KR100842430B1 - Ssr primer derived from japanese apricot and use thereof - Google Patents

Abstract

An SSR(simple sequence repeat) primer pair is provided to detect DNA polymorphism from Japanese Apricot and being usefully used to analyze genetic diversity, thereby efficiently evaluating and preserving genetic sources of the Japanese Apricot. An SSR primer pair comprises two sequences selected from the group consisting of SEQ ID : NOs. 1 to 60 and is derived from Japanese Apricot(Prunus mume S. et Z.). A method for detecting DNA polymorphism of the Japanese Apricot comprises the steps of: (a) extracting genome DNA from the lawn grass; (b) subjecting the extracted genome DNA as a template to PCR using the SSR primer pair; and (c) isolating PCR products obtained from the step(b) by size. A method for identifying species of the Japanese Apricot comprises the steps of: (a) extracting genome DNA from the Japanese Apricot and a control group Japanese Apricot species, respectively; (b) subjecting each of the extracted genome DNA to PCR using the SSR primer pair; (c) isolating each of PCR products obtained from the step(b) by size; and (d) comparing isolation results by the size of the Japanese Apricot with that of the control group.

Description

SSR primer derived from Japanese Apricot and use thereof}

The present invention is Japanese Apricot ( Prunus) SSR primer isolated from mume S. et Z.) and its use, more specifically SSR primer pair having two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 50 and PCR using the same It relates to a method for detecting DNA polymorphism of plum comprising performing.

Large quantities of genetic resources are collected annually in most major crops and cultivated crops used for breeding. However, on the other hand, the evaluation of genetic resources has not been sufficiently made. Rapid discrimination between species and subspecies varieties of collected genetic resources is very important for accurate management and protection of genetic resources. In addition to the identification of varieties, the identification and classification of trait traits and genetic relationships of genetic resources are very important for the conservation of genetic resources, the creation of new varieties, and the improvement of crops.

Recent rapid advances in molecular biology have led to the development of nucleic acid fingerprint analysis methods and various DNA markers that enable bio-diversity studies at the nucleic acid (DNA) level. This makes it possible to search useful traits, identify species of species, classify and identify varieties, and analyze flexible relationships of populations in a simple and quick manner with little influence on the external environment. Fingerprinting methods using polymerase chain reaction (PCR) developed so far include randomly amplified polymorphic DNAs (RAPD), amplified fragment length polymorphic DNA (AFLP), and simple sequence repeat (SSR). The RAPD method has a disadvantage of poor reproducibility because the non-specific PCR product is amplified, and the AFLP method is spotlighted by high DNA polymorphism detection, but has a disadvantage of complicated appearance and analysis of a low reproducible band. In contrast, the SSR method is a method of constructing a PCR primer based on nucleotide sequence information of a microsatellite region, which is a DNA repeat sequence. Frequently used. In particular, the SSR method has the advantage that it is not affected by the external environment at all. Due to the superiority of this SSR method, studies are underway to develop SSR markers in several major crops and cultivated crops.

In rice, supersatellite markers have been developed that amplify SSR repeated in the rice genome by PCR technology to identify genotypes of rice varieties (Korean Patent Application No. 2001-34003). Tang's team in the United States developed 879 SSR markers and published a genetic map of sunflowers (Tang et al., Theor. Appl. Genet ., 105: 1124-1136, 2002). In addition, many SSR markers have been developed in barley and soybeans. However, in plum, SSR markers have not been developed in Korea at all, and there is little research related to this in foreign countries.

Accordingly, the present inventors have completed the present invention by developing SSR primer pairs showing a large number of polymorphic variations in various plum lineages while researching to develop an SSR marker capable of efficiently evaluating the gene source of plum.

It is therefore an object of the present invention to provide an SSR marker and its use capable of efficiently evaluating the genetic resources of plum.

In order to achieve the above object, the present invention provides an SSR primer pair having two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 50.

In order to achieve the another object of the present invention, the present invention provides a method for detecting DNA polymorphism of the plum and a method for identifying the variety of the plum, including performing PCR using the SSR primer pair.

In order to achieve another object of the present invention, the present invention provides a kit for detecting the DNA polymorphism of the plum and kit for identifying the variety of the plum containing the SSR primer pair, DNA polymerase and PCR reaction buffer.

Hereinafter, the present invention will be described in detail.

The present invention is characterized by providing an SSR marker capable of specifically analyzing the genetic polymorphism of plum.

In the present invention, SSR markers were developed from plums by biotin-streptavidin capture (Dixit et al., Mol. Eco.Note, 5: 736-738). SSR markers isolated from plum are the first to be provided by the present invention.

