs were designed (results not shown).

<< 실시예Example 5>  5> SSRSSR 마커의Of marker 선발 Selection

상기 실시예 4에서 디자인된 프라이머쌍 중에서 다양한 기장 계통에서 다형성 변이를 많이 나타내는 SSR 프라이머 조합을 선발하기 위하여, 하기 표 4에 기재된 16점의 재배형 기장 또는 기장 품종에 대하여 PCR을 통한 DNA 프로파일링(profiling) 분석을 수행하였다. In order to select an SSR primer combination showing a lot of polymorphic variation in various length lines among the pair of primers designed in Example 4, DNA profiling through PCR for 16 points of the lengthened length or length varieties shown in Table 4 below ( profiling) analysis was performed.

SSR 분석에 사용된 기장Millet used for SSR analysis 기탁번호Deposit number 기탁기관Depositary Institution 수집국(원산지)Collection country (country of origin) 형(Type)Type 803701803701 농촌진흥청Rural Development Administration 카자흐스탄Kazakhstan Panicum miliaceum L. Panicum miliaceum L. 103301103301 농촌진흥청Rural Development Administration 대한민국Republic of Korea Panicum miliaceum L. Panicum miliaceum L. K029745K029745 농촌진흥청Rural Development Administration 북한North Korea Panicum miliaceum L. Panicum miliaceum L. 109455109455 농촌진흥청Rural Development Administration 네팔Nepal Panicum miliaceum L. Panicum miliaceum L. 124007124007 농촌진흥청Rural Development Administration 인도India Panicum miliaceum L. Panicum miliaceum L. 137674137674 농촌진흥청Rural Development Administration 태국Thailand Panicum miliaceum L. Panicum miliaceum L. 153555153555 농촌진흥청Rural Development Administration 러시아Russia Panicum miliaceum L. Panicum miliaceum L. 210157210157 농촌진흥청Rural Development Administration 대한민국Republic of Korea Panicum miliaceum L. Panicum miliaceum L. 194950194950 농촌진흥청Rural Development Administration 몽골Mongolia Panicum miliaceum L. Panicum miliaceum L. 197021197021 농촌진흥청Rural Development Administration 우크라이나Ukraine Panicum miliaceum L. Panicum miliaceum L. 199331199331 농촌진흥청Rural Development Administration 중국China Panicum miliaceum L. Panicum miliaceum L. 199346199346 농촌진흥청Rural Development Administration 프랑스France Panicum miliaceum L. Panicum miliaceum L. 199347199347 농촌진흥청Rural Development Administration 아제르바이잔Azerbaijan Panicum miliaceum L. Panicum miliaceum L. 199348199348 농촌진흥청Rural Development Administration 우즈베키스탄Uzbekistan Panicum miliaceum L. Panicum miliaceum L. 199349199349 농촌진흥청Rural Development Administration 타지키스탄Tajikistan Panicum miliaceum L. Panicum miliaceum L. 204269204269 농촌진흥청Rural Development Administration 볼리비아Bolivia Panicum miliaceum L. Panicum miliaceum L.

