KR102168820B1 - Genetic markers and methods for identifying species belong to genus Takifugu - Google Patents

Abstract

The present invention provides: a genetic marker for identifying Takifugu chinensis sp. fish species which can species-specifically, and quickly and accurately identifying six species of Takifugu chinensis sp. which are difficult to classify with the naked eye due to various morphological changes; and an identification method.

Description

Genetic markers and methods for identifying species belong to genus Takifugu}

The present invention relates to a genetic marker for discriminating a species of the genus Chambokki, and more particularly, to a genetic marker and a method for discriminating a species of Chambokki.

Tetratodontidae fish are found in fresh and brackish water in tropical and temperate coastal regions. Many genus Takifugu are economically important edible fish due to their unique taste and high market value, but are often difficult to classify due to various morphological changes (Tyler, Osteology, NOAA Tec Rep NMFS Cir 434:422 pp. , 1980) Because classification mistakes can lead to poisoning, accurate end determination is important. Within the genus Takifugu , most pufferfish species of the genus Takifugu contain tetrodotoxins, which are highly toxic to various organs, including human liver and ovaries. Toxicity varies considerably across regions and seasons, so an incorrect classification of the genus Psyllium can lead to a risk of tetrodotoxin poisoning. The Korea Food and Drug Administration approved only 21 domestic and imported clothing species, but some of the above species are very similar in shape, making it difficult to distinguish them with the naked eye. Therefore, it is urgent to develop a molecular genetic method for simple, fast and effective identification of six species of Genus Takifugu , which are commonly consumed in Korea. Previous studies have applied morphology and composition analysis to determine species used in aquatic products, and more recently diagnostic polymorphic sites have been used to identify closely related species (Kim et al., J. Fd. Hyg. Safety , 29: 347-355. 2014). However, the molecular-based method for determining the species of pufferfish species of Genus Takifugu is still insufficient (Luekasemsuk et al., Toxicon 102:43-47. 2015). In this regard, Japanese Patent Application Laid-Open No. 2006-254853 discloses a method for identifying blowfish species.

However, in the case of the prior art, since the identification using a total of nine restriction enzymes including Eco RV after PCR amplification, the identification method is complicated and it is difficult to expect accurate identification efficiency.

The present invention is to solve a number of problems, including the above problems, and 6 species ( T. pardalis ( T. pardalis )) belonging to genus Takifugu , which are difficult to classify with the naked eye due to various morphological changes. , T. porphyreus (sword), T. niphobles (boxes), T. poecilonotus (white spots ), T. rubripes ( scarces ), and T. xanthpterus ( magpies )) species-specifically, simultaneously, quickly and accurately. It is an object of the present invention to provide a genetic marker and a method for discriminating a fish species of the genus Pseudomonas. However, these problems are exemplary, and the scope of the present invention is not limited thereby.

According to an aspect of the present invention, a first forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 1; A second forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 2; A third forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 3; A fourth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 4; A fifth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 5; A sixth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 6; And there is provided a species-specific multiplex PCR kit for discriminating a species of genus Chambok, comprising a universal reverse primer composed of a nucleic acid sequence represented by SEQ ID NO: 8.

According to another aspect of the present invention, genomic DNA extraction step of extracting genomic DNA from blowfish; DNA amplification step of amplifying genomic DNA extracted with the PCR kit; An electrophoresis step of performing electrophoresis on the amplified DNA product; And analyzing the band pattern of the electrophoretic DNA.

According to an embodiment of the present invention made as described above, using a genetic marker for discriminating species of the genus Chunbok, the species that can accurately discriminate at the same time 6 species of the genus Chunbok which is difficult to classify with the naked eye due to various morphological changes The effect can be implemented. Therefore, it can be used as a tool that can contribute to the establishment of a safe fishery management and distribution system. Of course, the scope of the present invention is not limited by these effects.

