KR101989983B1 - Microsatellite Marker For Identification of Korean Native Chicken And Method For Identification Using The Same - Google Patents

Abstract

The present invention relates to a supersatellite marker for identifying an individual of a native chicken and a method for identifying an individual of a native chicken using the same. More particularly, the present invention relates to a marker of an ultra- The present invention relates to a method for identifying an individual of a conventional chicken including amplifying the amplified product with a multiplex PCR using a supersatellite marker set consisting of MCW0145 and MCW0330 and determining the genotype using the amplified product.
According to the present invention, more precise object identification results can be provided due to super satellites markers having higher individual discrimination than those used in the prior art. More specifically, the 12 kinds of satellites second marker of the invention are the same object appearance probability of a random mating population in 2.88 × 10 ^-21, half the breeding population hyeongmae 1.72 × 10 ^{- 15,} for the native chickens are bred in the country There is no possibility of occurrence of the same individual, so that it can be usefully used for identification of a native chicken. Therefore, it can be used as a means to prevent cheating by easily discriminating origin or route of chicken in the distribution process of traditional chicken, and it can be used as a means to increase the reliability of the consumer for the traditional chicken, .

Description

TECHNICAL FIELD The present invention relates to a method for identifying an individual of a domestic chicken,

TECHNICAL FIELD The present invention relates to a supersatellite marker for identifying an individual of a native chicken and a method for identifying an individual of a native chicken using the same. More particularly, the present invention relates to a method for identifying an individual of a conventional chicken using a combination of supersatellite markers capable of identifying a more accurate individual while securing a high level of power.

Poultry meat plays an important role in the income of the farm household and the rural economy to the extent that it accounts for more than 20% of the total meat production in our country. Most of the chickens consumed in the market are imported chickens imported from developed countries (US, UK, France, Germany, Denmark, etc.) and domestic chicken are dominant in the chicken market %, Which is quite low.

In the case of cows and pigs, the production history system is promoted to ensure reliability by the distinction between domestic species and imported species. In contrast, conventional chickens do not have much preservation and development, It is urgent to secure reliability as a species.

Therefore, in case of conventional chicken seeds to be developed in the future, it is necessary to establish a method for identifying individuals using genotypes, to develop high quality meat into branded meat, and to utilize gene detection techniques to increase the reliability of traditional chickens. However, since the domains that can be identified on the genome of chickens vary according to the breed of chicken, it is necessary to select marker genes based on specific genetic patterns of chickens to identify individual chickens, It is important to set up the technique.

In Korea, genetic diversity studies on genetic diversity between breeds and genetic markers (microsatellite markers) developed for paternity identification have been used in Korea. However, its usefulness and accuracy are still unknown. There is a disadvantage in that the inspection cost is relatively high and the analysis time is long.

KR 10-1118342 B

It is an object of the present invention to provide an ultra-satellite marker capable of identifying an individual accurately, quickly and economically, and a method for identifying an individual of a conventional chicken using the same.

Accordingly, the present invention provides a method for identifying an individual of a conventional chicken using a supersatellite marker set consisting of ADL0293, ADL0304, ADL0317, GCT0016, LEI0092, MCW0029, MCW0087, MCW0104, MCW0123, MCW0127, MCW0145 and MCW0330 I want to.

The present invention provides, as a second preferred embodiment, a nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, And a pair of reverse primers and reverse primers of SEQ ID NOs: 11 and 12, SEQ ID NOs: 13 and 14, SEQ ID NOs: 15 and 16, SEQ ID NOs: 17 and 18, SEQ ID NOs: 19 and 20, SEQ ID NOs: To provide a primer set for identification of a chicken.

As a third preferred embodiment of the present invention, there is provided a kit for identifying a chicken of the present invention comprising the aforementioned primer set.

Further, the present invention provides, as a fourth preferred embodiment, (S1) a step of obtaining a nucleic acid sample from a native chicken subject to be identified; (S2) amplifying the nucleic acid sample of step (S1) by multiplex PCR using the primer set; And (S3) determining the genotype using the amplified products of step (S2).