각각의 PCR 반응 혼합물 (20㎕)의 조성은 다음과 같다: 실시예 1의 방법에 의해 분리한 기장 주형 DNA 40ng, 정방향 프라이머 0.2μM, 역방향 프라이머 0.6μM, 형광물질이 표지된 M13 프라이머(TGTAAAACGACGGCCAGT, 서열번호 73) 0.6μM, 1X PCR 반응액 (10mM Tris-HCl (pH 8.8), 1.5mM MgCl2, 50mM KCl, 0.1% Triton X-100), 1 unit DNA 중합효소. PCR 반응은 94℃에서 3분간 주형 DNA를 전변성시킨 후, 94℃에서 30초; 각 프라이머의 Tm(표 1 참조)에 해당하는 온도에서 30초; 및 72℃에서 45초의 조건으로 35회 반복한 후, 다시 94℃에서 30초; 53℃에서 45초; 및 72℃에서 45초의 조건으로 15회 반복한 후, 마지막으로 72℃에서 15분의 조건으로 수행하였다. The composition of each PCR reaction mixture (20 μl) was as follows: 40 ng of the template template DNA isolated by the method of Example 1, 0.2 μM of forward primer, 0.6 μM of reverse primer, M13 primer labeled with fluorescent material (TGTAAAACGACGGCCAGT, SEQ ID NO: 73) 0.6 μM, 1 × PCR reaction solution (10 mM Tris-HCl, pH 8.8), 1.5 mM MgCl 2 , 50 mM KCl, 0.1% Triton X-100), 1 unit DNA polymerase. PCR reaction was performed after denaturing the template DNA for 3 minutes at 94 ℃, 30 seconds at 94 ℃; 30 seconds at the temperature corresponding to the Tm of each primer (see Table 1); And 35 repetitions under conditions of 45 seconds at 72 ° C., and then 30 seconds at 94 ° C .; 45 sec at 53 ° C .; And 15 repetitions at 45 ° C. for 45 seconds, and finally at 72 ° C. for 15 minutes.

각기 다른 형광물질로 증폭된 PCR 산물 단편의 크기를 분석하기 위해 자동 염기서열 분석 장치 (ABI 3100 Genetic Analyzer, Applied Biosystems, 미국)를 이용하였다. 분석을 위하여, PCR 산물 1.5㎕, Hi-di 포름아미드(formamide) 9.2㎕, 내부 크기 표준시약(Internal Size Standard; Genescan-500 ROX) 0.3㎕을 혼합한 후 94℃에서 3분간 변성하여 분석에 사용하였다.An automated sequencing device (ABI 3100 Genetic Analyzer, Applied Biosystems, USA) was used to analyze the size of PCR product fragments amplified with different fluorescent materials. For the analysis, 1.5 μl of PCR product, 9.2 μl of Hi-di formamide, and 0.3 μl of internal size standard (Genscan-500 ROX) were mixed and denatured at 94 ° C. for 3 minutes. It was.

