KR102083306B1 - Genetic markers and methods for identifying species belong to Myxinidae - Google Patents

Abstract

The present invention has a primitive and simple form compared to other fish species, and genetic markers for discriminating fish species, which can quickly and accurately discriminate between fish species that have difficulty in determining exact species when compared to similar species with the naked eye, and discrimination using the same. Provide a method.

Description

Genetic markers and methods for identifying species belong to Myxinidae}

The present invention relates to a genetic marker and a method for discriminating fish species, and more particularly, to a genetic marker and a method for discriminating fish species.

Eel and fish are reported in 6 genus and 81 species worldwide. Eptatretus burgeri , which is called eel for domestic consumption, is the main economic fish species. The eel lives in the southern coast of Korea, but natural resources have decreased due to excessive fishing and environmental pollution. Currently, domestic production is about 40 tons, and more than 6,000 tons are imported from the United States, Japan, Canada, and New Zealand to meet the demand. It is true. Pacific eel ( Eptatretus stoutii ) is mainly imported from the United States, mostly live fish, frozen or some shells or pellets. There are many species of eel and fish that are imported from Korea, which are not found in Korea, but are often marked differently from paper or origin. The black fish has a primitive and simple form compared to other fish species, which makes it difficult to discriminate accurately when compared with similar species. To date, genetic studies have examined the molecular lineage of the eel family through the use of mitochondrial DNA 16S rRNA genes. The Consortium for the Barcode of life (CBOL) has identified the classification of species in the world. To this end, we propose a common barcode region for classifying species in the cytochrome c oxidase subunit I (COI) gene region. In this regard, Korean Patent No. 1720483 discloses a peptide nucleic acid (PNA) probe set for eel species discrimination and an eel species discrimination method using the same.

However, in the case of the prior art, a species discrimination method of an eels is not yet present as a method for discriminating species according to an analysis of melting temperature of each eel species using a peptide nucleic acid (PNA).

The present invention is to solve a number of problems, including the above problems, the fish species that can quickly and accurately determine the fish species that are difficult to determine the exact species when compared to similar species with the naked eye An object of the present invention is to provide a genetic marker for discrimination and a discrimination method. However, these problems are exemplary, and the scope of the present invention is not limited thereby.

According to one aspect of the invention, the first forward primer consisting of a nucleic acid sequence described in SEQ ID NO: 1; A second forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 2; A third forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 3; A fourth forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 4; And a general-purpose reverse primer consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, a species-specific PCR kit for discriminating eel and fish species is provided.

According to another aspect of the invention, the genomic DNA extraction step of extracting genomic DNA from the fish; DNA amplification step of amplifying the genomic DNA extracted by the PCR kit of claim 1; An electrophoresis step of performing electrophoresis on the amplified DNA product; And analyzing the band pattern of the electrophoretic DNA.

As described above, according to one embodiment of the present invention, using a genetic marker for discriminating fish species, it has a primitive and simple form compared to other fish species, and it is difficult to accurately discriminate when comparing with similar species with naked eyes. A species discrimination effect can be realized to quickly and accurately identify fish species. Of course, the scope of the present invention is not limited by these effects.

1 is a diagram showing a primer region for the comparison of the nucleotide sequence of the mutant fish mt-DNA CO1 region of the present invention and the development of a species-specific marker.
Figure 2 is an electrophoresis picture using four species-specific multiplex PCR primers of the ink fish of the present invention.

Definition of Terms:

As used herein, " Eptatretus burgeri " is a saltwater fish belonging to the eel family, which is a parasitic fish that clings to other fish and eats flesh and intestines. It has a similar appearance to eel, but unlike eel, eel, and conger eel belonging to tibia, it has no jaws and is a round mouth (류 口 類). It was mainly caught using traps and nets, and after the liberation, they used only leather for making leather goods such as wallets and shoes.

Detailed description of the invention:

According to one aspect of the invention, the first forward primer consisting of a nucleic acid sequence described in SEQ ID NO: 1; A second forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 2; A third forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 3; A fourth forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 4; And a general-purpose reverse primer consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, a species-specific PCR kit for discriminating eel and fish species is provided.

In the species-specific PCR kit, it can be selected from the group consisting of domestic eel ( Eptatretus burgeri ), Pacific eel ( Eptatretus stoutii ), New Zealand eel ( Eptatretus cirrhatus ) and Canadian eel ( Myxine limosa ) among the eel in circulation in Korea. .

 According to another aspect of the invention, the genomic DNA extraction step of extracting genomic DNA from the fish; DNA amplification step of amplifying the genomic DNA extracted by the PCR kit of claim 1; An electrophoresis step of performing electrophoresis on the amplified DNA product; And analyzing the band pattern of the electrophoretic DNA.