Specifically, the SSR marker of the present invention was developed by the following method. Genomic DNA extracted from plum was treated with restriction enzymes to prepare DNA fragments and then ligated with two adapters of AP11 and AP12.

Ligation products were hybridized with biotin-labeled SSR probes and then separated using magnetic beads. PCR was performed using AP11 primers to amplify and analyze the sequence, thereby obtaining 500 DNA fragments containing the supersatellite of plum.

By analyzing the DNA fragments obtained above, 200 pairs of bidirectional primers were designed to select only fragments containing five or more repeating units and to amplify the supersatellite based on the portion containing the repeating unit. By using the primer pairs to perform DNA profiling through PCR of various cultivated plum lines and varieties, 25 pairs of SSR primer pairs showing a large number of polymorphic mutations were selected.

The SSR marker provided by the present invention refers to a pair of PCR primers, and includes a forward primer and a reverse primer. SSR primer pair provided in the present invention has two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 50. Preferably GB-PrM-003 (primer pairs represented by SEQ ID NOs: 1 and 2), GB-PrM-004 (primer pairs represented by SEQ ID NOs: 3 and 4), GB-PrM-013 (SEQ ID NOs: 5 and 6) Primer pairs shown in the table), GB-PrM-028 (primary pairs shown in SEQ ID NOs: 7 and 8), GB-PrM-034 (primary pairs shown in SEQ ID NOs: 9 and 10), and GB-PrM-041 (SEQ ID NO: Primer pairs represented by numbers 11 and 12), GB-PrM-047 (primary pairs represented by SEQ ID NOs: 13 and 14), GB-PrM-060 (primer pairs represented by SEQ ID NOs: 15 and 16), GB-PrM 063 (primary pairs represented by SEQ ID NOs: 17 and 18), GB-PrM-079 (primary pairs represented by SEQ ID NOs: 19 and 20), GB-PrM-087 (primary pairs represented by SEQ ID NOs: 21 and 22) , GB-PrM-094 (primary pairs represented by SEQ ID NOs: 23 and 24), GB-PrM-104 (primary pairs represented by SEQ ID NOs: 25 and 26), GB-PrM-107 (denoted by SEQ ID NOs 27 and 28) Primer pair), GB-PrM-111 (SEQ ID NOs. 29 and 3) Primer pair represented by 0), GB-PrM-112 (primary pair represented by SEQ ID NOs: 31 and 32), GB-PrM-143 (primary pair represented by SEQ ID NOs: 33 and 34), GB-PrM-147 ( Primer pairs represented by SEQ ID NOs: 35 and 36), GB-PrM-150 (primer pairs represented by SEQ ID NOs: 37 and 38), GB-PrM-161 (primer pairs represented by SEQ ID NOs: 39 and 40), GB- PrM-167 (primary pairs represented by SEQ ID NOs: 41 and 42), GB-PrM-169 (primary pairs represented by SEQ ID NOs: 43 and 44), and GB-PrM-170 (primary pairs represented by SEQ ID NOs: 45 and 46) ), GB-PrM-173 (primer pairs represented by SEQ ID NOs: 47 and 48) and GB-PrM-181 (primer pairs represented by SEQ ID NOs: 49 and 50). Information on the primer pairs provided in the present invention and the repeat motifs present in the supersatellites amplified by them, the size of the supersatellites to be amplified, T _m (° C.) and the chromosomal alleles in which the supersatellites are present It is listed in Table 1 below.