그 결과, 국내 및 국외에서 수집된 기장 재배형 및 기장 품종들에서 다형성을 나타내는 SSR 프라이머쌍 31쌍을 확인하여 GB-PaM-004(서열번호 1과 2로 표시되는 프라이머쌍), GB-PaM-013(서열번호 3과 4로 표시되는 프라이머쌍), GB-PaM-014(서열번호 5와 6으로 표시되는 프라이머쌍), GB-PaM-023(서열번호 7과 8로 표시되는 프라이머쌍), GB-PaM-025(서열번호 9와 10으로 표시되는 프라이머쌍), GB-PaM-029(서열번호 11과 12로 표시되는 프라이머쌍), GB-PaM-031(서열번호 13과 14로 표시되는 프라이머쌍), GB-PaM-060(서열번호 15와 16으로 표시되는 프라이머쌍), GB-PaM-061(서열번호 17과 18로 표시되는 프라이머쌍), GB-PaM-066(서열번호 19와 20으로 표시되는 프라이머쌍), GB-PaM-073(서열번호 21과 22로 표시되는 프라이머쌍), GB-PaM-083(서열번호 23과 24로 표시되는 프라이머쌍), GB-PaM-085(서열번호 25와 26으로 표시되는 프라이머쌍), GB-PaM-089(서열번호 27와 28으로 표시되는 프라이머쌍), GB-PaM-094(서열번호 29과 30로 표시되는 프라이머쌍), GB-PaM-096(서열번호 31와 32으로 표시되는 프라이머쌍), GB-PaM-098(서열번호 33과 34로 표시되는 프라이머쌍), GB-PaM-102(서열번호 35과 36로 표시되는 프라이머쌍), GB-PaM-103(서열번호 37과 38로 표시되는 프라이머쌍), GB-PaM-106(서열번호 39과 40로 표시되는 프라이머쌍), GB-PaM-107(서열번호 41과 42로 표시되는 프라이머쌍), GB-PaM-111(서열번호 43과 44로 표시되는 프라이머쌍), GB-PaM-115(서열번호 45과 46로 표시되는 프라이머쌍), GB-PaM-116(서열번호 47과 48로 표시되는 프라이머쌍), GB-PaM-117(서열번호 49과 50로 표시되는 프라이머쌍), GB-PaM-119(서열번호 51과 52로 표시되는 프라이머쌍), GB-PaM-121(서열번호 53과 54로 표시되는 프라이머쌍), GB-PaM-126(서열번호 55과 56로 표시되는 프라이머쌍), GB-PaM-133(서열번호 57과 58로 표시되는 프라이머쌍), GB-PaM-134(서열번호 59과 60로 표시되는 프라이머쌍) 및 GB-PaM-145(서열번호 61과 62로 표시되는 프라이머쌍)을 선별하였다(표 1 참조). 상기 31쌍의 프라이머에 의해 증폭된 PCR 단편의 각각의 크기는 다음 표 5와 같다.As a result, we identified 31 pairs of SSR primer pairs showing polymorphisms in millet cultivars and millet varieties collected domestically and internationally, GB-PaM-004 (primer pairs represented by SEQ ID NOs: 1 and 2), GB-PaM- 013 (primary pairs represented by SEQ ID NOs: 3 and 4), GB-PaM-014 (primary pairs represented by SEQ ID NOs: 5 and 6), GB-PaM-023 (primer pairs represented by SEQ ID NOs: 7 and 8), GB-PaM-025 (primary pairs represented by SEQ ID NOs: 9 and 10), GB-PaM-029 (primary pairs represented by SEQ ID NOs: 11 and 12), and GB-PaM-031 (SEQ ID NOs: 13 and 14) Primer pairs), GB-PaM-060 (primary pairs represented by SEQ ID NOs: 15 and 16), GB-PaM-061 (primary pairs represented by SEQ ID NOs: 17 and 18), GB-PaM-066 (SEQ ID NOs: 19 and Primer pair represented by 20), GB-PaM-073 (primary pair represented by SEQ ID NOs: 21 and 22), GB-PaM-083 (primer pair represented by SEQ ID NOs: 23 and 24), GB-PaM-085 ( SEQ ID NOs: 25 and 26 Primer pairs represented by &quot;), GB-PaM-089 (primer pairs represented by SEQ ID NOs: 27 and 28), GB-PaM-094 (primer pairs represented by SEQ ID NOs: 29 and 30), and GB-PaM-096 (SEQ ID NO: Primer pairs represented by numbers 31 and 32), GB-PaM-098 (primer pairs represented by SEQ ID NOs: 33 and 34), GB-PaM-102 (primer pairs represented by SEQ ID NOs: 35 and 36), GB-PaM -103 (primary pairs represented by SEQ ID NOs: 37 and 38), GB-PaM-106 (primary pairs represented by SEQ ID NOs: 39 and 40), and GB-PaM-107 (primary pairs represented by SEQ ID NOs: 41 and 42) , GB-PaM-111 (primary pairs represented by SEQ ID NOs: 43 and 44), GB-PaM-115 (primary pairs represented by SEQ ID NOs: 45 and 46), and GB-PaM-116 (SEQ ID NOs: 47 and 48) Primer pairs), GB-PaM-117 (primary pairs represented by SEQ ID NOs: 49 and 50), GB-PaM-119 (primary pairs represented by SEQ ID NOs: 51 and 52), GB-PaM-121 (SEQ ID NO: 53 And primer pairs represented by 54), GB-PaM-126 (SEQ ID NO: Primer pairs represented by 55 and 56), GB-PaM-133 (primary pairs represented by SEQ ID NOs: 57 and 58), GB-PaM-134 (primer pairs represented by SEQ ID NOs: 59 and 60), and GB-PaM- 145 (primary pairs represented by SEQ ID NOs: 61 and 62) were selected (see Table 1). The size of each PCR fragment amplified by the 31 pairs of primers is shown in Table 5 below.