In the method of determining the eel and fish species, the step of analyzing the band pattern of the DNA is domestic eel ( Eptatretus burgeri ) when the band of 437 bp is confirmed, Pacific eel ( Eptatretus stoutii ), 209 bp is confirmed when 96 bp is confirmed New Zealand eel ( Eptatretus cirrhatus ), and 325 bp can be identified by determination as Canadian eel ( Myxine limosa ) and genomic DNA can be amplified by multiplex PCR.

Inshore hagfish inhabit the southern coast of Korea, but natural resources have decreased due to excessive fishing and environmental pollution. Currently, domestic production is about 40 tons, and more than 6,000 tons in the US, Japan, Canada and New Zealand to meet the demand. It is imported. Papers and origins are often marked differently in the process of domestically imported fishes. Especially, the fishes have a primitive and simple form compared to other fish species, so it is difficult to discriminate precisely by visual observation alone. Since a lot of time and cost are required for gene sequencing, the present inventors have recognized that there is an easy and efficient method for identifying species at the stage before sequencing. We have developed a genetic marker and discrimination method for fish species identification that can be used to quickly and easily discriminate four kinds of eel and fish in Korea.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the present invention is not limited to the embodiments disclosed below, but can be implemented in various different forms, the following examples are intended to complete the disclosure of the present invention, the scope of the invention to those skilled in the art It is provided to inform you completely.

Example 1: Genomic DNA Extraction

The present inventors have sought jangeogwa (Myxinidae) Domestic hagfish for the kind of analysis of the fish (Eptatretus burgeri) samples 30 Object, Domestic US Pacific hagfish imports (Eptatretus stoutii) 30 objects and New Zealand hagfish (Eptatretus cirrhatus) 5 objects and Canadian A total of 115 individuals were used for analysis, including 50 individuals of Myxine limosa . Specifically, after transferring the sample of the eel eel to the laboratory, the tissues of individual samples were removed and preserved in 100% ethanol before DNA extraction, and genomic DNA was extracted using MagExtractor MFX-6100 automated DNA extraction system (Toyobo, Osaka, Japan). Extracted. The extracted genomic DNA was then quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Barrington, IL, USA) and stored at −20 ° C. until used for analysis.

Example 2: Molecular Systematic Analysis

The present inventors have found that the nucleotide sequence of mitochondrial DNA in eel and fish is registered in the National Center for Biotechnology Information (NCBI, www.ncbi.nlm.nih) of the United States for gene analysis of COI region of mitochondrial DNA. Based on the analyzed gene sequences of Eptatretus burgeri (Accession No. AJ278504), Eptatretus stoutii (Accession No. GU440317), Eptatretus cirrhatus (Accession No. JX050996) and Myxine limosa (Accession No. KC807332), the Clustal W program of the Bioedit platform In the COI region, primer positions that can specifically bind to the eel family were identified and specific primers were prepared. PCR amplification was then performed using AccuPower PCR Master Mix (Bioneer, Daejeon, Korea) with 20 pL of PCR mixture consisting of 1 pL of 10 pM eel and specific primers (SEQ ID NOS: 5 and 6), 1 μl of DNA, and distilled water. The reaction conditions were first denatured at 94 ° C. for 7 minutes, repeated 45 times at 94 ° C., 45 seconds at 55 ° C., and 1 minute at 72 ° C., and finally extended at 72 ° C. for 7 minutes. The amplified PCR product was then purified using Expin PCR SV (GeneAll Biotechnology, South Korea) for sequencing and Sanger sequencing using BigDye terminator v1.1 (Applied Biosystems). Was performed.

Then, 1 μl of the purified PCR reaction, 2 μl of 5x Big Dye terminator v1.1 sequencing buffer, 0.8 μl of BigDye terminator reaction mix v1.1, 1 μl of 0.1 pM forward or reverse primer, and 5.2 μl of distilled water. The liquid was prepared.

On the other hand, the sequencing PCR conditions were denatured at 96 ° C. for 2 minutes and repeated 25 times for 15 seconds at 96 ° C., 5 seconds at 50 ° C. and 2 minutes at 60 ° C. To the DNA amplified by sequencing PCR, 1 μl of 50 ml EDTA (pH 8.0), 1 μl of 600 mM sodium acetate (pH 5.2) and 25 μl of 99.9% ethanol were added and 45 at 3,000 rpm (2,272 × g) at 4 ° C. Centrifuged for a minute. Thereafter, the resultant was washed with 70% ethanol, dried at room temperature for 10 minutes, and DNA pellets were dissolved in 10 μl Hi-Di formamide (Applied Biosystems) and subjected to sequencing with ABI 3730 Genetic Analyzer (Applied Biosystems). In addition, the collected bidirectional sequences were analyzed using DNA Star SeqMan software (DNASTAR, USA).