Characteristics of SSR Primer Pairs of the Present Invention and Supersatellites Amplified therefrom Primer Name order Sequence number Repeating motif Range of size of supersatellite to be amplified (bp) Tm (℃) Number of alleles GB-PrM-003 F: AAGGAGTTGCTGCTGCTG One (TTG) ₃ (CTTCTG) (TTG) ₂ (GCT) (TTG) ₃ 227-289 52 2 R: GCATCTTCTGGCCCTCTT 2 GB-PrM-004 F: CGACGAAGGAGATCGTTG 3 (AG) ₁₇ 194-232 52 10 R: AACCAATTCCGGTTGGTC 4 GB-PrM-013 F: GCGTCACCTCCATCAAAA 5 (TTC) ₈ , (TCTT) ₃ 286-355 52 5 R: TACTGTCTTGGCACCGCT 6 GB-PrM-028 F: TCGATGGTGGTTTTGGTC 7 (GAG) ₂ (GAA) (GAG) ₄ 173-176 52 2 R: ATATCCTCTGCAACCGCA 8 GB-PrM-034 F: TTGATGGAGTTTAACTGAGTTTG 9 (TGG) ₄ (TGA) (TGG) 177-252 52 3 R: ACCACCACTACCATCCCC 10 GB-PrM-041 F: GCAAAAACCCAGCAACCT 11 (CT) ₁₅ 190-212 52 7 R: GCCTTGGAGCCTTCGTAT 12 GB-PrM-047 F: GTTGTCGCGAAGCAGAGT 13 (GA) ₄ (TT) (GA) ₁₂ 233-255 52 5 R: ACCGGGAAGAAATTTGGA 14 GB-PrM-060 F: TAAGCAGTATCCCCGCAA 15 (GCA) ₄ (ATA) (GCA) (ACA) (GCA) ₅ 192-222 52 4 R: CTGAGCGACACCGAACAT 16 GB-PrM-063 F: AACCTGCACAAGAAGCCA 17 (TA) ₈ , (TG) ₁₀ 188-218 52 8 R: AAAAGCCAAAAAGATTTCCA 18 GB-PrM-079 F: TTTCGCTGCAATGTAGGC 19 (GGAGGT) ₄ 151-157 52 2 R: CTGCAACAACCAACAGCA 20 GB-PrM-087 F: AAAGCCTGCTGGAGAACC 21 (CGC) ₃ (GGA) (CGC) ₂ 167-176 52 2 R: GAGTCGCTATCGCTGTCG 22 GB-PrM-094 F: GGTCAAGCGCAACTTTTG 23 (GA) ₁₀ (GG) (GA) (G) (GA) ₃ 222-256 52 7 R: CAGTCCCCCTCCTCCTCT 24 GB-PrM-104 F: GGCACAACATACCAGCGT 25 (CA) ₁₁ 162-174 52 5 R: AGACTTTGGGCCAGCTTC 26 GB-PrM-107 F: TAGGAGCATTGCCTTCCA 27 (TG) ₂₇ 252-302 52 7 R: GATCAGCAGATATAGTGTTGAGAA 28 GB-PrM-111 F: CTTCGTCCACGTAAACCG 29 (CT) ₈ (A) (CT) 156-172 52 5 R: CCAATCAAACCCCACCTT 30 GB-PrM-112 F: TGTTTCCGGCATCAAAAC 31 (GTT) ₇ , (GGC) ₄ 292-307 52 4 R: TGTGCCAAATCCGAACTC 32 GB-PrM-143 F: CGAGCAGGTACTTCACGG 33 (AG) ₁₇ 181-207 52 7 R: CGGCTACTTCAGGCACAG 34 GB-PrM-147 F: TAGGGCAAGGATTCTCCG 35 (TCC) ₃ (GCC) (TCC) ₂ 209-218 52 2 R: TCCTTCCCTTCATCCGTT 36 GB-PrM-150 F: CCAATTCCTCCATCACCA 37 (CAA) ₆ 183-189 52 3 R: GGCCGCCGTACTAGAGTT 38 GB-PrM-161 F: ACCGTACCTCGATCCCAT 39 (CT) ₁₀ 273-303 52 9 R: TAGAAAGCCGAACCAGCA 40 GB-PrM-167 F: GTTGCTTTTCTTGCGGTG 41 (CGGTGG) (TGGCGG) (CGGTGG) ₃ 147-165 52 4 R: CGACGGCACCAGAACTAC 42 GB-PrM-169 F: GTCCACCCGTGATGAAGA 43 (GAT) ₃ (GCT) (GAT) ₂ , (GAC) ₇ , (AGA) ₄ (GTA) (AGA) 259-277 52 5 R: TTAGCTCGGCTTGCTCAG 44 GB-PrM-170 F: GTAGAGCACGGCGAGATG 45 (TC) ₂₇ (CC) (TC) ₂ , (CA) ₁₀ 206-262 52 12 R: GGGACATTATCGGGGAGA 46 GB-PrM-173 F: GGCTCGAATCCGAGTTGT 47 (CT) ₁₄ 161-167 52 3 R: CCGTCGTTGCTATGCTTC 48 GB-PrM-181 F: AAGTTGTTAGAGGGGCGG 49 (TC) ₁₇ (CC) (TC) 203-253 52 6 R: TCCCAGACACACCTAGCG 50

^a F: forward primer ^b R: reverse primer

SSR primer pairs provided in the present invention can be usefully used to detect DNA polymorphism and analyze genetic diversity in plum. The SSR primer according to the present invention can be used to efficiently evaluate and preserve the genetic resources of plum. Therefore, the present invention provides a method for detecting DNA polymorphism of plum, including performing PCR using the SSR primer pair.

Specifically, the method for detecting DNA polymorphism of plum

(a) extracting genomic DNA from plums;

(b) performing PCR using the extracted genomic DNA as a template and the SSR primer pair provided by the present invention; And

(c) separating the PCR products by size.