프라이머에 따른 증폭된 초위성체의 종류 및 크기(bp) (단위 : bp)Type and size (bp) of amplified supersatellites according to primers (unit: bp) 기탁번호 프라이머    Accession number primer 803701803701 103301103301 K029745K029745 109455109455 124007124007 137674137674 153555153555 210157210157 GB-PaM-004GB-PaM-004 203203 203203 -- 203203 203203 203203 203203 205205 GB-PaM-013GB-PaM-013 252252 252252 234234 252252 252252 252252 252252 252252 GB-PaM-014GB-PaM-014 287287 287287 287287 287287 287287 302302 287287 287287 GB-PaM-023GB-PaM-023 220220 222222 -- 206206 222222 222222 222222 218218 GB-PaM-025GB-PaM-025 191191 191191 -- 191191 191191 191191 191191 189189 GB-PaM-029GB-PaM-029 213213 213213 189189 213213 213213 213213 213213 213213 GB-PaM-031GB-PaM-031 180180 180180 174174 180180 180180 180180 180180 180180 GB-PaM-060GB-PaM-060 181181 181181 189189 181181 181181 181181 181181 181181 GB-PaM-061GB-PaM-061 289289 292292 -- 292292 289289 289289 289289 292292 GB-PaM-066GB-PaM-066 231231 231231 231231 231231 228228 231231 231231 231231 GB-PaM-073GB-PaM-073 -- 292292 -- 296296 310310 292292 -- 292292 GB-PaM-083GB-PaM-083 185185 185185 185185 185185 185185 185185 181181 181181 GB-PaM-085GB-PaM-085 262262 259259 -- 253253 253253 253253 236236 259259 GB-PaM-089GB-PaM-089 266266 266266 -- 269269 269269 266266 266266 269269 GB-PaM-094GB-PaM-094 238238 238238 244244 238238 238238 238238 238238 238238 GB-PaM-096GB-PaM-096 188188 188188 185185 188188 188188 188188 188188 188188 GB-PaM-098GB-PaM-098 202202 190190 175175 202202 202202 202202 202202 202202 GB-PaM-102GB-PaM-102 183183 175175 -- 183183 183183 183183 183183 183183 GB-PaM-103GB-PaM-103 286286 286286 310310 286286 286286 286286 286286 292292 GB-PaM-106GB-PaM-106 225225 235235 255255 235235 217217 235235 235235 -- GB-PaM-107GB-PaM-107 257257 255255 243243 255255 255255 255255 255255 255255 GB-PaM-111GB-PaM-111 270270 270270 272272 270270 270270 270270 270270 270270 GB-PaM-115GB-PaM-115 267267 273273 -- 275275 277277 275275 273273 275275 GB-PaM-116GB-PaM-116 403403 285285 -- 333333 333333 321321 399399 349349 GB-PaM-117GB-PaM-117 303303 303303 281281 303303 303303 303303 303303 303303 GB-PaM-119GB-PaM-119 189189 189189 199199 189189 189189 189189 189189 189189 GB-PaM-121GB-PaM-121 215215 219219 -- 215215 215215 215215 215215 219219 GB-PaM-126GB-PaM-126 271271 264264 -- 270270 268268 270270 271271 260260 GB-PaM-133GB-PaM-133 290290 290290 -- 290290 296296 290290 290290 290290 GB-PaM-134GB-PaM-134 259259 263263 -- 257257 259259 257257 259259 233233 GB-PaM-145GB-PaM-145 189189 189189 198198 189189 189189 189189 189189 189189