The composition of the multiplex PCR reaction solution for amplification in step (S2) is 2 to 10 ng / 쨉 l of template DNA, 8 to 15 상기 of the primer set, DNA polymerisation 0.3 to 1.0 μl of enzyme, 1.5 to 2.5 μl of buffer, 1 to 2 μl of deoxynucleotides (dNTPs) and 0.1 to 1 μl of distilled water.

In the individual identification method of conventional chicken according to this embodiment, the number of alleles is 5-15, the expected heterozygosity is higher than 60%, and the size of the gene is 80 bp to 300 bp have.

In step (S2), the multiplex PCR amplification was carried out at 95 ° C for 10 minutes, followed by reaction at 95 ° C for 30 seconds, 54 to 56 ° C for 25 to 35 seconds and 72 ° C for 1 minute, 35 times, and reacting at 72 캜 for 30 minutes.

The method of identifying an individual of a conventional chicken according to the present invention uses a combination of supersize satellite markers having higher individuality than that used in the prior art, thereby providing more accurate identification results. More specifically, the 12 kinds of satellites second marker of the invention are the same object appearance probability of a random mating population in 2.88 × 10 ^-21, half the breeding population hyeongmae 1.72 × 10 ^{- 15,} for the native chickens are bred in the country There is no possibility of occurrence of the same individual, so that it can be usefully used for identification of a native chicken.

Therefore, it can be used as a means to prevent cheating by easily discriminating origin or route of chicken in the distribution process of traditional chicken, and it can be used as a means to increase the reliability of the consumer for the traditional chicken, .

FIG. 1 is a photograph showing the result of electrophoresis of a PCR product obtained using a primer specific to a supersatellite marker set according to an embodiment of the present invention.
Fig. 2 shows the results obtained by PCoA analysis, in which the respective groups are distributed by the horizontal axis (first dispersion value) and the vertical axis (second dispersion value).
Fig. 3 shows the results obtained by PCoA analysis, in which the respective groups are distributed by the horizontal axis (second dispersion value) and the vertical axis (third dispersion value).

Hereinafter, the present invention will be described in more detail.

The present invention is to provide an ultra-satellite marker capable of identifying an individual accurately, quickly and economically, and a method for identifying an individual of a conventional chicken using the same.

To this end, the present invention provides an individual identification method of a conventional chicken using a supersatellite marker set consisting of ADL0293, ADL0304, ADL0317, GCT0016, LEI0092, MCW0029, MCW0087, MCW0104, MCW0123, MCW0127, MCW0145 and MCW0330.

The term "microsatellite " in the present invention means STR (short tandem repeat) having a structure in which 2 to 6 nucleotide sequences are repeated. These supersatellites are known to be uniformly distributed in most eukaryotic genomes, and are mainly present in non-coding DNA.

In the present invention, the term "supersatellite marker" means a polymorphism generated by a variation in the number of repeats of the supersatellite repeating unit.

Since the number of repetition units of supersatellite repeating units may vary depending on the species or species, such a supersatellite marker may design a primer sequence as a primer sequence in both base pairs of repeating regions of the supersatellite and perform PCR amplification , The size of the resulting product can be compared to identify the individual or species.

In the present invention, a set of supersampling markers capable of identifying an individual of a conventional chicken without the possibility of occurrence of the same individual has been identified by considering both the heterozygosity and the size of the PCR amplification product. The super satellites marker set of the present invention includes a super satellites marker set consisting of ADL0293, ADL0304, ADL0317, GCT0016, LEI0092, MCW0029, MCW0087, MCW0104, MCW0123, MCW0127, MCW0145 and MCW0330, Information is available from the National Center for Biological Information (NCBI) database (www.NCBI.nlm.nih.gov). In addition, since the supersatellite marker set of the present invention is a combination of collected samples of the development of a new variety and a crossbreeding group, it is useful for identification of an individual of a domestic chicken distributed in the future.