1A is a diagram showing nucleotide alignment and sequence information of the mtDNA COI region for determining the species of six species of the genus Psyllium of the present invention. The red box indicates the designed primer set.
1B is a diagram showing nucleotide alignment and sequence information of the mtDNA COI region to determine the species of six species of the genus Psyllium of the present invention.
1C is a diagram showing nucleotide alignment and sequence information of the mtDNA COI region for the determination of the species of six species of the genus of the present invention.
2 is a gel photograph showing a product generated after performing multiple PCR using the universal primer and species-specific primer of the present invention. (A) universal primer, (B) species-specific primer (1) template mixture; (2) Takifugu pardalis ; (3) Takifugu porphyreus ; (4) Takifugu niphobles ; (5) Takifugu poecilonotus ; (6) Takifugu rubripes ; (7) Takifugu xanthpterus ; (M) 100 bp DNA ladder (iNtRON, Korea).
Figure 3 is a gel photograph showing the detection sensitivity of six species of the genus Psyllium using the species-specific primer set of the present invention. Samples are as follows: lane (M) 100 bp DNA ladder (iNtRON, Korea); (1) 10 ng; (2) 1 ng; (3) 0.1 ng; (4) 0.01 ng.

Definition of Terms:

The term "puffer fish" used in this document is a marine fish whose body length grows up to 55 cm. The shape is club-shaped and the snout is blunt. The rear end of the caudal fin is slightly rounded, and the skin has small thorns and is rough. The back side is dark brown, the belly side is white, and the rear fin is generally black. It has strong external seas and lives in the middle or lower layers, and spawning is known to occur around April-May. It appears in the west and south seas of Korea, and is also distributed in the western coast of Japan, and is mainly used as a raw material or hot water. It has a poison called tetrodotoxin in the ovaries and liver, but there is no poison to the testes, muscles, and skin.

The term "haplotype" used in this document refers to a set of statistically related single nucleotide polymorphis (SNPs) within the same gene region, through genetic mutation analysis between similar haplotypes. Used to define genetic populations.

As used herein, "Cytochrome Oxidase subunit I (COI)" is a gene in mitochondria and is a DNA marker that is frequently used when classifying species. Mitochondrial DNA carries out maternal inheritance, and genetic recombination does not occur. It is widely used in In particular, the Cytochrome Oxidase subunit I (COI) gene is widely used as a DNA barcode for end-discrimination markers in many species including fish.

As used herein, "primer" refers to a single-stranded specific oligonucleotide having a base sequence complementary to a target base sequence specific to the species to be detected.

Detailed description of the invention:

According to an aspect of the present invention, a first forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 1; A second forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 2; A third forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 3; A fourth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 4; A fifth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 5; A sixth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 6; And there is provided a species-specific multiplex PCR kit for discriminating a species of genus Chambok, comprising a universal reverse primer composed of a nucleic acid sequence represented by SEQ ID NO: 8.

In the species-specific multiplex PCR kit for discrimination of species of the genus Chamboks, the species of genus Chamboks are Takifugu pardalis , Takifugu porphyreus , Takifugu niphobles , Takifugu poecilonotus , and Takifugu rubripes ) and blackcurrant ( Takifugu xanthpterus ).

According to another aspect of the present invention, genomic DNA extraction step of extracting genomic DNA from blowfish; DNA amplification step of amplifying genomic DNA extracted with the PCR kit; An electrophoresis step of performing electrophoresis on the amplified DNA product; And analyzing the band pattern of the electrophoretic DNA.

In the method for determining a species of the genus Psyllium, the step of analyzing the band pattern of the DNA is Takifugu pardalis when a band of 897 bp is identified, and when a band of 822 bp is identified, a band of Takifugu porphyreus and 667 bp is If confirmed, it is determined as boxome ( Takifugu niphobles ), if a band of 454 bp is identified, white spots ( Takifugu poecilonotus ), if a band of 366 bp is identified, it is determined as Takifugu rubripes ( Takifugu rubripes ), and if a band of 230 bp is identified, it is determined as Takifugu xanthpterus . This can be done by doing and amplifying genomic DNA by multiplex PCR.