기탁번호 프라이머    Accession number primer 194950194950 197021197021 199331199331 199346199346 199347199347 199348199348 199349199349 204269204269 GB-PaM-004GB-PaM-004 203203 203203 201201 203203 203203 203203 203203 201201 GB-PaM-013GB-PaM-013 252252 252252 252252 252252 252252 243243 264264 252252 GB-PaM-014GB-PaM-014 287287 287287 287287 287287 287287 278278 287287 287287 GB-PaM-023GB-PaM-023 230230 224224 224224 222222 230230 230230 222222 230230 GB-PaM-025GB-PaM-025 191191 191191 191191 191191 193193 191191 191191 -- GB-PaM-029GB-PaM-029 213213 213213 213213 213213 213213 213213 213213 213213 GB-PaM-031GB-PaM-031 180180 180180 180180 180180 180180 180180 180180 180180 GB-PaM-060GB-PaM-060 181181 181181 181181 181181 181181 181181 -- 181181 GB-PaM-061GB-PaM-061 289289 289289 289289 289289 289289 289289 289289 289289 GB-PaM-066GB-PaM-066 231231 228228 231231 228228 231231 231231 231231 228228 GB-PaM-073GB-PaM-073 -- -- 296296 -- -- -- 292292 292292 GB-PaM-083GB-PaM-083 185185 185185 181181 181181 181181 181181 181181 185185 GB-PaM-085GB-PaM-085 256256 259259 259259 250250 256256 259259 250250 -- GB-PaM-089GB-PaM-089 269269 269269 269269 266266 269269 269269 266266 269269 GB-PaM-094GB-PaM-094 238238 238238 238238 238238 238238 238238 238238 238238 GB-PaM-096GB-PaM-096 188188 188188 188188 188188 188188 188188 188188 188188 GB-PaM-098GB-PaM-098 202202 202202 202202 202202 202202 202202 202202 202202 GB-PaM-102GB-PaM-102 183183 183183 183183 183183 183183 183183 183183 183183 GB-PaM-103GB-PaM-103 286286 290290 286286 286286 286286 290290 286286 286286 GB-PaM-106GB-PaM-106 235235 235235 235235 237237 235235 235235 235235 239239 GB-PaM-107GB-PaM-107 255255 255255 255255 255255 255255 255255 255255 255255 GB-PaM-111GB-PaM-111 -- 270270 270270 270270 270270 270270 270270 270270 GB-PaM-115GB-PaM-115 267267 275275 267267 267267 267267 275275 275275 275275 GB-PaM-116GB-PaM-116 333333 327327 317317 296296 291291 317317 367367 -- GB-PaM-117GB-PaM-117 303303 303303 303303 303303 303303 303303 303303 303303 GB-PaM-119GB-PaM-119 189189 189189 189189 189189 189189 189189 189189 189189 GB-PaM-121GB-PaM-121 215215 227227 215215 215215 227227 215215 215215 219219 GB-PaM-126GB-PaM-126 271271 271271 269269 -- 269269 269269 272272 273273 GB-PaM-133GB-PaM-133 290290 296296 290290 299299 299299 290290 290290 290290 GB-PaM-134GB-PaM-134 259259 259259 241241 259259 259259 261261 263263 249249 GB-PaM-145GB-PaM-145 189189 189189 189189 189189 189189 189189 189189 189189

상기 표 5에서와 같이 본원발명의 프라이머쌍에 의해 증폭된 SSR을 포함하는 부위의 크기가 16점의 기장샘플에서 다형성을 보였으며 이에 본원발명의 프라이머쌍에 의해 증폭된 부위에 위치하는 SSR은 다형성을 가짐을 알 수 있었다. 이 때 각각의 SSR의 반복모티프는 표 1에 기재된 바와 같으며 다형성을 보이는 대립인자 수 역시 표 1에 기재된 바와 같다. As shown in Table 5, the size of the site including the SSR amplified by the primer pair of the present invention showed polymorphism in the length 16 samples, and the SSR located at the site amplified by the primer pair of the present invention was polymorphic. It can be seen that. At this time, the repeat motif of each SSR is as shown in Table 1, and the number of alleles showing polymorphism is also as shown in Table 1.