The term "primer " as used herein refers to a nucleic acid sequence having a short free 3 'terminal hydroxyl group, a short nucleic acid sequence capable of forming base pairs with a complementary template and serving as a starting point for template strand copy .

In the present invention, the primer pair for MCW0145 is a forward primer of SEQ ID NO: 1 and the reverse primer pair of SEQ ID NO: 2, the primer pair for MCW0087 is a forward primer of SEQ ID NO: 3 and the reverse primer pair of SEQ ID NO: 4, the primer pair for MCW0127 The primer pair of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6, the primer pair of LEI0094 is the forward primer of SEQ ID NO: 7, the reverse primer pair of SEQ ID NO: 8, the primer pair of ADL0317 is the forward primer of SEQ ID NO: The reverse primer pair of SEQ ID NO: 10, the reverse primer pair of SEQ ID NO: 12, the reverse primer pair of SEQ ID NO: 12 and the reverse primer pair of GCT0016, the reverse primer pair of SEQ ID NO: 13 and the reverse primer pair of SEQ ID NO: The primer pair for MCW0104 is a forward primer of SEQ ID NO: The primer pair of SEQ ID NO: 16, the primer pair of MCW0123, the reverse primer of SEQ ID NO: 17, the reverse primer of SEQ ID NO: 18, the primer pair of MCW0330 is the forward primer of SEQ ID NO: 19 and the reverse primer pair of SEQ ID NO: The primer pair for ADL0293 may be a forward primer of SEQ ID NO: 21, the reverse primer pair of SEQ ID NO: 22, the primer pair for ADL0304 may be a forward primer of SEQ ID NO: 23 and a pair of reverse primers of SEQ ID NO: Any primer that can specifically bind to a supersatellite marker to produce an amplification product is included in the scope of the present invention.

The term "PCR (polymerase chain reaction)" in the present invention is a molecular biological technique for replicating and amplifying a desired portion of DNA. Specifically, PCR involves a series of three steps. The first step in PCR is denaturation of the DNA, which can be separated by heating two strands of DNA. Each separated DNA serves as a template. The second step in the PCR is annealing, in which primers for the supersatellite marker bind to the template DNA. Annealing temperature is an important factor in determining the accuracy of the reaction. If the temperature is too high, the primer will bind too weakly to the template DNA, resulting in very little amplified DNA product. If the temperature is too low, undesired DNA can be amplified because the primer binds nonspecifically, and the temperature should be appropriately controlled depending on the kind of primers used. The third step of the PCR is the Extension step. At this stage, when the primer binds to the template, a heat-resistant DNA polymerase will make a new DNA from the template DNA.

Multiplex PCR may be used when analysis is performed on several supersatellite markers as in the present invention.

In the present invention, the term "multiplex PCR" means a PCR technique in which multiple genes are simultaneously amplified, unlike a single PCR that amplifies one gene for one template DNA. In multiplex PCR, it is desirable to include multiple pairs of primers in a single PCR mixture, each of which has a specific amplification product size range for the different DNA sequences so that the sizes do not overlap with each other. In multiplex PCR, multiple primer pairs are inserted into one tube and reacted, so that inhibition may occur between primers. Therefore, when applying to multiplex PCR, selection of primers for the genes to be amplified is important Do. In addition, since the appropriate binding temperature may be different for each of the included primers, it is necessary to optimize the binding temperature suitable for multiplex PCR so that all pairs of PCR primers included in a single PCR reaction can be effectively combined when multiplex PCR is applied.

After such PCR, the PCR amplification product can be identified by a technique that can be classified according to the size of the PCR amplification product, such as SDS-PAGE or capillary electrophoresis.

Specifically, it is possible to determine how many repeating units are contained in each allele by classifying the PCR amplification products by size and determining their sizes by electrophoresis or the like. Accordingly, the genotype data as described above and the database for recording the authentic native chicken data can be separately constructed or the authenticated information can be used to identify the individual by comparing the information confirmed through experiment with the data.

In particular, when using the 12 satellites markers of the present invention, the probability of appearance of the same individual was 2.88 × 10 ^-21 in the random mated group, 1.72 × 10 ^-15 in the semi-mated group, 1.38 × 10 ^-7 , It is possible to identify the object with high accuracy when the PCR reaction is performed on the 12 satellites 'markers and then all the information on the 12 satellites' markers are synthesized.

In the following embodiments of the present invention, the combination of two sets of supersatellite markers that can be effectively used for identification of a conventional chicken is identified in consideration of heterozygosity and amplification product size. When multiplex PCR was performed using primer pairs, it was shown that not only amplification of the supersatellite markers but also more accurate, quick and economical identification was possible.

In addition, the 12 species of supersatellite markers according to the present invention showed a 2.88 × 10 ^-21 , 1.72 × 10 ^-15 , and 1.38 × 10 ^-7 , respectively, probability of occurrence in the same mating group, , It was concluded that the same species did not appear even considering the number of domestic chickens in Korea.

As another embodiment of the present invention, the present invention provides a kit for identifying a conventional chicken comprising the above-described primer set.

The conventional chicken identification kit may be in the form of a supersatellite PCR kit, preferably a multiplex PCR kit.

The PCR kit comprises a primer set consisting of primer pairs specific for a polynucleotide comprising the supersatellite markers, a DNA polymerase, a buffer to aid the polymerase reaction, deoxynucleotides (dNTPs), a distilled- water, test tubes and suitable containers, and the like.

In the PCR kit, 2 to 10 ng / μl of the template DNA of the individual to be specifically identified, 8 to 15 μl of the primer set, 0.3 to 1.0 μl of DNA polymerase, 1.5 to 2.5 μl of buffer, 1 μl of deoxynucleotide (dNTPs) To 2 [mu] l of distilled water and 0.1 to 1 [mu] l of distilled water.

In another embodiment, the present invention provides a nucleic acid sample isolated from a native chicken subject to be analyzed and a supersatellite consisting of ADL0293, ADL0304, ADL0317, GCT0016, LEI0092, MCW0029, MCW0087, MCW0104, MCW0123, MCW0127, MCW0145 and MCW0330 And multiplex PCR amplification using a primer set consisting of primer pairs specific to each marker set.

In the present invention, the term "nucleic acid sample" means a sample such as a DNA of a conventional chicken capable of amplifying supersatellite markers of the present invention. Such nucleic acid samples include, but are not limited to, those obtained from samples such as hair follicles, blood, various body fluids, isolated tissues, isolated cells or saliva of native chicken.

In another method of the present invention, primer sets containing primer pairs specific to the supersatellite marker set of the present invention may be mixed with template DNA derived from the conventional chicken, and amplified by multiplex PCR . By determining the genotype using the amplified product, a more economical and quick identification result can be obtained easily.

Specifically, the present invention provides a method for producing a nucleic acid comprising the steps of: (S1) obtaining a nucleic acid sample from a native chicken subject to be identified; (S2) amplifying the nucleic acid sample of step (S1) by multiplex PCR using the primer set of the second aspect; And (S3) determining the genotype using the amplified product of step (S2).

In the method for identifying an individual according to an embodiment of the present invention, the composition of the multiplex PCR reaction solution for amplification is 2 to 10 ng / μl of template DNA, 8 to 15 μl of the primer set, 0.3 to 1.0 μl of DNA polymerase, 1.5 to 2.5 μl of buffer, 1 to 2 μl of deoxynucleotides (dNTPs) and 0.1 to 1 μl of distilled water. The composition of the multiplex PCR reaction solution using the supersatellite marker set as described above is advantageous in that a sufficient analysis result can be obtained even with a very small amount of DNA of 10 ng / μl or less. In addition, the superscalar marker sets are combined with highly genetic polymorphic markers, enabling accurate and rapid individual identification.

The optimum composition of the multiplex PCR reaction solution was 5 ng / 주 of template DNA, 9.6 ㎕ of the primer set, 0.6 DNA of DNA polymerase, 1.8 버퍼 of buffer, 1.5 데 of deoxynucleotides (dNTPs) and 0.5 증 of distilled water .