Blowfish ( Takifugu spp. ) is an economically important edible marine fish, but it is toxic, so classification errors can lead to poisoning, so accurate species determination is important. In addition, since the COI (cytochrome c oxidase subunit I) gene region is simpler than DNA sequence analysis, it has been widely applied to gene identification of animals including fish, and it has been reported that the discrimination effect on end-of-stage discrimination has been improved in previous studies (Caner et al. ., Eur.Food Res. Technol., 243:49-57. 2017). On the other hand, the MSS (multiplex species-specific)-PCR method is economical in terms of time, effort, and cost compared to other DNA-based methods, and is characterized by being able to provide clear end determination and repeatable results (Noh et al. J. Life Sci., 7: 746-753. 2017).

Accordingly, the present inventors used the mtDNA COI gene to use the mtDNA COI gene to be legally sold in Korea, which are six species of pufferfish of the genus T. pardalis (zolbok), T. porphyreus (swordfish), T. niphobles (boksom), T. poecilonotus (white spot ), and Specific primers were designed for T. rubripes (purple coat ), and T. xanthpterus ( black coat ), and multiple PCR (MSS-PCR) was performed using species-specific primers with excellent sensitivity and specificity. Visualization using agarose gel electrophoresis to obtain accurate contrasts of the six species of the genus T. pardalis was 897 bp, T. porphyreus was 822 bp, T. niphybles was 667 bp, T. poecilonotus was 454 bp, T. rubripes was 366 bp and T. xanthpterus produced a PCR product of an amplified fragment of 230 bp in length, and it was confirmed that the six species can be quickly identified simultaneously by an easy method, thereby completing the present invention. The present invention is the first study to prove that it is possible to efficiently discriminate 6 species of the genus Chambokki that are generally imported into the fish market in Korea using conventional PCR amplification. Therefore, the genetic marker for discriminating fish species in the genus Chambok according to the present invention can be utilized as a tool for preventing mislabeling of fishery resources, protecting consumers' rights, and reducing the risk of poisoning caused by blowfish.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but may be implemented in various different forms, and the following embodiments make the disclosure of the present invention complete, and the scope of the invention to those of ordinary skill in the art. It is provided to fully inform you.

Example 1: Sample collection

For genetic analysis, the present inventors described six species of genus Takifugu stored in the National Institute of Fisheries Science (NIFS) and/or the Korea Marine Fish Resources Bank (MFRBK), T. pardalis (Solbok, n=8), T. porphyreus (Sword Bok). , n=28), T. niphobles (boxyme, n=8), T. poecilonotus (white spot , n=6), T. rubripes (purple coat , n=23) and T. xanthpterus ( magpie , n=198 ), muscle tissue samples were collected and morphological characteristics were confirmed.

Example 2: Genomic DNA extraction

The present inventors stored the muscle tissue sample obtained in Example 1 in 99.99% ethanol until DNA was extracted. Thereafter, total genomic DNA was extracted from each of the samples using an automatic DNA extraction system (MagExtractor MFX-6100, Toyobo, Osaka, Japan). Thereafter, genomic DNA was quantified using a spectrophotometer (Nanodrop ND-1000, Thermo Fisher Scientific, USA) and stored at about -20°C until gene analysis.

Example 3: Sequence analysis

The present inventors analyzed the complete sequence of the mtDNA COI genes of six species of the genus Chambok, registered with the National Center for Biotechnology Information (NCBI). To identify interspecies and intraspecies variations and conserved regions, BioEdit v. Analysis was performed using the 7.0.0 software. The registration information of the six species of the genus Chambok are as follows: T. pardalis (GenBank accession no., AP009528.1), T. porphyreus ( KY514076.1), T. niphobles (KY514069.1), T. poecilonotus (AP009539) .1), T. rubripes (KP641572.1), and T. xanthpterus (KP641579.1). However, the genetic information of the six species of the genus Psyllium is representative, and information on intraspecies variation is not reflected at all. Therefore, when a primer is designed with only the reference sequence information, if there is an intraspecies mutation in the corresponding primer site, a false negative determination may occur. Accordingly, the present inventors designed unique universal reverse primers (Taki-F35, Taki-R1232) for six species of Takigidae by referring to the sequence of the registration information (FIGS. 1A to 1C ). SeqMan software (DNASTAR, USA) was used to analyze the forward and reverse sequences of 6 species of the genus Genus for universal primers, and a single nucleotide polymorphism (SNP) exhibiting species-specificity was determined, excluding intraspecies point mutations. I searched. Thereafter, a species-specific forward primer for each target species in which the SNP is located at the 3'-end was designed (see Table 1).