Extraction of genomic DNA in step (a) is performed by phenol / chloroform extraction, SDS extraction (Tai et al ., Plant Mol. Biol. Reporter , 8: 297-303, 1990), CTAB separation method commonly used in the art ( Cetyl Trimethyl Ammonium Bromide; Murray et al. , Nuc. Res. , 4321-4325, 1980) or commercially available DNA extraction kits.

In addition, the PCR in the step (b) may be performed using a PCR reaction mixture containing a variety of components known in the art required for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer and water (dH ₂ O) in addition to genomic DNA extracted from the plum to be analyzed and the SSR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the MgCl ₂ concentration greatly affects the specificity and yield of amplification, and may be preferably used in the range of 1.5-2.5 mM. In general, when Mg ²⁺ is excessive, nonspecific PCR amplification products increase, and when Mg ²⁺ is insufficient, PCR The yield of the product is reduced. The PCR buffer may further include an appropriate amount of Triton X-100. PCR also denatured the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. The denaturation and amplification may be performed at 94-95 ° C. and 72 ° C., respectively, and the temperature at the time of binding may vary depending on the type of primer. Preferably it is 52-57 degreeC, More preferably, it is 55 degreeC. The time and number of cycles in each step can be determined according to the conditions generally made in the art. The optimal reaction conditions when performing PCR using the SSR primer pair according to the present invention are as follows: After denature the template DNA for 3 minutes at 95 ℃, 30 seconds at 95 ℃; 30 seconds at 55 ° C .; And repeating 36 cycles of 1 minute 30 seconds at 72 ° C., and finally reacting at 72 ° C. for 5 minutes.

In step (c), DNAs of PCR products may be separated according to sizes according to methods well known in the art. Preferably it can be confirmed by an agarose gel (agarose gel) or polyacrylamide gel electrophoresis or fluorescence analysis (ABI prism 3100 genetic analyzer-electropherogram). At this time, in order to use the fluorescence analyzer PCR is performed in the step (b) using a primer pair attached to a fluorescent die known in the art. PCR amplification results can be preferably confirmed by polyacrylamide gel electrophoresis, more preferably modified polyacrylamide gel electrophoresis. Electrophoresis results can be analyzed by silver staining after electrophoresis. General PCR performance and resulting analysis methods are well known in the art.

In addition, the present invention provides a method for identifying varieties of plum, including performing PCR using the SSR primer pair.

Specifically, how to identify varieties of plum

(a) extracting genomic DNA from plum and control plum varieties;

(b) performing PCR using each of the extracted genomic DNA as a template and the SSR primer pair provided by the present invention;

(c) separating each PCR product by size; And

(d) comparing the separation results for each size of step (c) with each other.

Genomic DNA extraction, PCR, and size separation of PCR products in steps (a) to (c) are as described above, and in step (d) comparisons of plum and control plum varieties are in the same combination of SSR primers. This is done by comparing the size of each PCR product of the plum and control plum varieties to be a sample for the pair. By comparing the results of the size comparison for each SSR primer pair, if both the plum and the control plum varieties match the results, the sample plum can be identified as the same varieties as the control plum varieties. The identification method of the variety can be useful when the identification of the breed, such as judging whether there is a violation of the labeling of origin through judging whether the overlapping when introducing a new genetic resource and confirm the origin.

Genomic DNA extraction, PCR, and size separation of PCR products for control plum varieties may be performed concurrently with the sampled plum, but may be performed before the sampled plum and prepared as a reference for identification. Using such a reference table can be useful because it can be compared with the reference table by performing genomic DNA extraction, PCR and separation of the size of the PCR product for the plum to be a sample.

In another aspect, the present invention provides a kit for detecting the DNA polymorphism of the plum containing the SSR primer pair according to the present invention. In addition, DNA polymerase and a PCR reaction buffer of the above-described composition may be additionally included in order to easily perform a PCR reaction, and components necessary for performing electrophoresis to confirm amplification of a PCR product are present. It may be further included in the kit of the invention.

The present invention also provides a kit for identifying a variety of plums comprising the SSR primer pair according to the present invention. The breed identification method is as described above. In addition to the DNA polymerase and the PCR reaction buffer of the above-described composition in order to be able to easily perform the PCR reaction may be further included, the components or known to perform electrophoresis to confirm whether the PCR product amplification or not Identification criteria for selected varieties may be further included in the kits of the present invention.

Plums that can be applied to the present invention are Prunuss mume Siebold & Zucc and variants thereof, but is not limited thereto. Preferably Prunuss It can be mume Siebold & Zucc.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1> Genome DNA  extraction

Genomic DNA was extracted from the cultivar Maesil (Department of Agricultural Biotechnology Research Institute, Accession No. 8) according to the method using SDS (Tai et al ., Plant Mol. Biol. Reporter , 8: 297-303, 1990). This will be described in detail as follows. 0.5 g of leaf tissues were taken from the young plum plants at 1 month of growth and placed in a 1.5 ml tube and quenched with liquid nitrogen. The leaf was then ground finely with a plastic rod immediately. Before the ground leaves were dissolved, 750 μl of extraction buffer (200 mM Tris-HCl, pH 8.0), 200 mM NaCl, 25 mM EDTA, 0.5% SDS) was added and the mixture was stored at 65 ° C. for 30 minutes. An equivalent amount of a phenol (chloro): chloroform: isoamylalchol (25: 24: 1) solution was further added thereto, followed by stirring for about 15 minutes. It was centrifuged for 15 minutes at 13,000 rpm. The supernatant was taken and transferred to a new tube. Equal amount of isopropanol (-20 ° C.) was added to the tube and stored at −20 ° C. for 1 hour. Thereafter, the mixture was centrifuged at 13,000 rpm for 15 minutes. After discarding the supernatant, the precipitated DNA was washed with 70% ethanol. After the DNA was dried, it was sufficiently dissolved by adding TE buffer (10 mM Tris-Cl, 1 mM EDTA, pH 7.4) containing about 300 µl of RNase (50 µg / ml), followed by 1 hour at 37 ° C. Stored.

< Example  2> Ligation with adapters ( ligation )

500 ng of genomic DNA obtained in Example 1 was digested with Eco RV, Dra I, Sma I, Pvu I, Alu I, Hae III and Rsa I according to the instructions of each restriction enzyme manufacturer. After cleaved DNA was electrophoresed in a 1.2% agarose gel, only DNA fragments of about 300-1500 bp size were obtained by elution from the gel. The DNA fragments obtained were then ligated overnight at 12 ° C. using two adapters (AP-11 and AP-12, 50 ng each) and a T4 DNA ligase (Promega, USA). To increase ligation efficiency, the AP-12 adapter phosphorylated the 5 'end with alkaline phosphatase (Promega, USA), and the composition of the reaction solution during ligation is as follows: 1X ligation buffer (Promega). , USA), 50 ng AP11 adapter, 50 ng AP12 adapter, 150 ng DNA fragment, 3 Unit T4 ligation (Promega, USA).

Adapter used in the present invention Adapter name Sequence SEQ ID NO: AP-11 5'-CTCTTGCTTAGATCTGGACTA-3 ' 51 AP-12 5'-TAGTCCAGATCTAAGCAAGAGCACA-3 ' 52

< Example  3> Supersatellite  Containing DNA  Selection and Separation of Fragments

<3-1> Magnetic Bead Preparation

The solution was removed after collecting 0.6 ml of magnetic beads (SA-PMPs, Promega, USA; 1 mg / ml) with a magnetic stand (Promega, USA). 0.6 ml of 0.5x Saline-Sodium Citrate (SSC) buffer was added thereto, washed, and collected again using a magnetic separator to remove the solution. Washing with 0.5 × SSC buffer was performed three times. 100 μl of 0.5 × SSC buffer was added to the washed magnetic beads and used within 30 minutes.

<3-2> hybridization

Distilled water was added to the ligation product prepared in Example 2 to 500 μl, and then denatured at 65 ° C. for 10 minutes. Biotin-labeled SSR probe 1.5 μl (20ng) and 20 μl SSC buffer 13 μl were added thereto and left for 10 minutes at room temperature to induce binding. The eight SSR probes used for hybridization are listed in Table 3 below, and the SSR probes were labeled with biotin according to conventional methods known in the art.

Sequence of probe for the separation of supersatellites of plum order SEQ ID NO: Biotin- (GA) ₂₀ 53 Biotin- (AT) ₂₀ 54 Biotin- (CA) ₂₀ 55 Biotin- (AGC) ₁₅ 56 Biotin- (GGC) ₁₅ 57 Biotin- (AAG) ₁₅ 58 Biotin- (AAC) ₁₅ 59 Biotin- (AGG) ₁₅ 60

Through hybridization reaction, DNA fragments having the repeat base sequence of genomic DNA fragments will complementarily bind to biotin-labeled SSR probes, which are called SSR probe-template hybrids.

<3-3> Separation of Template

The magnetic bead solution prepared in <3-1> was placed in the SSR probe-template hybrid solution in <3-2> and allowed to stand at room temperature for 10 minutes. Magnetic beads in which the SSR probe-template hybrid was bound were collected by using a magnetic separator in the reaction solution, and the supernatant was removed. The magnetic beads combined with the SSR probe-template hybrid were washed four times with 300 μl of 0.1 × SSC, and then 50 μl of distilled water was added and heated at 90 ° C. for 5 minutes to separate the template.

<3-4> PCR reaction

The PCR reaction was performed using the AP-11 adapter as a primer on the template isolated in <3-3>. The composition of the PCR reaction mixture (20 μl) is as follows: 250 ng adapter-ligated DNA, 10 pmol AP11 primer, 2 mM dNTP, 2 units Taq DNA polymerase, 5 μl 10 × buffer. PCR reactions were heated at 72 ° C. for 2 minutes, 94 ° C. for 3 minutes, and then at 94 ° C. for 30 seconds; 30 seconds at 56 ° C .; And 1 minute at 72 ° C. for 24 cycles, and finally at 72 ° C. for 10 minutes.

In this manner, in the present invention, 500 DNA fragments containing supersatellites were isolated.

< Example  4> Separated DNA  Sequencing of fragments and primer  design

DNA fragments containing the supersatellite isolated in Example 3 were cloned into pGEM T-easy vector vector (Promega, USA) to analyze their sequence. Sequence analysis was performed by requesting from Genotech. Only fragments containing 5 or more repeat units were selected based on the analyzed sequences. Based on the part containing the repeating unit, a primer in both directions was designed to amplify the supersatellite. A total of 200 pairs of primer pairs were designed (results not shown).

< Example  5> SSR Of marker  Selection

In order to select an SSR primer combination showing a large number of polymorphic variation in various plum lineages among the primer pairs designed in Example 4, DNA profiling through PCR for 16-point redistributed plum or plum varieties shown in Table 4 below ( profiling) analysis was performed.

Plums used for SSR analysis Deposit number Depositary Institution Collection country (country of origin) Type 8 Rural Development Administration Republic of Korea Prunus spp 9 Rural Development Administration Republic of Korea Prunus spp 15 Rural Development Administration Republic of Korea Prunus spp 21 Rural Development Administration Republic of Korea Prunus spp 23 Rural Development Administration Republic of Korea Prunus spp 26 Rural Development Administration Republic of Korea Prunus spp 29 Rural Development Administration Republic of Korea Prunus spp 30 Rural Development Administration Republic of Korea Prunus spp 39 Rural Development Administration Republic of Korea Prunus spp 43 Rural Development Administration Republic of Korea Prunus spp 51 Rural Development Administration Republic of Korea Prunus spp 64 Rural Development Administration Republic of Korea Prunus spp 67 Rural Development Administration Republic of Korea Prunus spp 76 Rural Development Administration Republic of Korea Prunus spp 77 Rural Development Administration Republic of Korea Prunus spp 78 Rural Development Administration Republic of Korea Prunus spp

The composition of each PCR reaction mixture (20 μl) was as follows: 40ng of plum template DNA isolated by the method of Example 1, 0.2 μM forward primer, 0.6 μM reverse primer, M13 primer labeled with fluorescent material (TGTAAAACGACGGCCAGT, SEQ ID NO: 61) 0.6 μM, 1 × PCR reaction solution (10 mM Tris-HCl, pH 8.8), 1.5 mM MgCl ₂ , 50 mM KCl, 0.1% Triton X-100), 1 unit DNA polymerase. PCR reaction was performed after denaturing the template DNA for 3 minutes at 94 ℃, 30 seconds at 94 ℃; 30 seconds at the temperature corresponding to the T _m of each primer (see Table 1); And 35 repetitions under conditions of 45 seconds at 72 ° C., and then 30 seconds at 94 ° C .; 45 sec at 53 ° C .; And 15 repetitions at 45 ° C. for 45 seconds, and finally at 72 ° C. for 15 minutes.

An automated sequencing device (ABI 3100 Genetic Analyzer, Applied Biosystems, USA) was used to analyze the size of PCR product fragments amplified with different fluorescent materials. For the analysis, 1.5 μl of PCR product, 9.2 μl of Hi-di formamide, and 0.3 μl of internal size standard (Genscan-500 ROX) were mixed and denatured at 94 ° C. for 3 minutes. It was.

As a result, we identified 25 pairs of SSR primer pairs showing polymorphism in domestic and foreign plum cultivars and plum varieties, GB-PrM-003 (primer pairs represented by SEQ ID NOs: 1 and 2), GB-PrM- 004 (primary pairs represented by SEQ ID NOs: 3 and 4), GB-PrM-013 (primary pairs represented by SEQ ID NOs: 5 and 6), GB-PrM-028 (primary pairs represented by SEQ ID NOs: 7 and 8), GB-PrM-034 (primary pairs represented by SEQ ID NOs: 9 and 10), GB-PrM-041 (primary pairs represented by SEQ ID NOs: 11 and 12), and GB-PrM-047 (SEQ ID NOs: 13 and 14) Primer pairs), GB-PrM-060 (primary pairs represented by SEQ ID NOs: 15 and 16), GB-PrM-063 (primary pairs represented by SEQ ID NOs: 17 and 18), GB-PrM-079 (SEQ ID NOs: 19 and Primer pair represented by 20), GB-PrM-087 (primary pair represented by SEQ ID NOs: 21 and 22), GB-PrM-094 (primer pair represented by SEQ ID NOs: 23 and 24), GB-PrM-104 ( SEQ ID NOs: 25 and 26 Primer pairs represented by &quot;), GB-PrM-107 (primary pairs represented by SEQ ID NOs: 27 and 28), GB-PrM-111 (primer pairs represented by SEQ ID NOs: 29 and 30), and GB-PrM-112 (SEQ ID NO: Primer pairs represented by numbers 31 and 32), GB-PrM-143 (primary pairs represented by SEQ ID NOs: 33 and 34), GB-PrM-147 (primary pairs represented by SEQ ID NOs: 35 and 36), GB-PrM -150 (primary pairs represented by SEQ ID NOs: 37 and 38), GB-PrM-161 (primary pairs represented by SEQ ID NOs: 39 and 40), and GB-PrM-167 (primary pairs represented by SEQ ID NOs: 41 and 42) , GB-PrM-169 (primary pairs represented by SEQ ID NOs: 43 and 44), GB-PrM-170 (primary pairs represented by SEQ ID NOs: 45 and 46), GB-PrM-173 (denoted SEQ ID NOs: 47 and 48) Primer pairs) and GB-PrM-181 (primary pairs represented by SEQ ID NOs: 49 and 50) were selected (see Table 1). The size of each PCR fragment amplified by the 25 pairs of primers is shown in Table 5 below.

Type and size of amplified supersatellites according to primers (unit: bp) 8 9 15 21 23 26 29 30 GB-PrM-003 277 277 277 277 277 277 277 277 GB-PrM-004 210 208/210 210/218 194/210 208/218 194/222 222 212/218 GB-PrM-013 289/292 289 286/289 289 286/289 346/355 289 289 GB-PrM-028 173 173 173 173 173 173 173 173 GB-PrM-034 177/252 252 177/252 177/246 177/252 177/246 177/252 177/252 GB-PrM-041 198 198 198 198 196/198 198 206 198 GB-PrM-047 245 243 243/253 253 243/255 243 243 243 GB-PrM-060 195/204 204 195/204 195/204 204 204 204 204 GB-PrM-063 188 190 188 188/190 190 216 188/190 190 GB-PrM-079 151/157 151/157 151/157 157 157 157 151/157 157 GB-PrM-087 167/176 167/176 167/176 167/176 176 167/176 167/176 167/176 GB-PrM-094 222/244 222 244 250 246 250 238/256 246/250 GB-PrM-104 174 162/174 174 174 174 162 162 162/174 GB-PrM-107 252/260 252 252/294 252 252 294 260 252/260 GB-PrM-111 156 156 156/166 158 156/166 158 158 156/158 GB-PrM-112 301/304 301 301 301 301 301 301 301 GB-PrM-143 185/195 185/189 185 189 187 189/195 181/187 181/185 GB-PrM-147 209 209 209 209 209 209 209 209 GB-PrM-150 186 186/189 186 186/189 186 186/189 186 186 GB-PrM-161 285 291/301 285/291 281/299 281/291 281 275/303 275/281 GB-PrM-167 147/159 147 147/159 147/159 147/159 147/159 147/159 147/159 GB-PrM-169 259/277 259/277 271 259/271 271 259 259/277 259/271 GB-PrM-170 240/258 224 206 256/258 228 238/240 238/240 228/254 GB-PrM-173 161 161 161 161 161/167 161 161/163 161 GB-PrM-181 243/251 211/251 241/253 251 243/253 251 251 243/251

39 43 51 64 67 76 77 78 GB-PrM-003 277 277 277/289 277 277 277 277/289 277/289 GB-PrM-004 218/222 210/224 210/232 208/210 208 208/210 198/218 194/206 GB-PrM-013 286/289 289/292 289 289 289 289 286 286 GB-PrM-028 173 173 173 173 173 173 173/176 176 GB-PrM-034 177/252 177/252 252 177/246 246 252 177/252 177/246 GB-PrM-041 198 206 212 198 198 198/200 210 190/212 GB-PrM-047 243/253 245 243/253 243 243/255 243 243/255 233/243 GB-PrM-060 204 204 204 204/222 204 204 192/204 192 GB-PrM-063 216/218 188/202 190 210 188/190 190/208 200/216 200/210 GB-PrM-079 157 151/157 151/157 157 157 157 151 151 GB-PrM-087 176 167/176 167/176 176 167/176 167/176 167 167 GB-PrM-094 246 222/250 246 222/248 250 250 246 246/250 GB-PrM-104 172 174 170/174 162/174 162/174 164/174 164/174 164 GB-PrM-107 252/302 252/284 252 252 252/260 252 252/254 262 GB-PrM-111 158/166 156/158 158/172 156/158 156 156/158 166/170 170/172 GB-PrM-112 301 301 292/301 301 301 301 292/301 292/307 GB-PrM-143 185/187 185/195 187/207 185/187 185/195 185/187 187/195 183/187 GB-PrM-147 209 209 209/218 209 209 209 209/218 209 GB-PrM-150 186 186 183/186 186/189 186 186 183/186 183 GB-PrM-161 281/285 281/285 281 275/279 279/301 279 285/291 273 GB-PrM-167 147/159 147/159 147/159 159/165 147/159 147/159 153/159 153/159 GB-PrM-169 259/271 259/277 259/265 259/271 277 259 259/265 265/268 GB-PrM-170 228/238 238/240 240 222 234/262 242 228/238 228/238 GB-PrM-173 161/167 161/163 161 161 161/163 161 161 161 GB-PrM-181 253 243 203/251 251 251 251 203 203

As described above, in the present invention, the first SSR marker was developed in plum. The SSR primer pair provided in the present invention can be very useful for effectively detecting the DNA polymorphism of the plum and preparing the DNA profile of the plum. In this way, by efficiently evaluating the genetic resources of the plum, it is possible to effectively perform redundancy analysis and establishment of novelty with existing resources when introducing new genetic resources, and to identify varieties of plum.

Attach sequence list electronic file  

Claims (7)

Simple sequence repeat (SSR) primer pair having two nucleotide sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 50. The method of claim 1, wherein the primer pair represented by SEQ ID NO: 1 and 2; Primer pairs represented by SEQ ID NOs: 3 and 4; Primer pairs represented by SEQ ID NOs: 5 and 6; Primer pairs represented by SEQ ID NOs: 7 and 8; Primer pairs represented by SEQ ID NOs: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12; Primer pairs represented by SEQ ID NOs: 13 and 14; Primer pairs represented by SEQ ID NOs: 15 and 16; Primer pairs represented by SEQ ID NOs: 17 and 18; Primer pairs represented by SEQ ID NOs: 19 and 20; Primer pairs represented by SEQ ID NOs: 21 and 22; Primer pairs represented by SEQ ID NOs: 23 and 24; Primer pairs represented by SEQ ID NOs: 25 and 26; Primer pairs represented by SEQ ID NOs: 27 and 28; Primer pairs represented by SEQ ID NOs: 29 and 30; Primer pairs represented by SEQ ID NOs: 31 and 32; Primer pairs represented by SEQ ID NOs: 33 and 34; Primer pairs represented by SEQ ID NOs: 35 and 36; Primer pairs represented by SEQ ID NOs: 37 and 38; Primer pairs represented by SEQ ID NOs: 39 and 40; Primer pairs represented by SEQ ID NOs: 41 and 42; Primer pairs represented by SEQ ID NOs: 43 and 44; Primer pairs represented by SEQ ID NOs: 45 and 46; Primer pairs represented by SEQ ID NOs: 47 and 48; And an SSR primer pair selected from the group consisting of SEQ ID NOs: 49 and 50. The SSR primer pair according to claim 1 or 2, which is derived from Japanese Apricot ( Prunus mume S. et Z.). (a) extracting genomic DNA from plums; (b) using the extracted genomic DNA as a template and performing PCR using the SSR primer pair of claim 1; And (C) method for detecting the DNA polymorphism of the plum comprising the step of separating the PCR product by size. (a) extracting genomic DNA from plum and control plum varieties; (b) performing PCR using each of the extracted genomic DNA as a template and the SSR primer pair of claim 1; (c) separating each PCR product by size; And (d) a method of identifying varieties of plum comprising the step of comparing the results of the separation by size of the plum and control plum varieties. A kit for detecting DNA polymorphism of a plum comprising the SSR primer pair of claim 1. A kit for identifying a variety of plums comprising the SSR primer pair of claim 1.