Example 3: Primer Preparation

We analyzed DNA haplotypes using the DNA Sequence Polymorphism (DnaSP, ver. 5.10.01) program, which excludes genetic variations within species and shows the differences between species while matching the nucleotide sequences of all individuals. Single nucleotide polymorphism (SNP) gene region was identified. Then, the optimal primer site was selected based on the sequence difference of about 100 bp or more between species, and a species-specific forward primer was prepared such that a single nucleotide polymorphism gene was located at the 3 'end (FIG. 1).

Subsequently, the primer composition for multiplex PCR amplification was mixed with 0.2 μl of forward primer (Eb-F / Es-F / Ec-F / Ml-F) and 0.4 μl of reverse primer (hag-R), respectively. PCR amplification was performed at an annealing temperature of 56 ° C. established through a single PCR reaction. 2 μl of the amplified PCR product was confirmed by electrophoresis with 1 × redsafe (iNtRON, South Korea) on a 1% agarose gel.

As a result, according to the size difference of the PCR product, it was confirmed that the domestic eel (437 bp), Pacific eel (96 bp), New Zealand eel (209 bp), Canadian eel (325 bp) and non-specific amplification did not occur ( 2). Information on the primers used for the multiplex PCR amplification is summarized in Table 1 below.

PCR primer sequence for discriminating the black fish species of the present invention primer Nucleic Acid Sequence (5 '-> 3') Target species origin Size (bp) SEQ ID NO: Eb-F CTTCATAGTTATACCAATTATG Eptatretus burgeri United States of America 437 One Es-F TCCCATTATTTGTATGATCAATC Eptatretus stoutii Korea 96 2 Ec-F AGATTTAACCATTTTTTCACTT Eptatretus cirrhatus New Zealand 209 3 MI-F TTGCCCCCATCACTTATA Myxine limosa Canada 325 4 Hag-F AGGRYCYTTAMTYAAYAAT hagfish
505 5 hag-R CGATCAGTKAGTAYTATAGT hagfish 6

In conclusion, the multiplex PCR assay using a species-specific primer designed according to an embodiment of the present invention has a primitive and simple form compared to other fish species. (Duckfish) It has been confirmed that it has excellent discrimination ability against four species, and it has excellent specificity and sensitivity, so it can be used as an effective method that enables accurate labeling of the import and export and distribution management of aquatic products for future food safety.

Although the present invention has been described with reference to the above-described embodiments, these are merely exemplary, and it will be understood by those skilled in the art that various modifications and equivalent other embodiments are possible. Therefore, the true technical protection scope of the present invention will be defined by the technical spirit of the appended claims.

<110> Republic of Korea represented by National Fisheries Research & Development Institute <120> Genetic markers and methods for identifying species belong to          Myxinidae <130> PD18-5680 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Eb-F <400> 1 cttcatagtt ataccaatta tg 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Es-F <400> 2 tcccattatt tgtatgatca atc 23 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Ec-F <400> 3 agatttaacc attttttcac tt 22 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> MI-F <400> 4 ttgcccccat cacttata 18 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Hag-F <400> 5 aggrycytta mtyaayaat 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hag-R <400> 6 cgatcagtka gtaytatagt 20

Claims (5)

A first forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 1;
A second forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 2;
A third forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 3;
A fourth forward primer consisting of the nucleic acid sequence set forth in SEQ ID NO: 4; And
Among domestically available eel, Eptatretus burgeri , Pacific eel ( Eptatretus stoutii ), New Zealand eel ( Eptatretus cirrhatus ) and Canadian eel ( Myxine limosa ) Species specific PCR kit for determining the eel and fish species selected from the group consisting of. delete A genomic DNA extraction step of extracting genomic DNA from the eel;
DNA amplification step of amplifying the genomic DNA extracted by the PCR kit of claim 1;
An electrophoresis step of performing electrophoresis on the amplified DNA product; And analyzing the band pattern of the electrophoretic DNA, which comprises domestic eel ( Eptatretus burgeri ), Pacific eel ( Eptatretus stoutii ), New Zealand eel ( Eptatretus cirrhatus ), and Canadian eel ( Myxine limosa ). Method of discriminating eels and fish species selected from the group to be. The method of claim 3,
The step of analyzing the DNA band pattern is 437 bp band is confirmed domestic eel ( Eptatretus burgeri ), 96 bp is confirmed Pacific eel ( Eptatretus stoutii ), 209 bp is confirmed New Zealand eel ( Eptatretus cirrhatus ), and 325 The method is performed by determining the Canadian eel ( Myxine limosa ) once the bp is identified. The method of claim 3,
Amplification of genomic DNA by multiplex PCR.

Images