이상 살펴본 바와 같이, 본 발명에서는 기장에서 처음으로 SSR 마커를 개발하였다. 본 발명에서 제공되는 SSR 프라이머쌍은 기장의 DNA 다형성을 효과적으로 검출하여 기장의 DNA 프로파일을 작성하는데 매우 유용하게 이용될 수 있다. 이를 통해 기장의 유전자원을 효율적으로 평가함으로써 신규 유전자원 도입시 기존 보유자원과의 중복성 분석 및 신규성 확립을 효과적으로 수행할 수 있으며, 기장의 품종을 판별할 수 있다. As described above, in the present invention, the SSR marker was first developed in the millet. SSR primer pairs provided in the present invention can be very useful for effectively detecting the DNA polymorphism of the millet to prepare the DNA profile of the millet. Through the efficient evaluation of the genetic resources of millet, it is possible to effectively conduct redundancy analysis and establishment of novelty with existing resources when introducing new genetic resources, and to identify the variety of millet.

서열목록 전자파일 첨부 Attach sequence list electronic file

Claims (7)

서열번호 1 내지 서열번호 62로 이루어진 군에서 선택되는 2개의 염기서열을 갖는 SSR(simple sequence repeat) 프라이머쌍.Simple sequence repeat (SSR) primer pair having two nucleotide sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 62. 제1항에 있어서, 서열번호 1과 2로 표시되는 프라이머쌍; 서열번호 3과 4로 표시되는 프라이머쌍; 서열번호 5와 6으로 표시되는 프라이머쌍; 서열번호 7과 8로 표시되는 프라이머쌍; 서열번호 9와 10으로 표시되는 프라이머쌍; 서열번호 11과 12로 표시되는 프라이머쌍; 서열번호 13과 14로 표시되는 프라이머쌍; 서열번호 15와 16으로 표시되는 프라이머쌍; 서열번호 17과 18로 표시되는 프라이머쌍; 서열번호 19와 20으로 표시되는 프라이머쌍; 서열번호 21과 22로 표시되는 프라이머쌍; 서열번호 23과 24로 표시되는 프라이머쌍; 서열번호 25와 26으로 표시되는 프라이머쌍; 서열번호 27과 28로 표시되는 프라이머쌍; 서열번호 29와 30으로 표시되는 프라이머쌍; 서열번호 31와 32으로 표시되는 프라이머쌍; 서열번호 33와 34으로 표시되는 프라이머쌍; 서열번호 35와 36으로 표시되는 프라이머쌍; 서열번호 37와 38으로 표시되는 프라이머쌍; 서열번호 39와 40으로 표시되는 프라이머쌍; 서열번호 41와 42으로 표시되는 프라이머쌍; 서열번호 43와 44으로 표시되는 프라이머쌍; 서열번호 45와 46으로 표시되는 프라이머쌍; 서열번호 47와 48으로 표시되는 프라이머쌍; 서열번호 49와 50으로 표시되는 프라이머쌍;서열번호 51과 52로 표시되는 프라이머쌍; 서열번호 53와 54으로 표시되는 프라이머쌍; 서열번호 55와 56으로 표시되는 프라이머쌍; 서열번호 57와 58으로 표시되는 프라이머쌍; 서열번호 59와 60으로 표시되는 프라이머쌍; 및 서열번호 61과 62로 표시되는 프라이머쌍으로 이루어진 군에서 선택되는 SSR 프라이머쌍.The method of claim 1, wherein the primer pair represented by SEQ ID NO: 1 and 2; Primer pairs represented by SEQ ID NOs: 3 and 4; Primer pairs represented by SEQ ID NOs: 5 and 6; Primer pairs represented by SEQ ID NOs: 7 and 8; Primer pairs represented by SEQ ID NOs: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12; Primer pairs represented by SEQ ID NOs: 13 and 14; Primer pairs represented by SEQ ID NOs: 15 and 16; Primer pairs represented by SEQ ID NOs: 17 and 18; Primer pairs represented by SEQ ID NOs: 19 and 20; Primer pairs represented by SEQ ID NOs: 21 and 22; Primer pairs represented by SEQ ID NOs: 23 and 24; Primer pairs represented by SEQ ID NOs: 25 and 26; Primer pairs represented by SEQ ID NOs: 27 and 28; Primer pairs represented by SEQ ID NOs: 29 and 30; Primer pairs represented by SEQ ID NOs: 31 