Here, the PCR amplification process amplifies a specific site by repeating denaturation, binding, and elongation steps. In this case, it is more preferable to perform multiplex PCR in the method of the present invention. In this case, since a plurality of primer pairs are included in a single tube, it is necessary to optimize the binding temperature.

Specifically, the multiplex PCR amplification conditions in step (S2) were 10 min at 95 ° C, 30 sec at 95 ° C, 25-35 sec at 54-56 ° C, and 1 min at 72 ° C Followed by repeating 25 to 35 times, and reacting at 72 DEG C for 30 minutes.

After performing the PCR, the size of the amplified product can be analyzed by electrophoresis, and the allele can be determined based on the size of the amplified product.

In this method, the number of alleles is 5 to 15, the expected heterozygosity is higher than 60%, and the size of the gene may be 80 bp to 300 bp.

Hereinafter, the present invention will be described in more detail with reference to preferred embodiments. It will be apparent, however, to those skilled in the art that these embodiments are for further explanation of the present invention and that the scope of the present invention is not limited thereby.

Example

Example  One: Traditional chicken  For object identification Super satellites Marker  Selection

In order to select the supersatellite markers that can be effectively used for identification of the native chicken, Seo et al. (2013, Discrimination of Korean native chicken lines using fifteen selected microsatellite markers) 150 satellites were examined. Based on the above 150 markers, allele size, polymorphism, and color of fluorescent material were considered. Finally, 12 kinds of supersatellite markers useful for individual identification and production history system were selected. The number of alleles of the selected supersatellite markers ranged from 5 to 14 on average of 9.33, and the heterozygosity rate was more than 77% on average and had high individual identification accuracy. The combination of the supersatellite markers is specifically shown in Table 1 below.

Super satellite marker combination One MCW0145 2 MCW0087 3 MCW0127 4 LEI0094 5 ADL0317 6 MCW0029 7 GCT0016 8 MCW0104 9 MCW0123 10 MCW0330 11 ADL0293 12 ADL0304

Example  2: Disclosure materials and DNA  sample

(A, F, H, S, W, Y, and Z) of the practical system of the consultation, the domestic poultry seeds and the national poultry academy, And blood was collected from the subcutaneous veins of Ross, Cobb and Arbor Acres which are widely known as practical broilers. Table 2 summarizes the species and the number of individuals of the above-mentioned disclosure materials.

The collected blood samples were treated with SSC buffer to separate the blood cells. Each 20 μl of the blood sample was subjected to extraction with genomic DNA isolation kit from blood (Genetbio, Korea) according to a method recommended by the manufacturer, And stored at 20 ° C.

Blood sample Number of samples Blood sample Number of samples Hanhak A system 12 Hanhwa 3 98 Han-Hip F system 48 Our tasty chicken No. 1 50 Hanseong H system 48 Our tasty chicken 2 46 Han-Hyeon S system 72 Loss 17 Han-wip W system 72 Cove 17 Han-Yip Y system 46 Abaca 15 Z Korea 20

Example  3: Super satellites On the marker  Specific gene amplification primer  making

A primer specific to the supersatellite marker set selected in Example 1 was customized by Thermofisher Scientific Corporation. A tagged fluorescent material consisting of FAM, NED, VIC and PET was attached to the end of the forward primer of each primer, and the sequence number, the marker name, the chromosome position, the base sequence, the product size and the attached fluorescent material Dye) and the like are shown in Table 3 below.

order
number Marker chromosome primer
F: Forward (5 'to 3')
R: reverse direction (3 'to 5') Amplification product
size Neon
matter One MCW0145 One F ACTTTATTCTCCAAATTTGGCT 178 to 214 FAM 2 R AAACACAATGGCAACGGAAAC 3 MCW0087 2 F ATTTCTGCAGCCAACTTGGAG 265-289 NED 4 R CTCAGGCAGTTCTCAAGAACA 5 MCW0127 3 F GAGTTCAGCAGGAATGGGATG 226-274 VIC 6 R TGCAATAAGAGAAGGTAAGGTC 7 LEI0094 4 F GATCTCACCAGTATGAGCTGC 232 ~ 282 FAM 8 R TCTCACACTGTAACACAGTGC 9 ADL0317 4 F AGTTGGTTTCAGCCATCCAT 278 to 204 NED 10 R CCCAGAGCACACTGTCACTG 11 MCW0029 5 F GTGGACACCCATTTGTACCCTATG 131 ~ 187 VIC 12 R CATGCAATTCAGGACCGTGCA 13 GCT0016 9 F TCCAAGGTTCTCCAGTTC 108 ~ 168 NED 14 R GGCATAAGGATAGCAACAG 15 MCW0104 13 F TAGCACAACTCAAGCTGTGAG 192-232 PET 16 R AGACTTGCACAGCTGTGTACC 17 MCW0123 14 F CCACTAGAAAAGAACATCCTC 80 ~ 90 FAM 18 R GGCTGATGTAAGAAGGGATGA 19 MCW0330 17 F TGGACCTCATCAGTCTGACAG 252 to 286 PET 20 R AATGTTCTCATAGAGTTCCTGC 21 ADL0293 17 F GTAATCTAGAAACCCCATCT 107-127 PET 22 R ACATACCGCAGTCTTTGTTC 23 ADL0304 18 F GGGGGAGAACTCTGGAAATG 138-162 FAM 24 R CCTCATGCTTCGTGCTTTTT

Example  4: Multiplex PCR  Amplification

Using the DNA samples collected in Example 2 as a template, multiplex PCR using 12 pairs of primers prepared in Example 3 was carried out under the following conditions.

For the multiplex PCR reaction, 5 μg / μl of template DNA and 10 μl of each primer were mixed with about 0.4 μl of each primer in consideration of the sensitivity of the fluorescent material. Total primer combination was 9.6 μl, 250 U of Hot Start Taq DNA polymerase (GENETBIO , Korea), 1.8 占 퐇 of 10 占 buffer and 1.5 占 퐇 of 2.5 mM dNTP were added, and then 0.5 占 퐇 of distilled water was added to make 15 占 퐇 in total. The composition of the PCR reaction solution is shown in Table 4 below.

After pre-denaturation at 95 ° C for 30 minutes, denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, extension at 72 ° C for 30 seconds, and final extension at 72 ° C for 30 minutes, Muliplex PCR conditions were established. The PCR reaction conditions are shown in Table 5 below.

PCR reaction liquid composition volume  Genomic DNA 5 ng / l Primer combination (12 markers) 9.6 μl Taq polymerase (250 U) 0.6 μl 10 × Buffer 1.8 μl dNTP 1.5 μl Distilled water 0.5 μl Total 15 μl

step Temperature (℃) time Number of times Pre-denaturation 95 10 minutes One Denaturation 95 30 seconds
30 Annealing 55 30 seconds Extension 72 1 minute Final extension 72 30 minutes One Hold 4 ∞

The products amplified by the multiplex PCR were diluted with Hi-DiTformamide and GeneScan (TM) 500LIZTMsizestandard according to the result, and electrophoresis was performed using a Genetic Analyzer 3130xl automatic sequencing apparatus (Applied Biosystems, USA) Fragment analysis was performed. The result of the electrophoresis of the PCR product obtained using the primer specific to the supersatellite marker set is shown in FIG.

The exact size of the allele genotype and the number of alleles were determined by GeneMapper ver. 4.1 (Applied Biosystems, USA).

Example  5: Super satellites Marker Polymorphism index  analysis

Using the alleles of each marker identified in Example 4, the observed heterozygosity (Hobs), expected heterozygosity (Hexp), polymorphism information content , PIC) were calculated using the Cervus 3.0 program (version 3.0.3 The University of Edinburgh) (Marshall et al (1998) Mol. Ecol. 7: 639-655).

As a result, the polymorphism index of each supersatellite marker is as shown in Table 6 below.

Super satellites marker Opposition
Number of genes Number of samples H _Obs H _Exp PIC ADL0293 8 566 0.684 0.774 0.741 ADL0304 7 566 0.673 0.753 0.715 ADL0317 9 566 0.329 0.853 0.835 GCT0016 10 545 0.385 0.639 0.568 LEI0092 10 564 0.690 0.719 0.674 MCW0029 13 566 0.786 0.827 0.807 MCW0087 10 566 0.611 0.809 0.781 MCW0104 14 565 0.717 0.859 0.843 MCW0123 5 566 0.634 0.729 0.681 MCW0127 11 566 0.693 0.824 0.802 MCW0145 9 566 0.737 0.798 0.770 MCW0330 6 566 0.588 0.710 0.661 Average 9.33 - 0.627 0.775 0.740

A total of 9 species of alleles were identified from 5 (MCW0123) to 14 (MCW0104). In addition, supersatellite markers of the present invention showed high values of expected heterozygosity (Hexp) value and polymorphism information index (PIC) of 0.775 and 0.740, respectively, and proved superiority as an individual identification marker. For reference, it has been reported that a marker with a predicted heterozygosity (Hexp) value of 0.6 or more and a polymorphism information index (PIC) value of 0.5 or more, which is a criterion for determining the polymorphism of a supersatellite marker, exhibits high polymorphism Botstein, D., et al., 1980).

Example  6: Statistical analysis

Using the 12 satellites (ADL0293, ADL0304, ADL0317, GCT0016, LEI0092, MCW0029, MCW0087, MCW0104, MCW0123, MCW0127, MCW0145 and MCW0330) used in this study, Calc ver 1.0 (Ayres and Overall, 2004) program and presented in Table 7 below. The probability of identity (PI) in the case of the random mating group (Random) was found to be 2.88 × 10 ^-21 frequency when 12 markers were used, Half-sib and sib were 1.72 × 10 ^-15 and 1.38 × 10 ^-07 , respectively.

In other words, since all the groups show the frequency of occurrence of the same individuals converging to zero, the identification rate of the individuals is very high. Therefore, 12 kinds of superglue markers according to the present invention can be sufficiently utilized .

Number of Markers PI PI _Half-sibs PI _sibs One 1.10 x 10 ^-02 4.13 × 10 ^-02 2.52 × 10 ^-01 2 1.40 x 10 ^-04 1.90 × 10 ^-03 6.83 × 10 ^-02 3 1.68 x 10 ^-06 8.48 × 10 ^-05 1.74 x 10 ^-02 4 2.18 x 10 ^-08 3.85 × 10 ^-06 4.44 × 10 ^-03 5 3.95 × 10 ^-10 2.21 × 10 ^-07 1.18 × 10 ^-03 6 8.63 × 10 ^-12 1.39 × 10 ^-08 3.20 × 10 ^-04 7 1.85 × 10 ^-13 8.76 × 10 ^-10 4.20 × 10 ^-04 8 4.63 × 10 ^-15 5.95 × 10 ^-11 2.37 × 10 ^-05 9 1.20 x 10 ^-16 4.11 × 10 ^-12 6.52 × 10 ^-06 10 3.26 × 10 ^-18 2.94 × 10 ^-13 1.81 x 10 ^-06 11 9.57 × 10 ^-21 2.26 × 10 ^-14 5.12 × 10 ^-07 12 2.88 × 10 ^-21 1.72 x 10 ^-15 1.38 × 10 ^-07

Example  7: Principal component analysis Principal Coordinates Analysis )

Principal Coordinates Analysis (PCoA) was performed on the basis of the frequency of the alleles of the 12 species of supersatellite markers of the present invention, and the results of the above procedures are shown in FIG. 2 and FIG. FIG. 2 shows the result obtained by PCoA analysis, in which the respective groups are distributed by the horizontal axis (first dispersion value) and the vertical axis (second dispersion value), and FIG. 3 shows the results obtained by PCoA analysis. 2 dispersion value) and the vertical axis (third dispersion value). In FIG. 2 and FIG. 3, each code is composed of the following information: HA, HF, HH, HS, HW, (WM), Woori chicken (WMT), Ross (RS), Cob (CB), and ABAACA (AB) in the HJ, HJ, HCC, HCC, it means.

As a result of the PCoA analysis, the dispersion value of the first component was 33.94%, the dispersion value of the second component was 22.42%, and the dispersion value of the third component was 14.78% We could confirm that the foreign cultivars such as roast, cob, and aca acre were clearly distinguished.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. It is natural.

<110> Industry-Academic Cooperation Foundation, Hankyong National University <120> Microsatellite Marker For Identification of Korean Native Chicken          And Method For Identification Using The Same <130> HPC7664 <160> 24 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MCW0145_F <400> 1 actttattct ccaaatttgg ct 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0145_R <400> 2 aaacacaatg gcaacggaaa c 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0087_F <400> 3 atttctgcag ccaacttgga g 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0087_R <400> 4 ctcaggcagt tctcaagaac a 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0127_F <400> 5 gagttcagca ggaatgggat g 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MCW0127_R <400> 6 tgcaataaga gaaggtaagg tc 22 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LEI0094_F <400> 7 gatctcacca gtatgagctg c 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LEI0094_R <400> 8 tctcacactg taacacagtg c 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0317_F <400> 9 agttggtttc agccatccat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0317_R <400> 10 cccagagcac actgtcactg 20 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MCW0029_F <400> 11 gtggacaccc atttgtaccc tatg 24 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0029_R <400> 12 catgcaattc aggaccgtgc a 21 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GCT0016_F <400> 13 tccaaggttc tccagttc 18 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GCT0016_R <400> 14 ggcataagga tagcaacag 19 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0104_F <400> 15 tagcacaact caagctgtga g 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0104_R <400> 16 agacttgcac agctgtgtac c 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0123_F <400> 17 ccactagaaa agaacatcct c 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0123_R <400> 18 ggctgatgta agaagggatg a 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0330_F <400> 19 tggacctcat cagtctgaca g 21 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MCW0330_R <400> 20 aatgttctca tagagttcct gc 22 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0293_F <400> 21 gtaatctaga aaccccatct 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0293_R <400> 22 acataccgca gtctttgttc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0304_F <400> 23 ggggaggaac tctggaaatg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0304_R <400> 24 cctcatgctt cgtgcttttt 20

Claims (7)

delete delete delete (S1) obtaining a nucleic acid sample from a native chicken subject to be identified;
(S2) a nucleic acid sample that specifically binds to a supersaturate marker consisting of ADL0293, ADL0304, ADL0317, GCT0016, LEI0092, MCW0029, MCW0087, MCW0104, MCW0123, MCW0127, MCW0145 and MCW0330, 1 and 2, SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, SEQ ID NOs: 7 and 8, SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, SEQ ID NOs: 13 and 15, SEQ ID NOs: 18, SEQ ID NOs: 19 and 20, SEQ ID NOs: 21 and 22, SEQ ID NOs: 23 and 24, and primer set consisting of a pair of reverse primers; And
(S3) determining a genotype using the amplified product of step (S2)
The composition of the reaction solution for the multiplex PCR in the step (S2) is 2 to 10 ng / μl of template DNA, 8 to 15 μl of the primer set, 0.3 to 1.0 μl of DNA polymerase, 1.5 to 2.5 μl of buffer, 1 ~ 2 [mu] l of oxynucleotides (dNTPs) and 0.1 ~ 1 [mu] l of distilled water. delete 5. The method of claim 4,
Wherein each of said supersatellite markers has an allelic number of 5 to 15, an expected heterozygosity of more than 60%, and a gene size of 80 to 300 bp. 5. The method of claim 4,
In step (S2), multiplex PCR amplification was performed at 95 ° C. for 10 minutes, followed by reaction at 95 ° C. for 30 seconds, 54 to 56 ° C. for 25 to 35 seconds, and 72 ° C. for 1 minute, And repeating the reaction for 30 minutes at 72 ° C.

Images