Using the general purpose reverse primer pair, DNA obtained from a total of 271 individuals of the genus Psyllium was amplified as a template, and a 1,252 bp long DNA of the mtDNA COI region was amplified. And DNA Sequence Polymorphism (DnaSP) v.5.10.01 software was used to analyze the haplotype of the COI gene of the individuals.

As a result, the haplotypes of the 6 kinds of COI genes in the genus T. porphyreus (n=28) were 4 kinds, in the case of T. niphobles (n=8), 7 kinds, and in the case of T. poecilonotus (n=6) There were 4 types of cases, 6 types of T. rubripes (n=23) and 32 types of T. xanthpterus (n=198). Excluding gene mutations within the species, species-specific SNPs are based on 1,252 bp long DNA, respectively, at position 352 (JB352), position 425 (GB425), position 586 (BS586), position 796 (HJB796), It was observed at positions 883 (JJB883) and positions 1,028 (GCB1028) (Figs. 1A to 1C). In addition, no intraspecies mutation was found within the primer sequence containing the species-specific SNP. The sequence information of the species-specific primers for the six species of fish of the genus Psyllium of the present invention, including the universal primers, are summarized in Table 1 below.

Species-specific primer sequence of multiple PCR Sequence number primer Sequence (5' -> 3') Product size (bp) Peculiar species One JB352 TTCTGACTACTTCCCCCG 897 T. pardalis 2 GB425 ACGGTTTACCCACCCT 822 T. porphyreus 3 BS586 GTACCAAACACCTCTTTTCGTA 667 T. niphobles 4 HJB796 CGGCTTCGGAATAATCTCG 454 T. poecilonotus 5 JJB883 GCCATCGGTCTTCTTGGT 366 T. rubripes 6 GCB1028 TCGCAACCTTACATGGG 230 T. xanthpterus 7 Taki-F35 GCAATCACACGCTGATT 1,197 common primer
(genus Takifugu ) 8 Taki-R1232 AYAATAGTGGGAARCAGTG

Example 4: Sequencing Analysis

PCR amplification for sequencing analysis according to an embodiment of the present invention is 2 μL genomic DNA (20 ng), 0.6 μL dNTP (250 μM), PCR is 2 μL 1x PCR buffer containing 2 mM MgCl ₂ , 0.4 μL 10 pmol Forward primer, 0.4 μL 10 pmol reverse primer, 0.2 μL 0.5 U DNA Taq (Anti-HS Taq, TNT Research, Seoul) containing 20 μL total volume. In addition, PCR amplification conditions were performed under the following conditions using an ABI 2720 Thermal Cycler: initial denaturation at 95° C. for 10 minutes; 37 cycles of 45 seconds at 94°C, 45 seconds at 58°C, and 1 minute at 72°C; And final extension at 72° C. for 5 minutes. Thereafter, the resulting PCR product was sequenced using an ABI BigDye Terminator Cycle Sequencing Kit (ver. 3.1, Applied Biosystems, Foster, USA, USA) and analyzed with an ABI 3730XL DNA analyzer (Applied Biosystems).

As a result, it was confirmed that the MSS-PCR products of the six species of fish of the genus Psyllium of the present invention had 100% homology with the expected regions. Primer dimers and non-specific amplification products were not observed, and cross-reactions were not observed between species-specific amplifications in the DNA mixture of 6 species of P.