and 32; Primer pairs represented by SEQ ID NOs: 33 and 34; Primer pairs represented by SEQ ID NOs: 35 and 36; Primer pairs represented by SEQ ID NOs: 37 and 38; Primer pairs represented by SEQ ID NOs: 39 and 40; Primer pairs represented by SEQ ID NOs: 41 and 42; Primer pairs represented by SEQ ID NOs: 43 and 44; Primer pairs represented by SEQ ID NOs: 45 and 46; Primer pairs represented by SEQ ID NOs: 47 and 48; Primer pairs represented by SEQ ID NOs: 49 and 50; primer pairs represented by SEQ ID NOs: 51 and 52; Primer pairs represented by SEQ ID NOs: 53 and 54; Primer pairs represented by SEQ ID NOs: 55 and 56; Primer pairs represented by SEQ ID NOs: 57 and 58; Primer pairs represented by SEQ ID NOs: 59 and 60; And an SSR primer pair selected from the group consisting of primer pairs represented by SEQ ID NOs: 61 and 62. 제1항 또는 제2항에 있어서, 기장(Panicum miliaceum L.)으로부터 유래된 것을 특징으로 하는 SSR 프라이머쌍.The panicum of claim 1, wherein the panicum miliaceum L.) SSR primer pair, characterized in that from. (a) 기장으로부터 게놈 DNA를 추출하는 단계; (a) extracting genomic DNA from the millet; (b) 추출된 게놈 DNA를 주형으로 하고 제1항 또는 제2항의 SSR 프라이머쌍을 이용하여 PCR을 수행하는 단계; 및(b) using the extracted genomic DNA as a template and performing PCR using the SSR primer pair of claim 1; And (c) PCR 산물을 크기별로 분리하는 단계를 포함하는 기장의 DNA 다형성 검출 방법.(C) method for detecting DNA polymorphism of the millet comprising the step of separating the PCR product by size. (a) 기장 및 대조군 기장 품종으로부터 게놈 DNA를 추출하는 단계; (a) extracting genomic DNA from millet and control millet varieties; (b) 추출된 각 게놈 DNA를 주형으로 하고 제1항 또는 제2항의 SSR 프라이머쌍을 이용하여 PCR을 수행하는 단계;(b) performing PCR using each of the extracted genomic DNA as a template and the SSR primer pair of claim 1; (c) 각 PCR 산물을 크기별로 분리하는 단계; 및(c) separating each PCR product by size; And (d) 상기 기장 및 대조군 기장 품종의 크기별 분리 결과를 비교하는 단계를 포함하는 기장의 품종 동정 방법.(d) Method of identifying the variety of millet comprising the step of comparing the separation results by size of the millet and control millet varieties. 제1항 또는 제2항의 SSR 프라이머쌍을 포함하는 기장의 DNA 다형성 검출용 키트. A kit for detecting DNA polymorphism of a millet comprising the SSR primer pair of claim 1. 제1항 또는 제2항의 SSR 프라이머쌍을 포함하는 기장의 품종 동정용 키트.A kit for identifying varieties of millet comprising the SSR primer pair of claim 1.
KR1020060094920A 2006-09-28 2006-09-28 Ssr primer derived from common millet and use thereof KR100769367B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020060094920A KR100769367B1 (en) 2006-09-28 2006-09-28 Ssr primer derived from common millet and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020060094920A KR100769367B1 (en) 2006-09-28 2006-09-28 Ssr primer derived from common millet and use thereof

