KR101749545B1 - Genetic markers and methods for identifying species belong to Cynoglossidae - Google Patents

Abstract

The present invention relates to a nucleic acid amplification system comprising a species specific forward primer consisting of one or more nucleic acid sequences selected from the group consisting of SEQ ID NOS: 3 to 12 and a common reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: Specific PCR kit.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to genetic markers,

The present invention relates to a genetic marker and a discriminating method, and more particularly, to a genetic marker and a discriminating method for distinguishing a chrysanthemum and a fish species.

Consumers are increasingly interested in health care and well - being due to the increase in national income and living standards in modern society. In the diet, well - being is a basic condition, and aquatic products are not simply food for protein supply, but are converted into health foods. Interest and demand are gradually increasing. In addition, consumer preferences are becoming more diverse, and consumption of imported aquatic products is also increasing with the increasing interest in foreign food products. Accordingly, imports of aquatic products are gradually increasing due to the increase in the concurrent FTA negotiations, and various aquatic products can be purchased at relatively low prices. However, in the case of these imported aquatic products, the exact name of the species or the place name of origin is often uncertain, which is a serious problem for food safety. In order to increase the reliability of the imported fishery products, the National Fisheries Research and Development Institute published the "Imported Fish Species Classification Manual" and correctly classified 84 kinds of imported fishery products through morphological and molecular biological methods. Among them, Cynoglossidae fish species , Cynoglossus arel , C. lingua , C. macrolepidotus , C. monodi , and Senegal transcriptional units ( Cynoglossus arel. ). C. senegalensis ), and the imported name and the standard name did not match at all.

Chosôda and fish are higher in water content than other fish, taste high in high-protein low-fat foods, and are evaluated as commercially valuable fish species such as geographical products developed in some areas. However, domestic catches and catches of fish have been gradually decreasing due to the recent indiscriminate overfishing and illegal fishing, resulting in a decrease in the amount of resources and destruction of spawning grounds. These fish species are very similar to species species, so it is very difficult to distinguish species with the naked eye. The domestic distribution of imported fishes and fishes, which are not known at a relatively low price and exact name, may result in confusing the rights and circulation order of consumers. However, the analytical methods for imported aquatic products have not been studied so far. In this regard, Korean Patent Registration No. 1151747 discloses a method for classifying marine organisms and polynucleotide probes, DNA chips and kits for class discrimination.

However, in the case of the prior art, there is a problem in that the analysis procedure for class discrimination is complicated and unsuitable for application to the discrimination of fish species and species.

DISCLOSURE OF THE INVENTION It is an object of the present invention to solve various problems including the above problems, and it is very difficult to classify species by the naked eye, and it is very difficult to discriminate species by the naked eye, and a genetic marker capable of quickly and accurately discriminating the species of cynoglossidae And to provide a discrimination method. However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention, there is provided a nucleic acid amplification kit comprising a species-specific forward primer consisting of one or more nucleic acid sequences selected from the group consisting of SEQ ID NOS: 3 to 12 and a common reverse primer consisting of the nucleic acid sequence set forth in SEQ ID NO: Lt; RTI ID = 0.0 > a < / RTI > species specific PCR kit.

According to another aspect of the present invention, there is provided a DNA amplification step of amplifying a genomic DNA of a sample to be discriminated by using a species-specific PCR kit for discriminating the genus Syrup and the species; An electrophoresis step of electrophoresing the amplified DNA fragment; And analyzing a band pattern of the electrophoresed DNA fragment.

According to the embodiment of the present invention as described above, it is possible to realize the effect of distinguishing the chorus and fish species that can be discriminated specifically and rapidly and accurately compared with the conventional method. Of course, the scope of the present invention is not limited by these effects.

FIG. 1 is a graph showing homology of Clostal W program of Bioedit platform based on the nucleotide sequence of the COI region of mitochondria of chondrus and fish according to an embodiment of the present invention.
FIG. 2 is a graph (a to c) of analyzing a haplotype of a species using a DNA Sequence Polymorphism (DnaSP, ver. 5.10.01) program according to an embodiment of the present invention.
FIG. 3 is a gel photograph of ten kinds of PCR amplification products observed in Chosoda University through multiplex PCR analysis using species-specific primers according to an embodiment of the present invention.
FIG. 4 is a photograph showing a result of measurement of a detection limit concentration by a species-specific primer in order to verify the reliability of the intermediate PCR assay according to an embodiment of the present invention.

Definition of Terms:

As used herein, "Cynoglossidae" is one of the early fish belonging to the flounder and contains more than 140 species in three species. It lives mainly in tropical and subtropical shallow waters and triangular rivers, and some species are found deep in the sea bed. Senegal Seodae, Bukdae, Seokseongdae, Seokseongdae, Sujeodae, Yongseodae, Joseodae, Seodae, Seodaedae, Bokseupdae, and black atmospheres.

As used herein, "species-specific PCR" is used to identify species in the same genus or subspecies by using species-specific sequences in the mitochondrial 16S rRNA gene, Technique. The most important factor in determining the accuracy of species-specific PCR assays is the design of primers. Generally, the design of the specific primer is simple because of the genetic difference in the genus of the different genus. However, it is difficult to find the specific gene in the same genus among the similar species. In order to establish the conditions for multiplex PCR, annealing temperature conditions of species-specific primers should be the same, nonspecific PCR reaction should not occur, and the PCR amplification products must be different in size, Must meet.

As used herein, "cytochrome c oxidase I (COI)" is a gene in mitochondria, which is a DNA marker that is often used to classify species because it has a faster evolution rate than DNA in the nucleus. In general, mtDNA is more effective for species-specific sequencing than DNA in nuclei, because it has a higher rate of evolution than nuclear DNA (nDNA) and a large number of mtDNA in one cell.

DETAILED DESCRIPTION OF THE INVENTION [

According to one aspect of the present invention, there is provided a nucleic acid amplification kit comprising a species-specific forward primer consisting of one or more nucleic acid sequences selected from the group consisting of SEQ ID NOS: 3 to 12 and a common reverse primer consisting of the nucleic acid sequence set forth in SEQ ID NO: Lt; RTI ID = 0.0 > a < / RTI > species specific PCR kit.

The species-specific PCR kit for distinguishing between the joystick and the species comprises a species-specific forward primer set each consisting of a nucleic acid sequence represented by SEQ ID NO: 3 to 12 and a common reverse primer consisting of a nucleic acid sequence represented by SEQ ID NO: 2 It can be used for multiple PCR reactions.

According to another aspect of the present invention, there is provided a DNA amplification step of amplifying a genomic DNA of a sample to be discriminated by using a species-specific PCR kit for discriminating the genus Syrup and the species; An electrophoresis step of electrophoresing the amplified DNA fragment; And analyzing a band pattern of the electrophoresed DNA fragment.

The morphological analysis of the Chosseongdae and the fishes was very similar, which made it difficult to distinguish the species. Recently, however, molecular biologic studies have supported the clarification of species. In order to solve this problem, RFLP-PCR and RAPD-PCR using nonspecific primers have been used to discriminate species through mitochondrial gene sequencing. However, there are limits to the number of species that can be analyzed because many genetic loci are required to identify each species. However, in the case of multiple PCR analysis, it is possible to discriminate several species quickly and accurately by using a lower cost and a single PCR reaction. Therefore, it has been recently shown that discrimination of food using species-specific sequences in mitochondrial 16S rRNA gene, discrimination of squid species, It is widely used in analysis methods for aquatic products and processed foods, such as discrimination of origin. The most important factor that determines the accuracy of species-specific PCR analysis is the design of primer. Generally, the genetic difference is large in different genus, so the design of specific primer is simple. However, among the species of same genus, Is difficult to find. In order to establish the conditions for multiplex PCR, annealing temperature conditions of species-specific primers should be the same, nonspecific PCR reaction should not occur, and the PCR amplification products must be different in size, Must meet. The inventors of the present invention have focused on this point and found that the nucleotide sequence of the cytochrome c oxidase I region of the mitochondrial DNA of Chosoda University and fishes registered in the NCBI database, which is useful for studying the phylogeny relationships between the species, We have developed a genetic marker for rapid and accurate identification of fish species by analyzing the interspecific relationships between 10 kinds of chopsticks and fishes which are difficult to distinguish morphologically using primers.

Hereinafter, the present invention will be described in more detail by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

Example 1: Preparation of materials

The experimental strains used in the present invention were imported from Spain, Bangladesh and Mozambique three times from July 2013 to April 2014, and were stored at the National Bioscience Institute of Bioscience and Biotechnology, , 40 samples of samples from large scales, large scales, long scales, and large scales) and 5 species of fishes from the Pukyong National University Marine Fish Resource Donation Registration and Preservation Agency (forgiveness, 15) were used, and the results are shown in Table 1 below.

designation Scientific name Reference Guinea reformist Cynoglossus monodi National Fisheries College Rewrite Cynoglossus robustus Pukyong National University Long Reversal Band Cynoglossus lingua National Fisheries College Chorus Cynoglossus joyner Pukyong National University Chiller stand Cynoglossus interruptus Pukyong National University inhospitality Cynoglossus semilaevis Pukyong National University Large scales Cynoglossus arel National Fisheries College A large opening Cynoglossus macrolepidotus National Fisheries College Forgiveness Cynoglossus abbreviatus Pukyong National University Senegal Recap Cynoglossus senegalensis National Fisheries College

Example 2: DNA extraction and concentration measurement

According to one embodiment of the present invention, extraction and purification of genomic DNA from experimental fishes are carried out in accordance with the method of Asahida, in which about 50 mg of muscle samples are mixed with 480 의 of TNES-Urea buffer (8M urea, 10 mM Tris-HCl pH7 The reaction mixture was mixed with 20 μl of Proteinase K (20 mg / ml) and incubated at 56 ° C. until the muscle tissue was completely degraded. Then, 500 μl of phenol (25 μl) ): Chloroform (24): isoamyl alcohol (1) was added, vortexed and mixed thoroughly, followed by centrifugation at 13,000 rpm for 10 minutes. After that, the supernatant was transferred to a new tube without mixing with phenol, and then 99.9% ethanol and 0.1-fold 3M sodium acetate were added twice, The reaction was carried out for 30 minutes, centrifuged at 4,000 rpm for 10 minutes, and then the supernatant was removed. Then, 70% alcohol (1 ml) was added, vortexed, and centrifuged at 13,000 rpm for 5 minutes. The ethanol was completely removed and dried at room temperature for 10 minutes. Thereafter, 100 μl of TE-buffer (10 mM Tris-HCl pH 8.0, 500 mM EDTA) was added and 5 μl of RNase (20 ug / ml) was added to dissolve the DNA pellet. Lt; 0 > C for 5 minutes. The extracted and purified genomic DNA was quantitated to a final concentration of 10 ng / μl using a spectrophotometer (NonoVue, GE healthcare, Sweden) and then used in the experiment.

Example 3: Preparation of primer

According to one embodiment of the present invention, the nucleotide sequence of the COI region of the mitochondrion of Chosoji and fishes registered in the NCBI database was prepared and a specific primer was prepared. Specifically, the US National Center for biotechnology Information (NCBI, www.ncbi.nlm.nih) the chamseodae (Cynoglossus) The nucleotide sequence of the mitochondrial DNA analysis of a completely Cynoglossus semilaevis (Accession No. NC012825) of in the register, C . zanzibarensis (Accession No. KJ433559), C. joyneri (Accession No. NC030256), C. gracilis (Accession No. NC028540), C. abbreviates (Accession No. NC014881), C. itinus (Accession No. NC023446), C . lineolatus (Accession No. NC023230), C. puncticeps (Accession No. NC023230), C. bilineatus (Accession No. NC023226) and C. sinicus (Accession No. NC023224) of the Clustal W program Bioedit platform based on gene sequences (Fig. 1). A site having a conserved sequence that was not genetically mutated in the cytochrome oxidase subunit I (COI) gene was selected to produce a primer specific for Chosun University (see Table 2).

primer The base sequence (5 '-> 3') Fragment size SEQ ID NO: Cyno-F TACCTGTGATAATTACACG 1420bp
One Cyno-R GTTCGTACGAAAGACGGTTC 2

Example 4: Genetic analysis

Gene analysis was carried out using the chorus and specific primers prepared in Example 3 according to an embodiment of the present invention. 20 μl of the PCR mixture for amplification consisted of 1 μl of 10 pM primer, 2 μl of 10 × Takara buffer, 0.8 μl of dNTP, 0.2 μl of Takara Ex Taq, 14 μl of distilled water and 1 μl of DNA. Denaturation for 7 minutes, followed by 35 cycles of 94 ° C for 45 seconds, 60 ° C for 45 seconds, 72 ° C for 1 minute, and finally extension at 72 ° C for 7 minutes. Then, 2 μl of the PCR reaction product was amplified on 1% agarose gel using 1 × redsafe (iNtRON, South Korea). The amplified PCR product was subjected to Expin PCR SV (GeneAll Biotechnology, South Korea).

Sanger sequencing was performed using 1 μl of the purified PCR reaction, 2 μl of 5 × BigDye therminator v1.1 (Applied Biosystems) sequencing buffer, 0.8 μl of BigDye terminator reaction mix v1.1, 1 μl of 0.1 pM forward or reverse primer, 5.9 μl of distilled water was used as a total of 10 μl of reaction solution. Sequencing PCR conditions were denatured at 96 ° C for 2 minutes, and repeated 25 times at 96 ° C for 15 seconds, at 50 ° C for 5 seconds, and at 60 ° C for 2 minutes in total. 1 μl of 50 mM EDTA (pH 8.0), 1 μl of 600 mM sodium acetate (pH 5.2) and 25 μl of 99.9% ethanol were added to the above sequencing PCR reaction, centrifuged at 4 ° C. and 3,000 rpm for 45 minutes Respectively. After washing with 70% ethanol and drying at room temperature for 10 minutes, 10 μl of Hi-Di formamide was dissolved in DNA pellet and sequenced with ABI 3500 Genetic Analyzer (Applied Biosystems).

Example 5: Sequence analysis and preparation of species-specific primers

Sequence analysis was performed using SeqMan software (Madison, USA) of DNASTAR program according to one embodiment of the present invention. The nucleotide sequences obtained through the forward and reverse primers were combined into a single sequence and the haplotypes were analyzed using the DNA Sequence Polymorphism (DnaSP, ver. 5.10.01) program. Single nucleotide polymorphism (SNP) gene sites were identified (FIG. 2), in which the nucleotide sequences of all individuals were identical and the differences were found between species. Based on the obtained sequence, an optimal primer site was selected with a sequence difference of about 100 bp or more between species, and a species-specific forward primer for 10 species of chimpanzee and fish was placed at the 3 'end of the species-specific single base polymorphism gene (See Table 3).

Scientific name designation The base sequence (5 '-> 3') Fragment size (bp) SEQ ID NO: C. monodi F-MON AATAGTTGGAACCGCTCTT 1483 3 C. robustus F-ROB TACCCATCATAATCGGAGGG 1307 4 C. lingua F-LIN GCTGGTACAGGTTGAACTGTC 1198 5 C. joyner F-JOY GGGGCAATCAATTTTATTACC 1084 6 C. Interruptus F-INT GGGCATCACTATGCTCCTT 952 7 C. semilaevis F-SEM CTATTCTTTATCAACACCTATTCTGG 874 8 C. arel F-ARE TTATATGGGTATAGTATGGGCC 754 9 C. macrolepidotus F-MAC TTGTTCTCTCTAACTCTTCCCTG 493 10 C. abbreviatus F-ABB CATTTCCTGGTAATATTCCTAGGT 322 11 C. senegalensis F-SEN AGTCTCATCCATCGGCTCT 208 12

Example 6: PCR reaction conditions

In order to establish the species specificity of the primers prepared according to one embodiment of the present invention, PCR was performed using 10 kinds of Western-dominant DNA as a template. First, gradient PCR was performed to determine the maximum limit of binding temperature, and Takara EX Taq was used. PCR was carried out in a pre-denaturation step at 94 ° C for 7 minutes, denaturation at 94 ° C for 45 seconds, and annealing at 52 ° C, 54 ° C, 56 ° C, 58 ° C, The incubation was carried out for 35 cycles at 45 ° C for 1 minute and 72 ° C for extension. The final extension was carried out at 72 ° C for 7 minutes. The amplified PCR product was electrophoresed on 1% agarose gel to confirm amplification. The primer combinations used were the Senegal Reversal Versus Sen-208 / CR, the Forgiveness Versus Abb-322 / CR, the Larger Revelation Versus Mac-493 / CR, the Larger Scale Revelation Are-754 / CR, the Sem-874 / CR, -952 / CR, Joy-1084 / CR, Lin-1198 / CR, Rev. Rob-1307 / CR and Guinea rewind were performed using Mon-1483 / CR.

Example 7: Measurement of primer sensitivity

In order to determine the minimum detection concentration of species specific primers for discrimination of convective species according to an embodiment of the present invention, 10 kinds of genomic DNAs of 10 convection types were added at a concentration of 50 ng / μl, 5 ng / μl, 0.5 ng / μl , 0.05 ng / μl, and sensitivity was measured by single PCR and multiplex PCR. Takara EX Taq was used for PCR as described above. After confirming the same amplification conditions for each primer, multiplex PCR was performed. In the case of multiplex PCR, Sen-208 / Abb-322 / Mac-493 / Are-754 / Sem-874 / Int-952 / Joy-1084 / Lin-1198 / Rob -1307 / Mon-1483 / CR After mixing 10 forward primers, 30 samples were analyzed, and reverse primers (Cyno-R, SEQ ID NO: 2) were commonly used. PCR was carried out by pre-denaturation at 94 ° C for 7 minutes, denaturation at 94 ° C for 45 seconds, annealing at 60 ° C for 45 seconds, extension at 72 ° C for 1 minute And the final extension was carried out at 72 ° C for 7 minutes.

As a result, as shown in Fig. 3, PCR amplification product of 10 different species of Chosama and 10 fish species was observed through multiplex PCR analysis and nonspecific amplification was not observed. In order to verify the reliability of the established multiplex PCR assay, the type of DNA was quantitated at 10 ng / μl and diluted 10-fold to determine the detection limit concentration by the species-specific primer. As a result, as shown in FIG. 4, Senegal red and black chickens were detected up to 1 ng / μl, and it was confirmed that up to 0.1 ng / μl was detected in the forgiveness zone, large rewarming zone, large scale rewinding zone, thinning zone, chorus zone, long rewriting zone, rewarming zone and guinea rewarming zone .

Therefore, when a kit according to an embodiment of the present invention is used, it is possible not only to identify the species by reacting the individual primer pairs in a separate reaction vessel, but also to use a common reverse primer and determine the binding position of the forward primer to the size of the band , It is possible to discriminate a kind of multiplex PCR including 9 species-specific primers at the same time, even if it is carried out in a single reaction vessel and belong to a species belonging to a species group, It is possible.

In conclusion, the multiplex PCR analysis by species-specific primers designed in accordance with one embodiment of the present invention showed excellent discrimination against 10 species of fishes and 10 species of fishes which are difficult to distinguish with the naked eye and has excellent sensitivity and specificity, Can be used as an effective way to enable accurate taxonomy of aquatic products import and export and distribution management.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> Republic of Korea represented by National Fisheries Research & Development Institute <120> Genetic markers and methods for identifying belonging to          Cynoglossidae <130> PD16-5406 <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Cyno-F <400> 1 tacctgtgat aattacacg 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cyno-R <400> 2 gttcgtacga aagacggttc 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> F-MON <400> 3 aatagttgga accgctctt 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ROB <400> 4 tacccatcat aatcggaggg 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-LIN <400> 5 gctggtacagt gttgaactgt c 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-JOY <400> 6 ggggcaatca attttattac c 21 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> F-INT <400> 7 gggcatcact atgctcctt 19 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> F-SEM <400> 8 ctattcttta tcaacaccta ttctgg 26 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> F-ARE <400> 9 ttatatgggt atagtatggg cc 22 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F-MAC <400> 10 ttgttctctc taactcttcc ctg 23 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> F-ABB <400> 11 catttcctgg taatattcct aggt 24 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> F-SEN <400> 12 agtctcatcc atcggctct 19

Claims (3)

A Cynoglossus monodi , a Cynoglossus monodi , a Cynoglossus monodi , a Cynoglossus monodi , a Cynoglossus monodi , a Cynoglossus monodi , a Cynoglossus monodi , Cynoglossus robustu s), long rewritten for (Cynoglossus lingua), chamseodae (Cynoglossus joyneri), Chilseo for (Cynoglossus interruptus), thin ribbons (Cynoglossus semilaevis), large scale rewriting for (Cynoglossus arel), largemouth rewritten for (Cynoglossus macrolepidotus), forgiveness A PCR kit for the identification of chimpanzees and species selected from the group consisting of Cynoglossus abbreviatus and Cynoglossus senegalensis . The method according to claim 1,
A multiplex PCR reaction comprising a species-specific forward primer set consisting of the nucleic acid sequence shown in SEQ ID NO: 3 to 12 and a common reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 2, Specific PCR kit. A DNA amplification step of amplifying a genomic DNA of a sample to be discriminated using a specie-specific PCR kit for discriminating species and a species discrimination according to claim 1 or 2;
An electrophoresis step of electrophoresing the amplified DNA fragment; And
Comprising the steps of analyzing the band pattern of the electrophoresis, the DNA fragment, guinea rewritten for (Cynoglossus monodi), rewritten for (Cynoglossus robustus), a long rewriting for (Cynoglossus lingua), chamseodae (Cynoglossus joyneri), Chilseo for (Cynoglossus interruptus), thin ribbons (Cynoglossus semilaevis), large scale rewriting for (Cynoglossus arel), largemouth rewritten for (Cynoglossus macrolepidotus), forgiveness for (Cynoglossus abbreviatus) and three naegal rewritten for (tonguefish compound selected from the group consisting of Cynoglossus senegalensis) Identification method.

Images