Example 5: MSS-PCR assay sensitivity test

We performed the MSS-PCR assay sensitivity test using the species-specific primer set of the present invention. Specifically, the sensitivity analysis was performed using 10-fold amplification with serial dilutions of 10 to 0.01 ng/μL genomic DNA from two individuals of each of the six species of Psyllium genus. Specifically, six forward primers (JB352, GB425, BS586, HJB796, JJB883 and GCB1028) and one reverse primer (Taki-R1232, SEQ ID NO: 8) were used under the above-described PCR conditions, and species were subjected to an annealing temperature condition of 60°C. -Specific PCR analysis was performed. After that, the amplified PCR product was subjected to 2% agarose gel electrophoresis (100V, 40 minutes) with 1x RedSafe (iNtRon, Korea), and confirmed using a Gel Doc image analysis system (ATTO Corp., Japan).

As a result, it was shown that the DNA template concentration of the stored product from 6 species of the genus Psyllium was 10 ng/μL, 1 ng/μL, 0.1 ng/μL, and 0.01 ng/μL. It was confirmed that it was detected at a concentration of 1 ng/μL (FIG. 3).

In conclusion, the true subordinate species determination difficult indeed subordinated to the naked eye classified as genetic markers because of a variety of morphological change of the present invention six species T. pardalis, T. porphyreus, T. niphobles, poecilonotus T., T. rubripes and T Since xanthpterus can be quickly and simultaneously identified by multiple PCR analysis based on species-specific mutations with excellent specificity and sensitivity, it is effective to enable accurate species name labeling for import/export and distribution management of seafood for future food safety. It can be used in a way.

The present invention has been described with reference to the above-described embodiments, but these are merely exemplary, and those of ordinary skill in the art will appreciate that various modifications and equivalent other embodiments are possible therefrom. Therefore, the true technical protection scope of the present invention should be determined by the technical spirit of the appended claims.

<110> Republic of Korea represented by National Fisheries Research & Development Institute <120> Genetic markers and methods for identifying species belong to genus Takifugu <130> PD19-5880 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> JB352 <400> 1 ttctgactac ttcccccg 18 <210> 2 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> GB425 <400> 2 acggtttacc caccct 16 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BS586 <400> 3 gtaccaaaca cctcttttcg ta 22 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HJB796 <400> 4 cggcttcgga ataatctcg 19 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> JJB883 <400> 5 gccatcggtc ttcttggt 18 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> GCB1028 <400> 6 tcgcaacctt acatggg 17 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Taki-F35 <400> 7 gcaatcacac gctgatt 17 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Taki-R1232 <400> 8 ayaatagtgg gaarcagtg 19

Claims (5)

A first forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 1;
A second forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 2;
A third forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 3;
A fourth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 4;
A fifth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 5;
A sixth forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 6; And
Takifugu pardalis , Takifugu porphyreus , Takifugu niphobles , Takifugu poecilonotus , Takifugu rubripes , and a universal reverse primer consisting of a nucleic acid sequence of SEQ ID NO: 8 Blackcurrant ( Takifugu xanthpterus ) selected from the group consisting of, species-specific multiplex PCR kit for the identification of species of the genus Pseudomonas . delete Genomic DNA extraction step of extracting genomic DNA from blowfish;
DNA amplification step of amplifying the genomic DNA extracted with the PCR kit of claim 1;
An electrophoresis step of performing electrophoresis on the amplified DNA product; And
Jolbok comprising the steps of analyzing the band pattern of the electrophoresis, DNA (Takifugu pardalis), geombok (Takifugu porphyreus), bokseom (Takifugu niphobles), white divination (Takifugu poecilonotus), Takifugu rubripes (Takifugu rubripes), and kkachibok (Takifugu xanthpterus ) selected from the group consisting of, a method for determining the species of genus Chambokki . The method of claim 3,
The step of analyzing the band pattern of the DNA is Takifugu pardalis when a band of 897 bp is identified, Takifugu porphyreus when a band of 822 bp is identified, and if a band of 667 bp is identified, voxom ( Takifugu niphobles ), 454 When a band of bp is identified, the method is performed by determining white spots ( Takifugu poecilonotus ), when a band of 366 bp is identified, Takifugu rubripes , and when a band of 230 bp is identified, it is determined as Takifugu xanthpterus . The method of claim 3,
A method of amplifying genomic DNA by multiplex PCR.

Images