Publications (1)

Publication Number Publication Date
KR100769367B1 true KR100769367B1 (en) 2007-10-31

Family

ID=38815553

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020060094920A KR100769367B1 (en) 2006-09-28 2006-09-28 Ssr primer derived from common millet and use thereof

Country Status (1)

Country Link
KR (1) KR100769367B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107815508A (en) * 2017-12-05 2018-03-20 山西农业大学 Five bases for detecting broomcorn millet heredity of drought resistance difference repeat motif molecular labeling
CN107841572A (en) * 2017-12-05 2018-03-27 山西农业大学 Five bases for detecting broomcorn millet salt tolerance hereditary difference repeat motif molecular labeling

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050024321A (en) * 2002-06-10 2005-03-10 가부시키가이샤 쇼쿠부츠 게놈 센터 Method of distinguishing rice varieties

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050024321A (en) * 2002-06-10 2005-03-10 가부시키가이샤 쇼쿠부츠 게놈 센터 Method of distinguishing rice varieties

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Theor Appl Genet 105:1124-1136 (2002)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107815508A (en) * 2017-12-05 2018-03-20 山西农业大学 Five bases for detecting broomcorn millet heredity of drought resistance difference repeat motif molecular labeling
CN107841572A (en) * 2017-12-05 2018-03-27 山西农业大学 Five bases for detecting broomcorn millet salt tolerance hereditary difference repeat motif molecular labeling

Similar Documents

Publication Publication Date Title
Hu et al. Target region amplification polymorphism: a novel marker technique for plant genotyping
KR100781205B1 (en) SSR primer isolated from Perilla spp. and use thereof
KR100781206B1 (en) SSR primer isolated from Sesamum sp. and use thereof
KR101183987B1 (en) SSR primer derived from Actinidia arguta and use thereof
KR100645445B1 (en) Method for producing a marker for detecting polymorphism in a plant
KR100769366B1 (en) Ssr primer derived from mungbean and use thereof
KR100996968B1 (en) SSR primer derived from Oyster Mushroom and use of there
KR100842434B1 (en) Ssr primer derived from ginseng and use thereof
KR100842432B1 (en) Ssr primer derived from mandarin and use thereof
KR101271367B1 (en) SSR primer isolated from Lilum spp. and use thereof
KR101269311B1 (en) SSR primer derived from Cymbidium spp. and use thereof
KR101650986B1 (en) Universal primer set for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR100769367B1 (en) Ssr primer derived from common millet and use thereof
KR100842429B1 (en) Ssr primer derived from lawn grass and use thereof
KR101006079B1 (en) SSR primer derived from Garlic and use of there
KR101183996B1 (en) SSR primer derived from Buckwheat and use thereof
KR20140106815A (en) Universal primer set COS0566 for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR101695051B1 (en) Universal primer set COS0842 for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR100842430B1 (en) Ssr primer derived from japanese apricot and use thereof
KR101236316B1 (en) SSR primer and kits derived from Acanthopanax senticosus, and use of there
KR100769368B1 (en) Ssr primer derived from italian millet and use thereof
KR20100079527A (en) Ssr primer derived from azuki-bean and use thereof
KR100842446B1 (en) Ssr primer derived from ginger and use thereof
KR101183991B1 (en) SSR primer derived from Chinese matrimony vine and use thereof
KR100803392B1 (en) Ssr primer derived from job&#39;s tears and use thereof

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant