KR101211068B1 - Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same - Google Patents

Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same Download PDF

Info

Publication number
KR101211068B1
KR101211068B1 KR1020100025431A KR20100025431A KR101211068B1 KR 101211068 B1 KR101211068 B1 KR 101211068B1 KR 1020100025431 A KR1020100025431 A KR 1020100025431A KR 20100025431 A KR20100025431 A KR 20100025431A KR 101211068 B1 KR101211068 B1 KR 101211068B1
Authority
KR
South Korea
Prior art keywords
seq
species
dna sequence
dna
fish
Prior art date
Application number
KR1020100025431A
Other languages
Korean (ko)
Other versions
KR20110106172A (en
Inventor
이윤호
김성
정다금
오지나
Original Assignee
한국해양연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국해양연구원 filed Critical 한국해양연구원
Priority to KR1020100025431A priority Critical patent/KR101211068B1/en
Publication of KR20110106172A publication Critical patent/KR20110106172A/en
Application granted granted Critical
Publication of KR101211068B1 publication Critical patent/KR101211068B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Abstract

본 발명은 대한민국 남해 해역에 서식하는 45종의 주요 어종의 종(species)을 판별하는 방법과, 이를 위한 어류의 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트에 대한 것으로, 어류에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계; 상기 PCR 산물을, 서열번호 7 내지 서열번호 77 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및, 상기 결합 여부에 따라 상기 어류가 속하는 종을 판별하는 단계;를 포함하는 것이 특징이다. 이러한 본 발명은 다양한 어류 종의 종간 염기서열 차이를 기반으로, 대한민국 남해 해역에 서식하는 어류에 대한 유전자형을 분석하고, 간단하고 신속, 정확하게 그것의 종을 판별할 수 있는 효과가 있다. The present invention relates to a method for discriminating species of 45 major fish species inhabiting the South Sea of Korea, and to polynucleotide probes, DNA chips, and kits for discriminating fish species therefor. Performing a polymerase chain reaction (PCR) to obtain a PCR product; Binding the PCR product to a probe each comprising a base sequence identical to or complementary to each DNA sequence of at least one of SEQ ID NO: 7 to SEQ ID NO: 77; And determining the species to which the fish belongs according to whether the combination is present. The present invention has the effect of analyzing the genotype for the fish inhabiting the South Sea of South Korea based on the sequence differences between species of various fish species, and can determine its species simply, quickly and accurately.

Description

대한민국 남해 어류의 종 판별 방법과 이에 따른 어류의 종 판별용 폴리뉴클레오티드 프로브, ＤＮＡ 칩 및 키트{Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same}Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same}

본 발명은 대한민국 남해 해역에 서식하는 45종의 주요 어류의 종(species)을 판별하기 위한 것으로, 특히 다양한 어류 종 간의 염기서열 차이를 기반으로, 대한민국 남해 해역에 서식하는 어류에 대한 유전자형을 분석하고, 간단하고 신속, 정확하게 그것의 종을 판별할 수 있는 어류의 종 판별 방법과 이에 따른 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트에 대한 것이다.
The present invention is to determine the species of 45 major fish species inhabiting the South Seas of the Republic of Korea, in particular, based on the sequence differences between the various fish species, and analyzes the genotype for fish inhabiting the South Seas of South Korea The present invention relates to a species identification method of fish that can determine its species simply, quickly and accurately, and to a polynucleotide probe, DNA chip, and kit for species identification accordingly.

국내외 종래의 생물종 분류연구는 형태의 계측형질, 계수형질을 바탕으로 하고 있다.
Conventional classification studies of both domestic and overseas species are based on metrological traits and traits.

근래에는 형태형질을 이용한 분류 및 계통연구에 많은 문제점들이 발견되어 분자생물학적 기법이 활발하게 도입되고 있다. 이 방법은 성체를 중심으로 이루어진 기존의 형태분류의 단점을 보완하는 것으로 발생초기 생물종 혹은 가공된 개체의 경우와 비교할 수 있어 이점으로 작용하고 있다.
Recently, many problems have been discovered in classification and phylogenetic studies using morphology, and molecular biological techniques have been actively introduced. This method compensates for the shortcomings of existing morphological classifications centered on adults, which is an advantage compared to the early species or processed individuals.

하지만, 우리나라 생물다양성과 관련하여 중요 어장으로 꼽히는 대한민국 남해 해역의 다양한 어종에 대하여, 생물다양성 조사를 위한 다양한 생물종을 한번에, 그리고 신속 정확하게 판별할 수 있는 분자 생물학적인 연구는 국내외에서 그 사례를 찾기 어려운 실정이다.
However, in the case of various fish species in the South Sea of Korea, which is regarded as an important fishing ground in Korea's biodiversity, molecular biological research that can quickly and accurately identify various species for biodiversity research at once and at home and abroad is found It is difficult.

본 발명은 대한민국 남해 해역에 서식하는 주요 어류에 대하여 유전자형을 분석하여, 간단하고 신속, 정확하게 상기 어류의 종을 판별할 수 있는 방법을 제공하는 것이 목적이다.
An object of the present invention is to provide a method that can determine the species of the fish simply, quickly and accurately by analyzing the genotype of the major fish inhabiting the South Sea of South Korea.

해당하는 종을 구분하는 데 있어서, 염기서열의 차이가 밝혀졌다고 하더라도 이를 신속 정확하게 분석할 수 있는 표준화된 방법이 있으면 많은 시간과 인적 자원, 비용이 줄어들 수 있다. 본 발명에서는 대한민국 남해 해역에 서식하는 주요 어종 45종 염기서열의 차이를 정확히 파악하고, 이를 근거로 하여 각 종마다 차이가 나도록 폴리뉴클레오티드 프로브를 제작하기 위한 것이며, 이를 포함하는 DNA칩 또는 키트를 이용하여 해당 종에 따른 염기서열 차이를 신속, 정확하게 분석할 수 있는 방법을 제공하고자 한다.
Even if the differences in the base sequences are identified in the classification of the species, the standardized method for analyzing them quickly and accurately can save a lot of time, human resources and costs. In the present invention, to accurately identify the differences between the 45 nucleotide sequences of the major fish species inhabiting the Namhae waters of the Republic of Korea, and to produce a polynucleotide probe to be different for each species based on this, using a DNA chip or kit comprising the same By providing a method that can quickly and accurately analyze the sequence differences according to the species.

또한, 본 발명의 다른 목적은 종간에 염기서열 차이가 있는 부위를 포함하는 15개 내지 30개의 연속적인 뉴클레오티드로 구성된 프로브와, 이것으로 구성된 DNA칩 그리고 이것들을 포함하는 키트를 제공하는 것이다. 이러한 본 발명에 의해, 하나의 슬라이드 위에서 다수의 해당 생물종에 대한 유전자형 분석을 간단하고 신속, 정확하게 검사하는 방법을 제공하기 위한 것이다.
Another object of the present invention is to provide a probe composed of 15 to 30 consecutive nucleotides including a region having a nucleotide sequence difference between species, a DNA chip composed of the probe, and a kit comprising the same. The present invention is intended to provide a simple, fast, and accurate method for inspecting genotypic analysis of a plurality of species on a slide.

본 발명자들은 다양한 종의 미토콘드리아 DNA 중 COI유전자의 종간 염기서열 차이를 근거로 하여, 각 종 마다 특이적으로 결합할 수 있는 최적의 폴리뉴클레오티드 프로브를 제작하고자 한다.
The present inventors intend to produce an optimal polynucleotide probe capable of specifically binding to each species based on the difference in species sequence between COI genes in various species of mitochondrial DNA.

상기한 목적을 달성하기 위한 본 발명에 따른 어류의 종(species) 판별 방법은, 어류에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계; 상기 PCR 산물을, 서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및, 상기 결합 여부에 따라 상기 어류의 종(species)을 판별하는 단계;를 포함하여 이루어지는 것이 특징이다.
In accordance with an aspect of the present invention, there is provided a method for determining species of a fish, the method comprising: obtaining a PCR product by performing a polymerase chain reaction (PCR) on DNA extracted from a fish; Binding the PCR product to a probe each comprising a base sequence identical to or complementary to each DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77; And determining the species of the fish according to the coupling.

그리고, 본 발명의 다른 실시형태는, 서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드로 이루어진 어류의 종(species) 판별용 프로브 세트일 수 있다.
In another embodiment of the present invention, a probe set for discriminating a species of fish consisting of polynucleotides each comprising a nucleotide sequence identical to or complementary to each DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77 Can be.

또한, 본 발명의 또 다른 실시형태는 상기한 프로브 세트를 포함하는 어류의 종(species) 판별용 DNA 칩인 것도 가능하다.
Further, another embodiment of the present invention may be a DNA chip for species determination of fish comprising the probe set described above.

이와 함께, 본 발명의 또 다른 실시형태는 어류의 미토콘드리아 DNA 중 COI 유전자(바람직하게는, 종간 염기서열 차이가 존재하는 DNA 서열 부위)와 결합하는 것으로, 서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 상보적인(complementary) 15-30개의 연속 염기서열을 각각 포함하는 폴리뉴클레오티드로 이루어진 프로브 세트와; 상기 어류의 미토콘드리아 DNA를 중합효소연쇄반응(PCR)으로 증폭시키기 위한 프라이머를 포함하는 것을 특징으로 하는 어류의 종(species) 판별용 키트일 수도 있다.
In addition, another embodiment of the present invention binds to a COI gene (preferably, a DNA sequence region in which species differences exist between species) in mitochondrial DNA of fish, and each DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77 A probe set consisting of polynucleotides each comprising 15-30 contiguous sequences identical or complementary to each other; It may be a kit for determining species of fish, comprising a primer for amplifying the mitochondrial DNA of the fish by a polymerase chain reaction (PCR).

기타 본 발명의 다른 실시형태는 후술하는 본 발명의 실시를 위한 구체적인 내용 및 첨부된 도면에 널리 기재되어 있다.
Other embodiments of the present invention are described in detail in the following description of the embodiments of the present invention and the accompanying drawings.

상기한 본 발명은 대한민국 남해 해역에 서식하는 어류의 다양한 종에 대한 유전자형을 분석하여, 상기 어류의 염기서열 차이를 기반으로, 간단하고 신속, 정확하게 종을 판별할 수 있는 효과가 있다.
As described above, the present invention analyzes genotypes of various species of fish inhabiting the South Sea of Korea, and there is an effect of determining species easily, quickly and accurately based on the difference in the nucleotide sequence of the fish.

즉, 본 발명은 어류의 유전자형으로 구별하기에 가장 적합한 유전자군으로서, 미토콘드리아 DNA 중 COI 유전자를 선택하였고, 거기에 존재하는 종간 염기서열 차이가 있는 부위를 찾아내었으며, 이를 바탕으로 다양한 어류의 종 간에 구별되는 DNA 서열을 임의의 만들어, 어류의 종 판별을 간단하고 용이하게 하였다.
That is, the present invention selected the COI gene from the mitochondrial DNA as the most suitable gene group to distinguish the genotype of the fish, and found the site where there is a difference in the sequence between the species present, based on this Random DNA sequences were distinguished from each other to make species identification of fish simple and easy.

또한, 본 발명은 어류 종 판별용 프로브, 또는 상기 프로브를 포함하는 DNA 칩이나 키트로 제작되어, 육안으로는 종을 분별하기 힘든 유생, 조미 가공물 또는 분말가루 등에 대해서도, 하나의 슬라이드 위에 시료를 올려놓는 것만으로도 그 종을 판별할 수 있는 것이다.
In addition, the present invention is made of a fish species discrimination probe, or a DNA chip or kit including the probe, and the sample is placed on one slide even for larvae, seasoned products, or powdered powder, which are difficult to discriminate with the naked eye. The species can be determined simply by placing it.

또한, 본 발명에 따른 프로브를 사용하여 마이크로어레이 방법을 활용하면, 종래의 방법에 비해 시료를 분석하는 시간이 크게 단축되어, 다량의 시료를 짧은 시간 내에 검사할 수 있다.
In addition, by using the microarray method using the probe according to the present invention, the time required for analyzing the sample is significantly shortened compared to the conventional method, and a large amount of the sample can be inspected within a short time.

도 1은 본 발명의 일 실시예에 따른 대한민국 남해 해역에 서식하는 주요 어종의 미토콘드리아 DNA상의 유전자 배열을 나타내는 모식도이고,
도 2 내지 도 46은 각각 본 발명의 바람직한 실시예에 따른 어류 45종의 미토콘드리아 DNA 중 COI(Cytochrome oxidase subunit I)유전자의 종간 염기서열 차이가 있는 부위를 포함하는 염기서열을 연속적으로 도시한 모식도이고,
도 47은 상기 도 2 내지 46에 나타난 종간 염기서열 차이에 근거하여 제작된 올리고뉴클레오티드 프로브를 포함하는 DNA칩의 구조를 도식화한 모식도이고,
도 48 내지 도 82는 각각 상기 도 47의 DNA칩을 이용하여 본 발명에 따른 올리고뉴클레오티드 프로브와 쥐노래미를 비롯한 주요어종의 PCR 증폭산물을 결합시킨 후의 반응 결과를 나타내는 사진이다.1 is a schematic diagram showing the gene arrangement on the mitochondrial DNA of major fish species inhabiting the South Sea of South Korea according to an embodiment of the present invention,
2 to 46 are schematic diagrams showing consecutive sequences of base sequences including sites of species nucleotide sequence differences of the cytochrome oxidase subunit I (COI) genes among 45 mitochondrial DNAs of 45 kinds of fish according to a preferred embodiment of the present invention. ,
FIG. 47 is a schematic diagram illustrating the structure of a DNA chip including an oligonucleotide probe prepared based on the difference in species sequences shown in FIGS. 2 to 46.
48 to 82 are photographs showing the reaction results after the PCR amplification products of major fish species including the oligonucleotide probe and rat mule according to the present invention using the DNA chip of FIG. 47, respectively.

이하에서는 본 발명의 바람직한 하나의 실시형태를 첨부된 도면을 참조하여 상세하게 설명하기로 한다.
Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings.

본 발명에 따른 어류의 종(species) 판별 방법은, 먼저 어류에 속하는 다양한 해양생물 시료에서 DNA를 추출하고, 이렇게 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계를 거친다.
According to the method for determining species of fish according to the present invention, DNA is first extracted from various marine organisms belonging to the fish, and then, PCR is performed on the extracted DNA to obtain a PCR product. .

상기 시료에서 DNA를 추출하는 것은 시료의 각 조직 혹은 다양한 가공물 등으로부터 다양한 방법에 의해 DNA를 추출할 수 있고, 이는 추출된 DNA를 분석하여 종을 판별하기 위한 것이기 때문에, 상기 시료의 어느 부위에서 DNA를 추출하는지 또는 어떠한 방법으로 추출하는지는 특별히 제한되지 않는다.
Extracting DNA from the sample may extract DNA from various tissues or various processed materials of the sample by various methods, and since DNA is extracted to analyze the extracted DNA, the DNA may be extracted at any part of the sample. Whether or not to extract is not particularly limited.

그리고, 이렇게 추출한 DNA를 PCR로 증폭하는 것 또한 검사 표본을 늘이기 위한 것으로, 증폭산물을 얻는 방법은 특별히 제한되지 않는다. 본 발명이 속하는 기술분야의 당업자에게 알려진 다른 DNA 추출방법이나 증폭방법 또한 본 발명의 범주에 속한다는 것은 명백하다.
In addition, amplifying the DNA thus extracted by PCR is also used to extend the test sample, and the method of obtaining the amplified product is not particularly limited. It is clear that other DNA extraction methods or amplification methods known to those skilled in the art are also within the scope of the present invention.

본 발명자들은 어류의 유전자형으로 구별하기에 가장 적합한 유전자군으로서, 미토콘드리아 DNA 중 COI 유전자를 선택하였고, 거기에 존재하는 종간 염기서열 차이가 있는 부위를 찾아내었으며, 이를 바탕으로 해당 종마다 특이적으로 결합할 수 있는 폴리뉴클레오티드 프로브를 제작할 수 있게 되었다. 이러한 폴리뉴클레오티드 프로브는 해당 생물종의 종간 염기서열 차이를 근거로 제작되었기 때문에, 의도한 종의 DNA와는 결합하지만 이외에 다른 종에는 결합하지 않는 것이 특징이다.
The inventors selected the COI gene from the mitochondrial DNA as the most suitable genotype to distinguish the genotype of the fish, and found a site where there is a difference between the nucleotide sequences present therein. It is now possible to construct polynucleotide probes that can bind. Since these polynucleotide probes are produced based on the differences in the sequence of species of the corresponding species, they are characterized by binding to DNA of the intended species but not to other species.

특히, 본 발명자들은 수많은 연구와 노력 끝에, 대한민국 남해 해역에 서식하는 주요 해양생물 45종의 미토콘드리아 DNA 중 COI 유전자에서 서열번호 7내지 서열번호 77에 해당하는 DNA서열이 각 생물종을 구별하기에 최적으로 적합하다는 것을 확인하였고, 상기 서열번호 7내지 서열번호 77의 DNA서열과 동일하거나 상보적인 염기서열을 가진 폴리뉴클레오티드 프로브를 사용하면, 종래의 다른 어떤 방법보다 현저히 우수하게 각 해당 생물종을 판별할 수 있음을 알 수 있었다.
In particular, the inventors, after numerous studies and efforts, the DNA sequences corresponding to SEQ ID NO: 7 to SEQ ID NO: 77 in the COI gene among 45 mitochondrial DNAs of 45 major marine organisms in the Namhae waters of Korea are optimal for distinguishing each species. When the polynucleotide probe having a nucleotide sequence identical to or complementary to the DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77 is used, the respective species can be distinguished remarkably superior to other conventional methods. I could see that.

이에 따라, 본 발명의 대상이 되는 어류는 특별히 제한되는 것은 아니지만, 대한민국 남해 해역에 서식하는 어종인 것이 바람직하다. 본 명세서에 있어서, "남해" 또는 "남해 해역"이라 함은 한국 남쪽에 있는 바다로서, 대체로 동쪽은 쓰시마섬[對馬島], 서쪽은 흑산도, 남쪽은 제주도를 연결하는 해역을 뜻한다.
Accordingly, the fish that is the subject of the present invention is not particularly limited, but is preferably a fish species inhabiting the South Sea of Korea. In the present specification, "Namhae" or "Namhae Sea Area" is a sea in the south of Korea, and generally refers to a sea area connecting Tsushima Island [對 馬島], the west to Heuksan Island, and the South to Jeju Island.

도 1은 본 발명의 일 실시예에 따른 대한민국 남해 해역에 서식하는 주요 어류의 미토콘드리아 DNA상의 유전자 배열을 나타내는 모식도이고, 여기에 도시된 바와 같은 유전자 중에서도, 본 발명은 특별히 COI 유전자 부위에 존재하는 종간 염기서열 차이가 있는 부위를 이용한 것이며, 이에 따라 상기 어류에서 추출한 DNA는 어류의 미토콘드리아 DNA 중 COI 유전자 부위의 종간 염기서열 차이가 있는 부위를 포함하는 것이 바람직하다.
1 is a schematic diagram showing the gene arrangement on the mitochondrial DNA of the major fish inhabiting the South Sea of South Korea according to an embodiment of the present invention, among the genes shown here, the present invention is a species between the COI gene region The use of a site having a difference in nucleotide sequence, and accordingly, the DNA extracted from the fish may include a site having a difference in species sequence between species of the COI gene site in the mitochondrial DNA of the fish.

도 2 내지 도 46은 각각 본 발명의 바람직한 실시예에 따른 대한민국 남해 해역에 서식하는 주요 어류 45종의 미토콘드리아 DNA 중 COI(Cytochrome oxidase subunit I)유전자의 종간 염기서열 차이가 있는 부위가 포함된 염기서열을 연속적으로 도시한 모식도이다.
2 to 46 are base sequences each containing a region having a difference between the base sequence of the species of the cytochrome oxidase subunit I (COI) gene in the mitochondrial DNA of 45 major fishes inhabiting the South Sea of Korea according to a preferred embodiment of the present invention It is a schematic diagram which shows continuously.

본 발명자들은 수많은 연구와 노력 끝에 어류 DNA의 COI 유전자 중에서, 상기 종간 염기서열 차이가 있는 부위의 DNA를 프로브로 이용하면, 상기 어류의 종을 구별하기에 가장 적합하다는 것을 확인하였다.
The inventors have found that, after numerous studies and efforts, using the DNA of the site having the difference in sequence between the species among the COI genes of the fish DNA is the most suitable for distinguishing the species of the fish.

이에 따라, 본 발명은 상기 종간 염기서열 차이가 있는 부위에 속하는 염기서열, 즉 후술하는 서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 프로브로 이용한 것이다. 이러한 프로브는 어류가 속하는 종에 따라 다른 염기서열 부위를 근거로 제작되었기 때문에, 의도한 어류에 속하는 PCR 시료 산물과는 결합하지만 이외에 다른 종에 속하는 어류의 그것과는 결합하지 않는 것이 바람직하다.
Accordingly, the present invention uses a nucleotide sequence belonging to a site having a difference in nucleotide sequence between species, that is, a nucleotide sequence identical to or complementary to each DNA sequence of SEQ ID NOs: 7 to 77, described later, as a probe. Since these probes are made based on the nucleotide sequences that differ depending on the species belonging to the fish, it is preferable to bind to the PCR sample product belonging to the intended fish, but not to those of fish belonging to other species.

본 발명에 따른 서열번호 7 내지 서열번호 77의 DNA 서열은 하기의 표 1 및 표 2에 나타낸 바와 같다.DNA sequences of SEQ ID NO: 7 to SEQ ID NO: 77 according to the present invention are as shown in Table 1 and Table 2 below.

[대한민국 남해 해역에 서식하는 주요 어류의 종 판별을 위한 DNA 서열(1)][DNA Sequences for the Identification of Species of Major Fishes in the South Sea of Korea (1)] 대한민국 남해 해역에 서식하는 주요 어종 판정을 위한 DNA서열DNA Sequences for Determining Major Fish Species in the South Sea of Korea 프로브 명칭Probe Name DNA서열DNA sequence 반응어종Reactive fish species DNA 서열 위치DNA sequence position R1(서열정보 7)R1 (SEQ ID NO: 7) GTGCTAGGTTACCAGACAGAGGG (antisense)GTGCTAGGTTACCAGACAGAGGG (antisense) 쥐노래미Rat song 385-407385-407 R2(서열정보 8)R2 (SEQ ID NO: 8) GTGCCAGATTACCAGACAGAGGG (antisense)GTGCCAGATTACCAGACAGAGGG (antisense) 줄노래미Rope song 385-407385-407 R3(서열정보 9)R3 (SEQ ID NO: 9) GTTAAGTCAACAGAGGCTCCAGC (antisense)GTTAAGTCAACAGAGGCTCCAGC (antisense) 줄노래미Rope song 410-432410-432 R4(서열정보 10)R4 (SEQ ID NO: 10) CTCTCTTTACCAGTCCTCGCTGCCTCTCTTTACCAGTCCTCGCTGC 조피볼락Zoppybolak 584-606584-606 R5(서열정보 11)R5 (SEQ ID NO: 11) GAGCCGTCCTAATTACCGCTGTTGAGCCGTCCTAATTACCGCTGTT 조피볼락Zoppybolak 552-574552-574 R6(서열정보 12)R6 (SEQ ID NO: 12) GCAGGTATCACAATACTATTGACGCAGGTATCACAATACTATTGAC 개서대Dog stand 605-627605-627 R7(서열정보 13)R7 (SEQ ID NO: 13) GCAGGAATCACCATGCTTTTAACGCAGGAATCACCATGCTTTTAAC 흑대기Black atmosphere 605-627605-627 R8(서열정보 14)R8 (SEQ ID NO: 14) CCCTGTTTTAGCCGCAGGAATCACCCTGTTTTAGCCGCAGGAATCA 흑대기Black atmosphere 592-614592-614 R9(서열정보 15)R9 (SEQ ID NO: 15) GCTGGAATTACTATACTACTCACGCTGGAATTACTATACTACTCAC 참서대Reference 605-627605-627 R10(서열정보 16)R10 (SEQ ID NO: 16) GCAGTACTTATTACAGCAGTTCTGCAGTACTTATTACAGCAGTTCT 참서대Reference 554-576554-576 R11(서열정보 17)R11 (SEQ ID NO: 17) CTTTCACTACCCGTTCTAGCTGCCTTTCACTACCCGTTCTAGCTGC 멸치Anchovy 584-606584-606 R12(서열정보 18)R12 (SEQ ID NO: 18) CTGAGCTGTATTAATCACGGCAGCTGAGCTGTATTAATCACGGCAG 멸치Anchovy 550-572550-572 R13(서열정보 19)R13 (SEQ ID NO: 19) CTCTTCCAGTACTGGCGGCACTCTTCCAGTACTGGCGGCA 청베도라치Cheongbedorachi 588-607588-607 R14(서열정보 20)R14 (SEQ ID NO: 20) GTCTTAGCCGCCGGTATTACAGTCTTAGCCGCCGGTATTACA 앞동갈베도라치Jundong Galvedorachi 596-616596-616 R15(서열정보 21)R15 (SEQ ID NO: 21) CCTGCCCTTACACAGTACCAACCTGCCCTTACACAGTACCAA 돛양태류Sail 515-535515-535 R16(서열정보 22)R16 (SEQ ID NO 22) ATTACGGCTGTCCTACTACTCATTACGGCTGTCCTACTACTC 돛양태류Sail 563-583563-583 R17(서열정보 23)R17 (SEQ ID NO 23) CTGCTACCATGTCTATGTACCCTGCTACCATGTCTATGTACC 노랑각시서대Yellow poem 513-533513-533 R18(서열정보 24)R18 (SEQ ID NO: 24) AGTCCTAGCAGCAGGCATCACAGTCCTAGCAGCAGGCATCAC 노랑각시서대Yellow poem 595-615595-615 R19(서열정보 25)R19 (SEQ ID NO: 25) TTCATCGATCCTAGGGGCAATTTCATCGATCCTAGGGGCAAT 전어Word 460-480460-480 R20(서열정보 26)R20 (SEQ ID NO 26) CCAGCCACTACACAATATCAACCAGCCACTACACAATATCAA 붕장어conger 515-535515-535 R21(서열정보 27)R21 (SEQ ID NO 27) CAGTTTTAGTCACTGCTGTCCCAGTTTTAGTCACTGCTGTCC 갯장어Eel 555-575555-575 R22(서열정보 28)R22 (SEQ ID NO 28) CCCGTGCTTGCGGCAGGAATTCCCGTGCTTGCGGCAGGAATT 황아귀Yellow Maw 593-613593-613 R23(서열정보 29)R23 (SEQ ID NO: 29) CGTGCTTGCGGCAGGAATTACCGTGCTTGCGGCAGGAATTAC 황아귀Yellow Maw 595-615595-615 R24(서열정보 30)R24 (SEQ ID NO: 30) TATAAAACCCCCAGGCACCACTATAAAACCCCCAGGCACCAC 병어Bottle 505-525505-525 R25(서열정보 31)R25 (SEQ ID NO: 31) CAGGCACCACCCAATACCAAACAGGCACCACCCAATACCAAA 병어Bottle 516-536516-536 R26(서열정보 32)R26 (SEQ ID NO: 32) GTTCTGATTACGGCTGTCCTCGTTCTGATTACGGCTGTCCTC 양태류Aspect 557-577557-577 R27(서열정보 33)R27 (SEQ ID NO: 33) TTCTATTAGCCTCCTCTGGGTTCTATTAGCCTCCTCTGGG 보리멸Barley 327-346327-346 R28(서열정보 34)R28 (SEQ ID NO 34) CCTCTCGCTCCCAGTACTTCCTCTCGCTCCCAGTACTT 보리멸Barley 583-601583-601 R29(서열정보 35)R29 (SEQ ID NO: 35) AACGGTATACCCCCCTCTTGCAACGGTATACCCCCCTCTTGC 학공치Academic 373-393373-393 R30(서열정보 36)R30 (SEQ ID NO: 36) ACCACCAGCGATTTCCCAATAACCACCAGCGATTTCCCAATA 학공치Academic 511-531511-531 R31(서열정보 37)R31 (SEQ ID NO: 37) CTCTTGTCCCTCCCAGTTCCTCTTGTCCCTCCCAGTTC 감성돔Black sea bream 581-599581-599 R32(서열정보 38)R32 (SEQ ID NO: 38) GTCACCGCCTTCCTCCTACTAGTCACCGCCTTCCTCCTACTA 군평선이The military line 563-583563-583 R33(서열정보 39)R33 (SEQ ID NO: 39) AGTCCTTGCTGCTGCCATTACAGTCCTTGCTGCTGCCATTAC 군평선이The military line 595-615595-615 R34(서열정보 40)R34 (SEQ ID NO: 40) CCTGATTACCGCCGTCCTCCTCCTGATTACCGCCGTCCTCCT 성대vocal cords 559-579559-579 R35(서열정보 41)R35 (SEQ ID NO: 41) CATGAAACCTCCTGCAGTCTCCATGAAACCTCCTGCAGTCTC 전갱이pompano 505-525505-525 R36(서열정보 42)R36 (SEQ ID NO: 42) GAAACCTCCTGCAGTCTCAATGAAACCTCCTGCAGTCTCAAT 전갱이pompano 508-528508-528 R37(서열정보 43)R37 (SEQ ID NO: 43) CACCATCCACAACCATGTATCCACCATCCACAACCATGTATC 꼬치고기Skewer 513-533513-533 R38(서열정보 44)R38 (SEQ ID NO: 44) TTCTCTGCCTGTGCTGGCTGTTCTCTGCCTGTGCTGGCTG 꼬치고기Skewer 586-605586-605 R39(서열정보 45)R39 (SEQ ID NO 45) CATCTATCTTGGGCGCAATTACATCTATCTTGGGCGCAATTA 달고기John Dory 462-482462-482 R40(서열정보 46)R40 (SEQ ID NO 46) CCAGTACTAGCGGCTGGAATTCCAGTACTAGCGGCTGGAATT 달고기John Dory 593-613593-613 R41(서열정보 47)R41 (SEQ ID NO: 47) TGAGCTGTCCTAATCACTGCCTGAGCTGTCCTAATCACTGCC 열동가리돔East Seabream 551-571551-571 R42(서열정보 48)R42 (SEQ ID NO 48) TGCAGCCGTTTCCCAATACCATGCAGCCGTTTCCCAATACCA 샛돔샛 Dome 514-534514-534 R43(서열정보 49)R43 (SEQ ID NO: 49) GTCTTTACCCGTTCTTGCTGGTCTTTACCCGTTCTTGCTG 샛돔샛 Dome 586-605586-605 R44(서열정보 50)R44 (SEQ ID NO: 50) TTGGCCATCTTCTCCCTACACTTGGCCATCTTCTCCCTACAC 보구치Boguchi 428-448428-448 R45(서열정보 51)R45 (SEQ ID NO: 51) GGTGTCTCTTCTATTCTGGGGGTGTCTCTTCTATTCTGGG 보구치Boguchi 455-474455-474 R46(서열정보 52)R46 (SEQ ID NO 52) CTGTGCTTATTACAGCCGTCCCTGTGCTTATTACAGCCGTCC 망상어Reptile 555-575555-575

[대한민국 남해 해역에 서식하는 주요 어류의 종 판별을 위한 DNA 서열(2)][DNA Sequences for Identification of Species of Major Fishes in the South Sea of Korea] (2) 대한민국 남해 해역에 서식하는 주요 어종 판정을 위한 DNA서열DNA Sequences for Determining Major Fish Species in the South Sea of Korea 프로브 명칭Probe Name DNA서열DNA sequence 반응어종Reactive fish species DNA 서열 위치DNA sequence position R47(서열정보 53)R47 (SEQ ID NO: 53) CTTGTTACAGCTGTTCTGCTTCTTGTTACAGCTGTTCTGCTT 청어herring 560-580560-580 R48(서열정보 54)R48 (SEQ ID NO: 54) TGTGCTAGCTGCCGGAATTACTGTGCTAGCTGCCGGAATTAC 청어herring 595-615595-615 R49(서열정보 55)R49 (SEQ ID NO 55) TAGCAGGAAATCTTGCCCACGTAGCAGGAAATCTTGCCCACG 복섬Bokseom 390-410390-410 R50(서열정보 56)R50 (SEQ ID NO 56) AGGAGCTTCTGTAGACCTTACAGGAGCTTCTGTAGACCTTAC 복섬Bokseom 412-432412-432 R51(서열정보 57)R51 (SEQ ID NO 57) ACCAGTCTTAGCTGCTGGCATACCAGTCTTAGCTGCTGGCAT 숭어mullet 592-612592-612 R52(서열정보 58)R52 (SEQ ID NO 58) GGCCGTTCTTATTACCGCTGTGGCCGTTCTTATTACCGCTGT 참돔Red snapper 553-573553-573 R53(서열정보 59)R53 (SEQ ID NO 59) CCGTTCTTATTACCGCTGTCCCCGTTCTTATTACCGCTGTCC 참돔Red snapper 555-575555-575 R54(서열정보 60)R54 (SEQ ID NO 60) TGTGTGGGCTGTCCTAATTACTGTGTGGGCTGTCCTAATTAC 삼치Mackerel 547-567547-567 R55(서열정보 61)R55 (SEQ ID NO 61) CTTGCAGCCGGAATCACCATACTTGCAGCCGGAATCACCATA 베도라치gunnel 599-619599-619 R56(서열정보 62)R56 (SEQ ID NO 62) TGCAGGTGTGTCCCAATACCATGCAGGTGTGTCCCAATACCA 고등어Mackerel 514-534514-534 R57(서열정보 63)R57 (SEQ ID NO 63) CTACCTGTTCTTGCAGCTGGAATTCTACCTGTTCTTGCAGCTGGAATT 미역치Seaweed 590-613590-613 R58(서열정보 64)R58 (SEQ ID NO 64) GCGGGTATTACTATGCTCCTTACAGCGGGTATTACTATGCTCCTTACA 용치놀래기Sneak 605-628605-628 R59(서열정보 65)R59 (SEQ ID NO: 65) TAGACCTGACAATTTTCTCCCTTTAGACCTGACAATTTTCTCCCTT 홍어skates 423-445423-445 R60(서열정보 66)R60 (SEQ ID NO 66) AGGAATCTCTTCCATCTTGGGCGAGGAATCTCTTCCATCTTGGGCG 갈치Cutlass 454-476454-476 R61(서열정보 67)R61 (SEQ ID NO 67) ACCCAGTTTCAAACCCCTCTGTTACCCAGTTTCAAACCCCTCTGTT 갈치Cutlass 524-546524-546 R62(서열정보 68)R62 (SEQ ID NO 68) TGGTGCCGGCACAGGATGAACTGGTGCCGGCACAGGATGAAC 흘림도다리Shedding Bridge 355-375355-375 R63(서열정보 69)R63 (SEQ ID NO: 69) AAGCTGGTGCCGGCACAGGATAAGCTGGTGCCGGCACAGGAT 흘림도다리Shedding Bridge 351-371351-371 R64(서열정보 70)R64 (SEQ ID NO: 70) TACCCCCCATTGGCCGGTAATTACCCCCCATTGGCCGGTAAT 쑤기미류Scallop 380-400380-400 R65(서열정보 71)R65 (SEQ ID NO: 71) TTGGCCGGTAATCTCGCCCATTTGGCCGGTAATCTCGCCCAT 쑤기미류Scallop 389-409389-409 R66(서열정보 72)R66 (SEQ ID NO 72) CGTACTAATCACCGCCGTTCTCGTACTAATCACCGCCGTTCT 문치가자미Octopus 556-576556-576 R67(서열정보 73)R67 (SEQ ID NO 73) CCTGGCCGCTGGCATTACAATCCTGGCCGCTGGCATTACAAT 문치가자미Octopus 598-618598-618 R68(서열정보 74)R68 (SEQ ID NO 74) TCTGGAGTAGAGGCAGGTGCCTCTGGAGTAGAGGCAGGTGCC 쏨뱅이Earmuff 341-361341-361 R69(서열정보 75)R69 (SEQ ID NO 75) AGTAGAGGCAGGTGCCGGAACAGTAGAGGCAGGTGCCGGAAC 쏨뱅이Earmuff 346-366346-366 R70(서열정보 76)R70 (SEQ ID NO 76) CCCCCTTGTTTGTGTGATCTGCCCCCTTGTTTGTGTGATCTG 노래미/줄노래미Singing / Singing Song 537-557537-557 R71(서열정보 77)R71 (SEQ ID NO 77) CCTCGCTGCGGGCATTACTATCCTCGCTGCGGGCATTACTAT 노래미Singing 598-618598-618

본 발명은 상기 서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하도록 다수의 프로브를 제작할 수 있고, 이러한 프로브 중 적어도 하나 이상을 상기에서 얻은 PCR 산물과 결합시킴으로서, 그 결합 여부에 따라 어류의 종을 판별할 수 있는 것이다.
The present invention can be produced a plurality of probes each containing a base sequence identical or complementary to each of the DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77, at least one or more of these probes PCR products obtained above By combining with, it is possible to determine the species of fish depending on whether the combination.

즉, 본 발명에 있어서, 상기 결합 여부에 따라 상기 어류가 속하는 종을 판별하는 것은, 상기 결합되는 서열번호를 근거로 하여, 서열번호 7의 프로브와 결합하면 쥐노래미(Hexagrammos otakii), 서열번호 8 또는/및 9와 결합하면 줄노래미(Hexagrammos octagrammos) 종인 것으로 판별할 수 있다. 기타 조피볼락(Sebastesschlegelii), 개서대(Cynoglossus robustus), 흑대기(Paraplagusia japonica), 참서대(Cynoglossus joyneri), 멸치(Engraulis japonicus), 청베도라치(Pictiblennius yatabei), 앞동갈베도라치(Omobranchus elegans), 돛양태류(Repomucenus sp.), 노랑각시서대(Zebrias fasciatus), 전어(Konosirus punctatus), 붕장어(Conger myriaster), 갯장어(Muraenesox cinereus), 황아귀(Lophimus litulon), 병어(Pampus argenteus), 양태류(Platycephalus sp.), 보리멸(Hemicentrotus pulcherrimus), 학공치(Hyporhamphus sajori), 감성돔(Acanthopagrus schlegeli), 군평선이(Scomber australasicus), 성대(Chelidonichthys spinosus), 전갱이(Trachurus japonicus), 꼬치고기(Sphyraena pinguis), 달고기(Zeus faber), 열동가리돔(Apogon lineatus), 샛돔(Psenopsis anomala), 보구치(Chionoecetes japonica), 망상어(Ditrema temminckii ), 청어(Clupea pallasii), 복섬(Takifugu niphobles), 숭어(Mugil cephalus), 참돔(Pagrus major), 삼치(Scomberomorus niphonius), 베도라치(Pholis nebulosa), 고등어(Scomber japonicus), 미역치(Hypodytes rubripinnis), 용치놀래기(Halichoeres poecilopterus), 홍어(Okamejei kenojei), 갈치(Trichiurus japonicus), 흘림도다리(Pleuronichthys sp.), 쑤기미류(Inimicus sp.), 문치가자미(Pleuronectes schrenki), 쏨뱅이류(Sebasticus sp.), 노래미/줄노래미(Hexagrammos agrammus/Hexagrammos octagrammos) 및 노래미(Hexagrammos agrammus)에 대해서도 상기 표 1 및 표 2에 기재된 각 서열번호의 염기서열을 포함하는 프로브와의 결합에 따라 그에 맞는 종 판별이 가능하다.
That is, in the present invention, the species to which the fish belongs is determined based on whether the binding is performed based on the sequence number to be bound, when combined with the probe of SEQ ID NO: 7 Hexagrammos otakii , SEQ ID NO: 8 or When combined with / and 9, it can be determined to be Hexagrammos octagrammos species. Other rockfish (Sebastesschlegelii), rewritten for (Cynoglossus robustus), black Standby (Paraplagusia japonica), chamseodae (Cynoglossus joyneri), anchovy (Engraulis japonicus), Zheng gunnel (Pictiblennius yatabei), apdong go gunnel (Omobranchus elegans), dotyangtae flow ( Repomucenus sp. ), Zephyraceae ( Zebrias fasciatus ), Eel ( Konosirus punctatus ), Eel ( Conger myriaster ), Eel ( Muraenesox cinereus ), Eel ( Lophimus litulon ), Eel ( Pampus argenteus ), Seaweed ( Platycephalus sp. ), borimyeol (Hemicentrotus pulcherrimus), hakgongchi (Hyporhamphus sajori), black sea bream (Acanthopagrus schlegeli), gunpyeong line (Scomber australasicus), the vocal cords (Chelidonichthys spinosus), horse mackerel (Trachurus japonicus), barracuda (Sphyraena pinguis), John Dory (Zeus faber ), Apogon lineatus , Pedopsis anomala , Chinoecetes japonica , Ditrema temminckii , Herring ( Clupea pallasii ), Takifugu niphobles , Mullet ( Mugil cephalus ), Red snapper ( Pagrus major ), Swordfish ( Scomberomorus niphonius ), Vedorachi ( Pholis nebulosa ), Mackerel ( Scomber japonicus ), Seaweed ( Hypodytes rubripinnis ), Yellowtail ( Halichoeres poecilopterus ), Redfish ( Okameei ) Trichiurus japonicus , Pleuronichthys sp. ), Inimicus sp. , Pluronectes schrenki , Sesamecus ( Sebasticus sp. ), Hexagrammos agrammus / Hexagrammos octagrammos and Hemigrammos agrammus According to the combination with the probe including the nucleotide sequence of each SEQ ID NO described in 2 it is possible to determine the species.

또한, 본 발명에 따른 상기 프로브는 어류의 미토콘드리아 DNA 중 COI 유전자 부위의 종간 염기서열 차이가 있는 부위와 결합하고, 상기 결합은 상기 어류의 종에 따라 다르게 이루어지는 것이 바람직하다.
In addition, the probe according to the present invention is coupled to the site of the species sequence differences between the COI gene region in the mitochondrial DNA of fish, the binding is preferably made differently depending on the species of the fish.

예를 들어, 상기 결합이 종에 따라 다르게 이루어진다는 것은, 서열번호 7의 염기서열을 포함하는 프로브는 쥐노래미(Hexagrammos otakii) 종의 미토콘드리아 DNA 중 COI 유전자 부위의 385-407번째 DNA 서열과 특이적으로 결합하고, 서열번호 8과 9의 프로브는 줄노래미(Hexagrammos octagrammos) 종의 385-407번째 DNA 서열 및 410-432번째 DNA 서열, 서열번호 10과 11의 경우는 조피볼락(Sebastesschlegelii) 종의 584-606번째 DNA 서열 및 552-574번째 DNA 서열, 서열번호 12의 경우는 개서대(Cynoglossus robustus) 종의 605-627번째 DNA 서열, 서열번호 13과 14의 경우는 흑대기(Paraplagusia japonica) 종의 605-627번째 DNA 서열 및 592-614번째 DNA 서열, 서열번호 15와 16의 경우는 참서대(Cynoglossus joyneri) 종의 605-627번째 DNA 서열 및 554-576번째 DNA 서열, 서열번호 17과 18의 경우는 멸치(Engraulis japonicus) 종의 584-606번째 DNA 서열 및 550-572번째 DNA 서열, 서열번호 19의 경우는 청베도라치(Pictiblennius yatabei) 종의 588-607번째 DNA 서열, 서열번호 20의 경우는 앞동갈베도라치(Omobranchus elegans) 종의 596-616번째 DNA 서열, 서열번호 21과 22의 경우는 돛양태류(Repomucenus sp.) 종의 515-535번째 DNA 서열 및 563-583번째 DNA 서열, 서열번호 23과 24의 경우는 노랑각시서대(Zebrias fasciatus) 종의 513-533번째 DNA 서열 및 595-615번째 DNA 서열, 서열번호 25의 경우는 전어(Konosirus punctatus) 종의 460-480번째 DNA 서열, 서열번호 26의 경우는 붕장어(Conger myriaster) 종의 515-535번째 DNA 서열, 서열번호 27의 경우는 갯장어(Muraenesox cinereus) 555-575번째 DNA 서열, 서열번호 28 및 서열번호 29의 경우는 황아귀(Lophimus litulon) 종의 593-613번째 DNA 서열 및 595-615번째 DNA 서열, 서열번호 30 과 서열번호 31의 경우는 병어(Pampus argenteus) 종의 505-525번째 DNA 서열 및 516-536번째 DNA 서열, 서열번호 32의 경우는 양태류(Platycephalus sp.) 종의 557-577번째 DNA 서열, 서열번호 33 및 서열번호 34의 경우는 보리멸(Hemicentrotus pulcherrimus) 종의 327-346번째 DNA 서열 및 583-601번째 DNA 서열, 서열번호 35 및 서열번호 36의 경우는 학공치(Hyporhamphus sajori) 종의 373-393번째 DNA 서열 및 511-531번째 DNA 서열, 서열번호 37의 경우는 감성돔(Acanthopagrus schlegeli) 종의 581-599번째 DNA 서열, 서열번호 38과 서열번호 39의 경우는 군평선이(Scomber australasicus) 종의 563-583번째 DNA 서열 및 595-615번째 DNA 서열, 서열번호 40의 경우는 성대(Chelidonichthys spinosus) 종의 559-579번째 DNA 서열, 서열번호 41과 서열번호 42의 경우는 전갱이(Trachurus japonicus) 종의 505-525번째 DNA 서열 및 508-528번째 DNA 서열, 서열번호 43과 서열번호 44의 경우는 꼬치고기(Sphyraena pinguis) 종의 513-533번째 DNA 서열 및 586-605번째 DNA 서열, 서열번호 45와 서열번호 46의 경우는 달고기(Zeus faber) 종의 462-482번째 DNA 서열 및 593-613번째 DNA 서열, 서열번호 47의 경우는 열동가리돔(Apogon lineatus) 종의 551-571번째 DNA 서열, 서열번호 48과 서열번호 49의 경우는 샛돔(Psenopsis anomala) 종의 514-534번째 DNA 서열 및 586-605번째 DNA 서열, 서열번호 50과 서열번호 51의 경우는 보구치(Chionoecetes japonica) 종의 428-448번째 DNA 서열 및 455-474번째 DNA 서열, 서열번호 52의 경우는 망상어(Ditrema temminckii ) 종의 555-575번째 DNA 서열, 서열번호 53과 서열번호 54의 경우는 청어(Clupea pallasii) 종의 560-580번째 DNA 서열 및 595-615번째 DNA 서열, 서열번호 55와 서열번호 56의 경우는 복섬(Takifugu niphobles) 종의 390-410번째 DNA 서열 및 412-432번째 DNA 서열, 서열번호 57의 경우는 숭어(Mugil cephalus)종의 592-612번째 DNA 서열 및 서열번호 58과 서열번호 59의 경우는 참돔(Pagrus major)종의 553-573번째 DNA 서열 및 555-575번째 DNA 서열, 서열번호 60의 경우는 삼치(Scomberomorus niphonius)종의 547-567번째 DNA 서열, 서열번호 61의 경우는 베도라치(Pholis nebulosa)종의 599-619번째 DNA 서열, 서열번호 62의 경우는 고등어(Scomber japonicus)종의 514-534번째 DNA 서열, 서열번호 63의 경우는 미역치(Hypodytes rubripinnis)종의 590-613번째 DNA 서열, 서열번호 64의 경우는 용치놀래기(Halichoeres poecilopterus)종의 605-628번째 DNA 서열, 서열번호 65의 경우는 홍어(Okamejei kenojei)종의 423-445번째 DNA 서열, 서열번호 66, 서열번호 67의 경우는 갈치(Trichiurus japonicus)종의 454-476번째 DNA 서열 및 524-546번째 DNA 서열, 서열번호 68과 서열번호 69의 경우는 흘림도다리(Pleuronichthys sp.)종의 355-375번째 DNA 서열 및 351-371번째 DNA 서열, 서열번호 70과 서열번호 71의 경우는 쑤기미류(Inimicus sp.)종의 380-400번째 DNA 서열 및 389-409번째 DNA 서열, 서열번호 72와 서열번호 73의 경우는 문치가자미(Pleuronectes schrenki)종의 556-576번째 DNA 서열 및 598-618번째 DNA 서열, 서열번호 74와 서열번호 75의 경우는 쏨뱅이류(Sebasticus sp.)종의 341-361번째 DNA 서열 및 346-366번째 DNA 서열, 서열번호 76의 경우는 노래미/줄노래미(Hexagrammos agrammus/Hexagrammos octagrammos)종의 537-557번째 DNA 서열, 서열번호 77의 경우는 노래미(Hexagrammos agrammus)종의 598-618번째 DNA 서열과 특이적으로 결합하는 것일 수 있다.
For example, the binding is different depending on the species, the probe containing the nucleotide sequence of SEQ ID NO: 7 is specifically with the 385-407 DNA sequence of the COI gene region of the mitochondrial DNA of Hexagrammos otakii species The probes of SEQ ID NOs: 8 and 9 bind to the 385-407 DNA sequence and 410-432 DNA sequence of Hexagrammos octagrammos species, and 584-606 of Sebastesschlegelii species in SEQ ID NOs: 10 and 11 DNA sequence 552-574, DNA sequence 605-627 for Cynoglossus robustus , SEQ ID NO: 605-627 for Paraplagusia japonica 627- and 592-614 DNA sequences, the 605-627 DNA sequence of the Cynoglossus joyneri species for SEQ ID NOs 15 and 16, and the anchovy for the 554-576 DNA sequence, SEQ ID NOs 17 and 18 ( Engraulis japonicus ) species 584-60 6th DNA sequence and 550-572 DNA sequence, 588-607 DNA sequence of Pictiblennius yatabei species for SEQ ID NO: 19, 596- of Omobranchus elegans species for SEQ ID NO: 20 616th DNA sequence, SEQ ID NOs: 21 and 22 for the 515-535 DNA sequence and 563-583 DNA sequence for the species Repomucenus sp. , Zebrias fasciatus for SEQ ID NOs: 23 and 24 ) 513-533 DNA sequence and 595-615th DNA sequence of SEQ ID NO: 25, 460-480 DNA sequence of Konosirus punctatus species, Conger myriaster species of SEQ ID NO: 26 DNA sequence 515-535, Muraenesox cinereus for SEQ ID NO: 27, 555-575 DNA sequence for SEQ ID NO: 28, and 593-613 DNA sequence for Lophimus litulon species for SEQ ID NO: 29, and for a 595-615 second DNA sequence, SEQ ID NO: 30 and SEQ ID NO: 31 is pomfret (Pampu s argenteus ), the 505-525th DNA sequence and the 516-536th DNA sequence, SEQ ID NO: 32 for the aspect ( Platycephalus sp. ) 557-577 DNA sequence, SEQ ID NO: 33 and SEQ ID NO: 34 for the 327-346 DNA sequence and 583-601 DNA sequence, SEQ ID NO: 35 and SEQ ID NO: 36 of the Hemicentrotus pulcherrimus species Is the 373-393 DNA sequence and the 511-531 DNA sequence of Hyporhamphus sajori species, in the case of SEQ ID NO: 37, the 581-599 DNA sequence of the Acanthopagrus schlegeli species, SEQ ID NO: 38 and SEQ ID NO: 39 The 563-583 DNA sequence and the 595-615th DNA sequence of the Scomber australasicus species, and the 559-579 DNA sequence of the Chelidonichthys spinosus species, SEQ ID 41 and the sequence of In the case of No. 42, the 505-525th DNA sequence of the Trachurus japonicus species and the 508-528th DNA sequence, and the 513-533th DNA sequence of the Sphyraena pinguis species of SEQ ID NO: 43 and SEQ ID NO: 44 And 586-605 DNA sequences of SEQ ID NO: 45 and SEQ ID NO: 46 Wu John Dory (Zeus faber) species of 462-482 second DNA sequence and a second DNA sequence 593-613, in the case of SEQ ID NO: 47 is a thermal clownfish dome (Apogon lineatus) species 551-571 second DNA sequence, SEQ ID NO: 48 and of SEQ ID NO: In the case of 49, the 514-534 DNA sequence and the 586-605 DNA sequence of Psenopsis anomala species, and the 428-448 DNA sequence and 455 of the Chionoecetes japonica species in SEQ ID NO: 50 and SEQ ID NO: 51 -474th DNA sequence, 555-575 DNA sequence of Ditrema temminckii species for SEQ ID NO: 52, 560-580 DNA sequence of Clupea pallasii species for SEQ ID NO: 53 and SEQ ID NO: 54, and The 595-615th DNA sequence, SEQ ID NO: 55 and SEQ ID NO: 56 for the 390-410 DNA sequence of the Takifugu niphobles species, and the 412-432 DNA sequence for the SEQ ID NO: 57, Mugil cephalus species 592-612 DNA sequence of SEQ ID NO: 58 and SEQ ID NO: 59 for red snapper ( Pagrus majo) r ) 553-573 DNA sequence and 555-575 DNA sequence of SEQ ID NO: 60, 547-567 DNA sequence of Scomberomorus niphonius species, Pholis nebulosa species of SEQ ID NO: 61 599-619 of the second DNA sequence, in the case of SEQ ID NO: 62 is a mackerel (Scomber japonicus) 514-534 species of second DNA sequence, in the case of SEQ ID NO: 63 is seaweed value (Hypodytes rubripinnis) 590-613 species of second DNA sequence, SEQ ID NO: In the case of No. 64, the 605-628th DNA sequence of Halichoeres poecilopterus species; in the case of SEQ ID NO: 65, the 423-445th DNA sequence of the Okamejei kenojei species, SEQ ID NO: 66, and SEQ ID NO: 67 In the case of the 454-476 DNA sequence and the 524-546 DNA sequence, SEQ ID NO: 68 and SEQ ID NO: 69 of the Trichiurus japonicus species, Pleuronichthys sp. ) 355-375 DNA sequence and 351-371 DNA sequence, SEQ ID NO: 70 and SEQ ID NO: 71 in the case of Inimicus sp. 380-400 DNA sequence and 389-409 DNA sequence, SEQ ID NO: 72 and SEQ ID NO: 73 for the 556-576 and 598-618 DNA sequences of the Pleuronectes schrenki species, Sebasticus sp. The 341-361th DNA sequence of the species and the 346-366th DNA sequence of SEQ ID NO: 76 are 537-557 DNA sequences of the species Hexagrammos agrammus / Hexagrammos octagrammos , and in the case of SEQ ID NO: 77 Hexagrammos agrammus ) species may specifically bind to DNA sequence 598-618.

나아가, 상술한 본 발명에서, 상기 PCR 산물을 프로브에 결합시키는 단계는 적어도 2회 이상 수행되는 것이 바람직한데, 이와 같이 상기 결합을 확인하는 단계 이전에, 추출된 DNA와 본 발명에 따른 프로브의 결합 과정을 반복적으로 수행한다면, 상기 결합을 더욱 확실히 하여 프로브와 대상 DNA 산물의 결합을 더욱 견고히 할 수 있기 때문이다.
In addition, in the present invention, it is preferable that the step of binding the PCR product to the probe is performed at least twice or more. Thus, before the step of confirming the binding, the binding of the extracted DNA with the probe according to the present invention If the process is repeatedly performed, the binding can be further ensured and the binding between the probe and the target DNA product can be further strengthened.

한편, 본 발명의 다른 실시형태는, 상술한 어류의 종 판별 방법에 있어서, 상기 중합효소연쇄반응(PCR)을 수행하는 것은, 서열번호 1 내지 서열번호 6 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드를 정방향 프라이머 또는 역방향 프라이머로 사용하는 것을 특징으로 할 수 있다.
On the other hand, in another embodiment of the present invention, in the above-described fish species determination method, performing the polymerase chain reaction (PCR) is the same as at least one DNA sequence selected from SEQ ID NO: 1 to SEQ ID NO: 6 Or polynucleotides each including a complementary base sequence thereof may be used as a forward primer or a reverse primer.

즉, 본 발명에 따른 45종의 어류에서 DNA 시료를 채취하고, 이를 증폭시켜서 PCR 산물을 증폭시키는데 있어서, 상기 어류의 종에 적합한 특별한 염기서열을 상기 증폭을 위한 프라이머로 사용하는 것이다. 이러한 특정한 프라이머는 어류의 미토콘드리아 DNA 중 COI 유전자의 종간 염기서열 차이가 있는 DNA 부위에 부합하는 것으로써, 상기 추출한 DNA를 더욱 우수하게 증폭시킬 수 있다. 이를 위해 상기와 같이 혈액, 세포 또는 조직으로부터 추출된 DNA는 COI 유전자의 종간 염기서열 차이가 있는 DNA 부위를 포함하는 것이 바람직하다.
That is, in amplifying PCR products by collecting DNA samples from 45 kinds of fish according to the present invention and amplifying them, a specific base sequence suitable for the species of fish is used as a primer for the amplification. Such specific primers can be matched with DNA sites having different species sequences of COI genes in fish mitochondrial DNA, thereby further amplifying the extracted DNA. To this end, the DNA extracted from blood, cells or tissues as described above preferably comprises a DNA region having a difference in the sequence of species between the COI gene.

예를 들어, 상기 어류에 속하는 종이 쥐노래미, 줄노래미, 조피볼락, 멸치, 망상어, 노랑각시서대, 전어, 붕장어, 갯장어, 황아귀, 숭어, 학공치, 병어, 참돔, 성대, 전갱이, 꼬치고기, 달고기, 삼치, 열동가리돔, 샛돔, 베도라치, 청어, 흘림도다리, 문치가자미, 보리멸, 보구치, 감성돔, 군평선이, 양태류, 쏨뱅이류, 노래미, 고등어, 미역치, 용치놀래기, 홍어, 복섬, 청베도라치, 앞동갈베도라치, 쑤기미류 및 돛양태류로 이루어진 군에서 선택된 하나 이상인 경우에는, 하기 표 3에 기재된 서열번호 1과 서열번호 2의 염기서열을 포함하는 프라이머를 정방향 프라이머와 역방향 프라이머로 이용하는 것이 바람직하다. For example, the species belonging to the above fishes, sea bream, sea bream, lizard rockfish, anchovy, reef shark, yellow horned roe, eel, conger eel, eel, yellowfish, mullet, shark, eel, red snapper, vocal cord, horse mackerel, skewered fish, moonfish, Japanese mackerel, Japanese red snapper, red snapper, bedorachi, herring, shedding bridge, octopus flounder, barley extinction, moth, black sea bream, grouper's fish, flatfish, flatfish, songmi, mackerel, seaweed, red sea bream, skate In the case of at least one selected from the group consisting of a bedorachi, forerungalbedorachi, pikeweed and sail aspect, it is preferable to use a primer comprising the base sequence of SEQ ID NO: 1 and SEQ ID NO: 2 shown in Table 3 as the forward primer and the reverse primer Do.

[쥐노래미 등 일반 어류의 종판별을 위한 프라이머 서열]Primer Sequence for Species Identification of Common Fishes 프 라 이 머primer 염 기 서 열Salt base column 전위 프라이머(서열정보1)Translocation Primer (SEQ ID NO: 1) TCA GCC ATC TTA CCT GTG GCTCA GCC ATC TTA CCT GTG GC 역위 프라이머 (서열정보2)Inversion primer (SEQ ID NO: 2) GGG TGT CCG AAG AAT CAG AAGGG TGT CCG AAG AAT CAG AA

그리고, 상기 어류에 속하는 종이 개서대, 흑대기 및 참서대로 이루어진 군에서 선택된 하나 이상인 경우에는, 하기 표 4에 기재된 서열번호 3과 서열번호 4의 염기서열을 포함하는 프라이머를 정방향 프라이머와 역방향 프라이머로 이용하는 것이 바람직하다. And, in the case of one or more selected from the group consisting of a paper dog stand, a black wait and a chamdae belonging to the fish, the primer comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 shown in Table 4 as a forward primer and a reverse primer It is preferable to use.

[개서대, 흑대기, 참서대의 판별을 위한 프라이머 서열][Priority Sequences for Discrimination of Open Stand, Black Stand, and True Stand] 프 라 이 머primer 염 기 서 열Salt base column 전위 프라이머(서열정보3)Translocation Primer (SEQ ID NO: 3) GGT CAA CAA ATC ATA AAG ATA TTG GGGT CAA CAA ATC ATA AAG ATA TTG G 역위 프라이머 (서열정보4)Inversion primer (SEQ ID NO: 4) TAA ACT TCA GGG TGA CCA AAA AAT CATAA ACT TCA GGG TGA CCA AAA AAT CA

그리고, 상기 어류에 속하는 종이 갈치인 경우에는, 하기 표 5에 기재된 서열번호 5와 서열번호 6의 염기서열을 포함하는 프라이머를 정방향 프라이머와 역방향 프라이머로 이용하는 것이 바람직하다. And, if the species belonging to the fish is cutlass, it is preferable to use a primer comprising the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6 shown in Table 5 as the forward primer and the reverse primer.

[갈치의 판별을 위한 프라이머 서열]Primer Sequence for Determination of Cutlass 프 라 이 머primer 염 기 서 열Salt base column 전위 프라이머(서열정보5)Translocation Primer (SEQ ID NO: 5) TCA ACC AAC CAC AAA GAC ATT GGC ACTCA ACC AAC CAC AAA GAC ATT GGC AC 역위 프라이머 (서열정보6)Inversion primer (SEQ ID NO: 6) TAG ACT TCT GGG TGG CCA AAC AAT CATAG ACT TCT GGG TGG CCA AAC AAT CA

상기한 바와 같이, 본 발명은 서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브를 이용하는 것이 특징이고, 이에 따라 본 발명의 다른 실시형태는 상기한 프로브, 이러한 프로브를 포함하는 DNA 칩 및 키트일 수 있다. 상기 DNA 칩 및 키트에는 프로브와의 결합 및 검출의 정확성을 높이기 위하여, 특정한 염기서열로 표시되는 별도의 위치마커(position marker)가 추가로 고정되어 있는 것도 가능하다.
As described above, the present invention is characterized by using probes each comprising a base sequence identical to or complementary to each DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77, and accordingly another embodiment of the present invention The probes described above may be DNA chips and kits including the probes. In order to improve the accuracy of binding and detection with the probe, it is also possible that the DNA chip and the kit are additionally fixed with a separate position marker indicated by a specific nucleotide sequence.

이러한 본 발명은 DNA 마이크로어레이 기술에 따라 하나의 슬라이드 위에서 다수 어류의 종을 동시에 판별할 수 있다. 본 발명에 따른 DNA 칩 및 키트는 상기한 프로브를 포함하여, 종 특이적 DNA의 혼성화 가부에 따라 판별함으로서, 염기서열을 분석하기 않고도 분석하고자 하는 각 어류 종의 유전자형과 그 종을 신속히 판정할 수 있는 효용성을 가지고 있다. 또한 상기 어류에 속하는 어류 종을 한 번의 실험으로 정확한 유전자형을 분석할 수 있어, 상기 어류의 유전자형과 종을 판별하는 방법을 표준화 및 자동화하는 것도 가능하다.
The present invention can simultaneously identify multiple species of fish on one slide according to DNA microarray technology. DNA chips and kits according to the present invention, including the probes described above, can be determined according to hybridization of species-specific DNA, thereby quickly determining the genotype and species of each fish species to be analyzed without analyzing the sequence. It has utility. In addition, it is possible to analyze the exact genotype of the fish species belonging to the fish in one experiment, it is also possible to standardize and automate the method of discriminating the genotype and species of the fish.

본 발명은 하기의 실시예에 의하여 보다 더 잘 이해 될 수 있으며, 하기의 실시예는 본 발명의 예시 목적을 위한 것이며, 첨부된 특허청구범위에 의하여 한정되는 보호범위를 제한하고자 하는 것은 아니다.
The present invention may be better understood by the following examples, which are for the purpose of illustrating the invention and are not intended to limit the scope of protection defined by the appended claims.

실시예 1: 프라이머의 합성Example 1: Synthesis of primer

먼저, 어류에서 추출한 DNA를 증폭시키기 위한 프라이머를 합성하였다. 본 실시예에서 사용한 어류와 이에 따른 프라이머는 상기 표 3 내지 표 5에 기재된 것과 같은 것을 사용하였다. 프라이머는 독일의 Metabion 사에 의뢰하여 합성하였다.
First, primers for amplifying DNA extracted from fish were synthesized. Fish used in this example and the primers according to the same as those described in Tables 3 to 5 were used. Primers were synthesized by the German Metabion company.

대칭 또는 비대칭 PCR에 사용하는 역방향(앤티센스) 프라이머는 교잡화 반응 후에 형광을 확인하기 위하여, 말단에 로다민, cy3, cy5를 부착시켜서 제작하거나 바이오틴을 부착시켰고, 교잡화 반응 후 Syreptavidin-Cyanine과 결합하도록 제작하여 사용하였다.
The reverse (antisense) primer used for symmetric or asymmetric PCR was prepared by attaching rhodamine, cy3, cy5 to the end or attaching biotin to the end to confirm fluorescence after the cross-linking reaction. After the hybridization reaction, Syreptavidin- Were used.

실시예 2: 어류의 DNA 추출과 PCR 반응Example 2 DNA Extraction and PCR Reactions of Fishes

대한민국 남해 해역에 서식하는 주요 어류 45종의 DNA는 독일 QIAGEN사의 DNeasy tissue kit을 사용하여 추출하였다.
The DNA of 45 major fish inhabiting the South Sea of Korea was extracted using DNeasy tissue kit of QIAGEN of Germany.

상기 실시예 1에 따른 프라이머를 이용하여, 하기의 표 6과 같은 조건의 방법으로 PCR 반응을 DNA Engine(MJ Research사, 미국)에서 시행하였다.Using the primer according to Example 1, the PCR reaction was carried out in a DNA engine (MJ Research, USA) by the method of the conditions shown in Table 6 below.

[프라이머 정상 증폭 확인 조건][Conditions for confirming normal primer amplification] 반응 조성Reaction composition 반응 조건Reaction conditions 멸균증류수 11.5ul
10X buffer 2ul
2mM dNTP 1ul
10uM forward 1ul
10uM reverse 1ul
1unit Hot start Taq 0.5ul
정제 DNA 2ulSterilized distilled water 11.5 ul
10X buffer 2ul
2mM dNTP 1ul
10uM forward 1ul
10uM reverse 1ul
1unit Hot start Taq 0.5ul
Purified DNA 2ul 94, 15분94, 15 minutes 1 cycle1 cycle 94, 15초
45, 45초
72, 1분94, 15 seconds
45, 45 seconds
72, 1 minute 35 cycles35 cycles 72, 5분 72, 5 minutes 1 cycle1 cycle

PCR이 끝난 후, PCR 산물 10ul에 젤 로딩 버퍼(0.2% orange G, 0.25% xylene cyanol FF, 60% glycerol) 2ul를 넣고 1ug/ml ethidium bromide가 함유된 2% 아가로스 젤에서 전기영동 한 후 UV transilluminator가 부착된 Image analyzer (HITACHI, 일본)에서 PCR 밴드를 확인하였다.
After PCR, 2ul of gel loading buffer (0.2% orange G, 0.25% xylene cyanol FF, 60% glycerol) was added to 10ul of PCR product, followed by electrophoresis on 2% agarose gel containing 1ug / ml ethidium bromide, followed by UV PCR bands were confirmed by a transilluminator-attached image analyzer (HITACHI, Japan).

실시예 3: 서열번호 7 내지 77의 프로브 제작Example 3: Probe Construction of SEQ ID NOs: 7-77

본 실시예에서는 45종 각각의 어류에 대한 프로브를 합성하였다. 교잡화 반응을 위한 프로브의 서열정보는 상기 표 1 및 표 2에 나타낸 것과 같다.
In this example, probes for each of 45 species of fish were synthesized. Sequence information of the probe for the hybridization reaction is as shown in Table 1 and Table 2.

먼저, 알데히드 작용기가 처리되어 있는 글라스 위에, 상기한 서열정보를 가지는 폴리뉴클레오티드의 5'말단에 아미노 링크를 수식하고, 교잡화 반응시 슬라이드 글라스 위에 집적되어 있는 프로브 간의 공간적인 방해를 최소화시키기 위하여, 10-20 개의 올리고(dT)를 부가하여 본 발명에 따른 프로브를 완성하였다. 본 발명에서 사용한 프로브는 독일의 Metabion 사에 의뢰하여 합성하였다.
First, in order to modulate the amino link at the 5 'end of a polynucleotide having the above sequence information on a glass treated with an aldehyde functional group and to minimize spatial interference between the probes integrated on the slide glass during the hybridization reaction, 10-20 oligo (dT) were added to complete the probe according to the present invention. The probe used in the present invention was synthesized by asking Metabion of Germany.

실시예 4: DNA 칩 제작Example 4: Production of DNA chip

올리고뉴클레오티드 칩을 제작하기 위하여, 상기 실시예 3에 따라 CSS-100 Silylatied Slide(Cell Associate사, 미국) 상에 50μM의 농도로 아미도 링크가 수식되어 있는 프로브와 동일한 양의 3X SSC를 혼합하여 집적하였고, 이를 16 시간 동안 실온에서 반응시켰다. 반응이 완료된 슬라이드를 0.1% SDS로 5분간 2회 세척한 후, 증류수로 5분간 2회 세척하였다.
In order to fabricate the oligonucleotide chip, the same amount of 3X SSC as the probe having Amido link modified at 50 μM on the CSS-100 Silylatied Slide (Cell Associate, USA) was mixed and integrated according to Example 3 It was reacted for 16 hours at room temperature. After the reaction was completed, the slide was washed twice with 0.1% SDS for 5 minutes and then with distilled water for 5 minutes.

그리고, 소디움 보로하이드리드(1.3g NaBH4 375ml. PBS 125ml, 100% EtOH)에 제작된 칩을 5분간 반응시킨 후, 끓는 증류수에서 3분간 반응시킨 다음 진공 원심분리기에서 800rpm의 속도로 10분간 건조시켰다.
Then, a chip prepared in sodium borohydride (1.3 g NaBH 4 375 ml. PBS 125 ml, 100% EtOH) was reacted for 5 minutes, and then reacted in boiling distilled water for 3 minutes, and then dried in a vacuum centrifuge at 800 rpm for 10 minutes. .

한 장의 슬라이드에서 다수의 시료 반응을 위해 perfusion chamber(BioGrace, 미국)로 분리한 후 실험 전까지 실온의 암소에서 보관하였다.
One slide was separated into a perfusion chamber (BioGrace, USA) for multiple sample reactions and stored in the dark at room temperature until the experiment.

이렇게 제작된 DNA 칩을 도 47에 예시적으로 나타내었다. 도 47은 상기 도 2 내지 도 46에 나타난 염기서열에 근거하여 제작된 폴리뉴클레오티드 프로브를 포함하는 DNA칩의 구조를 도식화한 모식도이다.
The DNA chip thus produced is exemplarily shown in FIG. 47. FIG. 47 is a schematic diagram illustrating the structure of a DNA chip including a polynucleotide probe prepared based on the nucleotide sequences shown in FIGS. 2 to 46.

실시예 5: 교잡화 반응Example 5: Hybridization reaction

상기 실시예 2에 따라 로다민, cy3, cy5 또는 바이오틴으로 결합된 PCR 산물을 교잡화 용액(3X SSC, 0.25% SDS)과 1:9의 비율로 혼합하였다. 형광반응을 일으키기 위하여 바이오틴을 사용한 경우 Syreptavidin-Cyanine을 1㎍/㎖의 농도로 첨가하여 반응시켰다.
According to Example 2, PCR products bound with rhodamine, cy3, cy5 or biotin were mixed in a ratio of 1: 9 with hybridization solution (3X SSC, 0.25% SDS). When biotin was used to cause fluorescence, Syreptavidin-Cyanine was added at a concentration of 1 µg / ml and reacted.

그리고, 준비된 교잡화 용액을 상기 실시예 4의 DNA 칩이 포함된 chamber에 도포하여 60℃에서 1시간 동안 반응시켰다.
Then, the prepared hybridization solution was applied to the chamber containing the DNA chip of Example 4 and reacted at 60 ° C. for 1 hour.

그런 다음, 1X SSC, 0.1% SDS에서 5분 동안 일차 세척 후, 1X SSC에서 3분간 2차 세척을 실시하였다. 세척된 슬라이드는 원심분리기에서 800rpm의 속도로 10분간 건조하였다.
Then, the first wash for 5 minutes in 1X SSC, 0.1% SDS, and then a second wash for 3 minutes in 1X SSC. The washed slides were dried for 10 minutes at a speed of 800 rpm in a centrifuge.

실험 결과의 확인은 LuxScan-10K/A(CapitalBio, 중국) 스캐너를 사용하여 형광값을 측정하여 유전자형을 분석하였고, 그 결과는 도 48 내지 도 82에 나타낸 바와 같다.
In order to confirm the experimental results, genotypes were analyzed by measuring fluorescence values using a LuxScan-10K / A (CapitalBio, China) scanner, and the results are shown in FIGS. 48 to 82.

도 48 내지 도 82는 각각 상기 도 47의 DNA칩을 이용하여 본 발명에 따른 올리고뉴클레오티드 프로브와 쥐노래미를 비롯한 주요어종의 PCR 증폭산물을 결합시킨 후의 반응 결과를 나타내는 사진이다.
48 to 82 are photographs showing the reaction results after the PCR amplification products of major fish species including the oligonucleotide probe and rat mule according to the present invention using the DNA chip of FIG. 47, respectively.

여기서, 도 48은 쥐노래미, 도 49는 줄노래미, 도 50은 조피볼락, 도 51는 개서대, 도 52는 흑대기, 도 53은 참서대, 도 54은 멸치, 도 55은 청베도라치, 도 56은 앞동갈베도라치, 도 57은 돛양태류, 도 58은 노랑각시서대, 도 59는 전어, 도 60은 붕장어, 도 61는 갯장어, 도 62는 황아귀, 도 63은 병어, 도 64은 양태류, 도 65은 보리멸, 도 66는 학공치, 도 67은 감성돔, 도 68은 군평선이, 도 69은 성대, 도 70은 전갱이, 도 71는 꼬치고기, 도 72는 달고기, 도 73은 열동가리돔, 도 74은 샛돔, 도 75은 보구치, 도 76는 망상어, 도 77은 청어, 도 78은 복섬, 도 79는 숭어, 도 80은 참돔, 도 81는 삼치, 도 82는 베도라치 대한 결과이다.
Here, Fig. 48 is a rat song, Fig. 49 is a string song, Fig. 50 is a jeopbolak, Fig. 51 is a retreat, Fig. 52 is a black atmosphere, Fig. 53 is a charm stand, Fig. 54 is anchovy, Fig. 55 is Cheongbedorachi, Fig. 56 is the front east Galvedorachi, Fig. 57 is a sail eel, Fig. 58 is a yellow horn, Fig. 59 is a eel, Fig. 60 is a conger eel, Fig. 61 is a eel, Fig. 62 is a eel, Fig. 63 is a bottlefish, Fig. 64 is a lateral flow, Fig. 65 Is barley extinction, FIG. 66 is a school work, FIG. 67 is a black sea bream, FIG. 68 is a military plane, FIG. 69 is a vocal cord, FIG. 70 is a horse mackerel, FIG. 71 is a skewer, FIG. 72 is a moon meat, FIG. 73 is a hot snapper, FIG. 74 Fig. 75 shows a red snapper, Fig. 75 is a molar tooth, Fig. 76 is a shark, Fig. 77 is a herring, Fig. 78 is a bokseom, Fig. 79 is a mullet, Fig. 80 is a red snapper, Fig. 81 is a mackerel, and Fig. 82 is a result of Vedorachi.

여기에 도시된 것과 같이, 본 발명에 의하는 경우 해당 생물 종에 따라 형광 표지가 다르게 나타나므로, 이에 따라 해당 종을 판별할 수 있음을 확인하였다.
As shown in the figure, according to the present invention, since the fluorescent label is different depending on the species, it is confirmed that the species can be discriminated.

한편, 상기에서는 본 발명을 특정의 바람직한 실시예에 관련하여 도시하고 설명하였지만, 이하의 특허청구범위에 의해 마련되는 본 발명의 기술적 특징이나 분야를 이탈하지 않는 한도 내에서 본 발명이 다양하게 개조 및 변화될 수 있다는 것은 당업계에서 통상의 지식을 가진 자에게 명백한 것이다.
On the other hand, while the present invention has been shown and described with respect to certain preferred embodiments, the invention is variously modified and modified without departing from the technical features or fields of the invention provided by the claims below It will be apparent to those skilled in the art that such changes can be made.

본 발명에 의하는 경우, 하나의 슬라이드 위에서 다수의 해양 생물 종에 대한 유전자형 분석을 간단하고 신속, 정확하게 판별할 수 있는 효과가 있다. 본 발명에 따라 해양 생물 45종의 미토콘드리아 COI지역을 유전자 표지로 사용하면, 종래의 형태학적 구별법으로 해당 종을 판별하는 지금까지의 방법이 가졌던 낮은 분해능의 문제점을 해결 할 수 있다. 종래와 같이, 형태학적인 차이점을 기초로 판별하는 것 보다 본 발명에 따라 종간 염기서열 차이를 근거로한 DNA칩 방법을 이용하면, 종래기술보다 한 단계 진보된 형태의 유전자 분석법을 제공하여, 더욱 효과적으로 해양 생물종을 판별할 수 있고, 분해능도 현저히 증가시킬 수 있다.
According to the present invention, it is possible to easily, quickly, and accurately discriminate the genotype analysis on a plurality of marine species on one slide. Using the mitochondrial COI region of 45 marine organisms according to the present invention as a genetic marker, it is possible to solve the problem of low resolution, which has been the conventional method of discriminating the species by conventional morphological distinction. As in the prior art, using the DNA chip method based on the species sequence difference according to the present invention rather than discriminating based on morphological differences, it provides a more advanced type of genetic analysis method than the prior art, more effectively Marine species can be identified and resolution can be significantly increased.

그리고 본 발명에 따라 상기한 폴리뉴클레오티드 프로브를 사용하여 마이크로어레이 방법을 활용하면, 종 특이적 DNA의 혼성화 가부에 따라 판별함으로써, 염기서열을 분석하지 않고도 각 생물종의 유전자형을 신속히 판정할 수 있는 적용성을 갖고 있다. 또한 다수의 생물종을 한 번의 실험으로 정확한 유전자형을 분석할 수 있어, 해당 생물종의 유전자형을 표준화, 자동화할 수 있도록 기술 개발의 적용성을 극대화시켰다. 즉, 본 발명은 종래의 방법에 비해 시료를 분석하는 데 걸리는 시간을 크게 단축시켰으며, 다량의 시료를 짧은 시간 내에 처리할 수 있는 효과가 있다.
And by using the microarray method using the polynucleotide probe described above according to the present invention, by discriminating according to the hybridization of species-specific DNA, the application that can quickly determine the genotype of each species without analyzing the sequence Have sex In addition, it is possible to analyze the exact genotype of a large number of species in a single experiment, thereby maximizing the applicability of technology development to standardize and automate the genotype of the species. That is, the present invention greatly shortens the time required for analyzing the sample compared to the conventional method, and it is possible to process a large amount of sample in a short time.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (13)

어류에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계;
상기 PCR 산물을, 서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및,
상기 결합 여부에 따라 상기 어류의 종(species)을 판별하는 단계;를 포함하는 어류의 종(species) 판별 방법.
Performing PCR on a DNA extracted from fish to obtain a PCR product;
Binding the PCR product to a probe each comprising a base sequence identical to or complementary to each DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77; And
Determining a species of the fish according to whether the combination; species of fish species comprising a (species) comprising a.
제1항에 있어서, 상기 어류는 남해 해역에 서식하는 어종인 것을 특징으로 하는 어류의 종 판별 방법.
The method of claim 1, wherein the fish is a species that inhabit the South Sea waters.
제1항에 있어서, 상기 어류는 쥐노래미(Hexagrammos otakii), 줄노래미(Hexagrammos octagrammos), 조피볼락(Sebastesschlegelii), 개서대(Cynoglossus robustus), 흑대기(Paraplagusia japonica), 참서대(Cynoglossus joyneri), 멸치(Engraulis japonicus), 청베도라치(Pictiblennius yatabei), 앞동갈베도라치(Omobranchus elegans), 돛양태류(Repomucenus sp.), 노랑각시서대(Zebrias fasciatus), 전어(Konosirus punctatus), 붕장어(Conger myriaster), 갯장어(Muraenesox cinereus), 황아귀(Lophimus litulon), 병어(Pampus argenteus), 양태류(Platycephalus sp.), 보리멸(Hemicentrotus pulcherrimus), 학공치(Hyporhamphus sajori), 감성돔(Acanthopagrus schlegeli), 군평선이(Scomber australasicus), 성대(Chelidonichthys spinosus), 전갱이(Trachurus japonicus), 꼬치고기(Sphyraena pinguis), 달고기(Zeus faber), 열동가리돔(Apogon lineatus), 샛돔(Psenopsis anomala), 보구치(Chionoecetes japonica), 망상어(Ditrema temminckii ), 청어(Clupea pallasii), 복섬(Takifugu niphobles), 숭어(Mugil cephalus), 참돔(Pagrus major), 삼치(Scomberomorus niphonius), 베도라치(Pholis nebulosa), 고등어(Scomber japonicus), 미역치(Hypodytes rubripinnis), 용치놀래기(Halichoeres poecilopterus), 홍어(Okamejei kenojei), 갈치(Trichiurus japonicus), 흘림도다리(Pleuronichthys sp.), 쑤기미류(Inimicus sp.), 문치가자미(Pleuronectes schrenki), 쏨뱅이류(Sebasticus sp.), 노래미/줄노래미(Hexagrammos agrammus/Hexagrammos octagrammos) 및 노래미(Hexagrammos agrammus)로 이루어진 군에서 적어도 하나 이상이 선택된 것을 특징으로 하는 어류의 종 판별 방법.
The method of claim 1, wherein the fish is Greenling (Hexagrammos otakii), line noraemi (Hexagrammos octagrammos), rockfish (Sebastesschlegelii), rewritten for (Cynoglossus robustus), black atmosphere (Paraplagusia japonica), chamseodae (Cynoglossus joyneri), anchovy (Engraulis japonicus), Zheng gunnel (Pictiblennius yatabei), apdong go gunnel (Omobranchus elegans), dotyangtae flow (Repomucenus sp.), yellow yellowfin seodae (Zebrias fasciatus), gizzard shad (Konosirus punctatus), conger (conger myriaster), sea eel (Muraenesox cinereus ), Yellowfish ( Lophimus litulon ), Bottlefish ( Pampus argenteus ), Vertebrate ( Platycephalus sp. ), Barley ( Hemicentrotus pulcherrimus ), Sclerosis ( Hyporhamphus sajori ), Black sea bream ( Acanthopagrus schlegeli ), Squiber australasicus , Sungdae ( Chelidonichthys spinosus ), horse mackerel ( Trachurus japonicus ), skewer ( Sphyraena pinguis ), moon meat ( Zeus faber ), red snapper ( Apogon lineatus ), red snapper ( Psenopsis anomala ), chiguchi ( Chion oecetes japonica), mangsangeo (Ditrema temminckii), herring (Clupea pallasii), bokseom (Takifugu niphobles), gray mullet (Mugil cephalus), red sea bream (Pagrus major), Spanish mackerel (Scomberomorus niphonius), gunnel (Pholis nebulosa), mackerel (Scomber japonicus ), Brown seaweed ( Hypodytes rubripinnis ), yellowtail ( Halichoeres poecilopterus ), skate ( Okamejei kenojei ), cutlass ( Trichiurus japonicus ), Pleuropod ( Pleuronichthys sp. ), At least one in the group consisting of Inimicus sp. , Pleuronectes schrenki , Seinecus ( Sebasticus sp. ), Hexagrammos agrammus / Hexagrammos octagrammos and Hexagrammos agrammus The species identification method of the fish characterized by the above-mentioned.
제1항에 있어서, 상기 추출한 DNA는 상기 어류의 미토콘드리아 DNA 중 COI 유전자의 종간 염기서열 차이가 있는 부위를 포함하는 것을 특징으로 하는 어류의 종 판별 방법.
The method of claim 1, wherein the extracted DNA comprises a site having a difference in species nucleotide sequences of COI genes in the mitochondrial DNA of the fish.
제1항에 있어서, 상기 프로브는 상기 어류의 미토콘드리아 DNA 중 COI 유전자의 종간 염기서열 차이가 있는 부위와 결합하고, 상기 결합은 상기 어류의 종에 따라 다르게 이루어지는 것을 특징으로 하는 어류의 종 판별 방법.
The method of claim 1, wherein the probe binds to a site having a difference in species sequence between COI genes in the mitochondrial DNA of the fish, and the binding is performed differently depending on the species of the fish.
제5항에 있어서, 상기 결합이 상기 어류의 종에 따라 다르게 이루어진다는 것은, 서열번호 7의 염기서열을 포함하는 프로브는 쥐노래미(Hexagrammos otakii) 종의 미토콘드리아 DNA 중 COI 유전자 부위의 385-407번째 DNA 서열과 특이적으로 결합하고, 서열번호 8과 9의 프로브는 줄노래미(Hexagrammos octagrammos) 종의 385-407번째 DNA 서열 및 410-432번째 DNA 서열, 서열번호 10과 11의 경우는 조피볼락(Sebastesschlegelii) 종의 584-606번째 DNA 서열 및 552-574번째 DNA 서열, 서열번호 12의 경우는 개서대(Cynoglossus robustus) 종의 605-627번째 DNA 서열, 서열번호 13과 14의 경우는 흑대기(Paraplagusia japonica) 종의 605-627번째 DNA 서열 및 592-614번째 DNA 서열, 서열번호 15와 16의 경우는 참서대(Cynoglossus joyneri) 종의 605-627번째 DNA 서열 및 554-576번째 DNA 서열, 서열번호 17과 18의 경우는 멸치(Engraulis japonicus) 종의 584-606번째 DNA 서열 및 550-572번째 DNA 서열, 서열번호 19의 경우는 청베도라치(Pictiblennius yatabei) 종의 588-607번째 DNA 서열, 서열번호 20의 경우는 앞동갈베도라치(Omobranchus elegans) 종의 596-616번째 DNA 서열, 서열번호 21과 22의 경우는 돛양태류(Repomucenus sp.) 종의 515-535번째 DNA 서열 및 563-583번째 DNA 서열, 서열번호 23과 24의 경우는 노랑각시서대(Zebrias fasciatus) 종의 513-533번째 DNA 서열 및 595-615번째 DNA 서열, 서열번호 25의 경우는 전어(Konosirus punctatus) 종의 460-480번째 DNA 서열, 서열번호 26의 경우는 붕장어(Conger myriaster) 종의 515-535번째 DNA 서열, 서열번호 27의 경우는 갯장어(Muraenesox cinereus) 555-575번째 DNA 서열, 서열번호 28 및 서열번호 29의 경우는 황아귀(Lophimus litulon) 종의 593-613번째 DNA 서열 및 595-615번째 DNA 서열, 서열번호 30 과 서열번호 31의 경우는 병어(Pampus argenteus) 종의 505-525번째 DNA 서열 및 516-536번째 DNA 서열, 서열번호 32의 경우는 양태류(Platycephalus sp.) 종의 557-577번째 DNA 서열, 서열번호 33 및 서열번호 34의 경우는 보리멸(Hemicentrotus pulcherrimus) 종의 327-346번째 DNA 서열 및 583-601번째 DNA 서열, 서열번호 35 및 서열번호 36의 경우는 학공치(Hyporhamphus sajori) 종의 373-393번째 DNA 서열 및 511-531번째 DNA 서열, 서열번호 37의 경우는 감성돔(Acanthopagrus schlegeli) 종의 581-599번째 DNA 서열, 서열번호 38과 서열번호 39의 경우는 군평선이(Scomber australasicus) 종의 563-583번째 DNA 서열 및 595-615번째 DNA 서열, 서열번호 40의 경우는 성대(Chelidonichthys spinosus) 종의 559-579번째 DNA 서열, 서열번호 41과 서열번호 42의 경우는 전갱이(Trachurus japonicus) 종의 505-525번째 DNA 서열 및 508-528번째 DNA 서열, 서열번호 43과 서열번호 44의 경우는 꼬치고기(Sphyraena pinguis) 종의 513-533번째 DNA 서열 및 586-605번째 DNA 서열, 서열번호 45와 서열번호 46의 경우는 달고기(Zeus faber) 종의 462-482번째 DNA 서열 및 593-613번째 DNA 서열, 서열번호 47의 경우는 열동가리돔(Apogon lineatus) 종의 551-571번째 DNA 서열, 서열번호 48과 서열번호 49의 경우는 샛돔(Psenopsis anomala) 종의 514-534번째 DNA 서열 및 586-605번째 DNA 서열, 서열번호 50과 서열번호 51의 경우는 보구치(Chionoecetes japonica) 종의 428-448번째 DNA 서열 및 455-474번째 DNA 서열, 서열번호 52의 경우는 망상어(Ditrema temminckii ) 종의 555-575번째 DNA 서열, 서열번호 53과 서열번호 54의 경우는 청어(Clupea pallasii) 종의 560-580번째 DNA 서열 및 595-615번째 DNA 서열, 서열번호 55와 서열번호 56의 경우는 복섬(Takifugu niphobles) 종의 390-410번째 DNA 서열 및 412-432번째 DNA 서열, 서열번호 57의 경우는 숭어(Mugil cephalus)종의 592-612번째 DNA 서열 및 서열번호 58과 서열번호 59의 경우는 참돔(Pagrus major)종의 553-573번째 DNA 서열 및 555-575번째 DNA 서열, 서열번호 60의 경우는 삼치(Scomberomorus niphonius)종의 547-567번째 DNA 서열, 서열번호 61의 경우는 베도라치(Pholis nebulosa)종의 599-619번째 DNA 서열, 서열번호 62의 경우는 고등어(Scomber japonicus)종의 514-534번째 DNA 서열, 서열번호 63의 경우는 미역치(Hypodytes rubripinnis)종의 590-613번째 DNA 서열, 서열번호 64의 경우는 용치놀래기(Halichoeres poecilopterus)종의 605-628번째 DNA 서열, 서열번호 65의 경우는 홍어(Okamejei kenojei)종의 423-445번째 DNA 서열, 서열번호 66, 서열번호 67의 경우는 갈치(Trichiurus japonicus)종의 454-476번째 DNA 서열 및 524-546번째 DNA 서열, 서열번호 68과 서열번호 69의 경우는 흘림도다리(Pleuronichthys sp.)종의 355-375번째 DNA 서열 및 351-371번째 DNA 서열, 서열번호 70과 서열번호 71의 경우는 쑤기미류(Inimicus sp.)종의 380-400번째 DNA 서열 및 389-409번째 DNA 서열, 서열번호 72와 서열번호 73의 경우는 문치가자미(Pleuronectes schrenki)종의 556-576번째 DNA 서열 및 598-618번째 DNA 서열, 서열번호 74와 서열번호 75의 경우는 쏨뱅이류(Sebasticus sp.)종의 341-361번째 DNA 서열 및 346-366번째 DNA 서열, 서열번호 76의 경우는 노래미/줄노래미(Hexagrammos agrammus/Hexagrammos octagrammos)종의 537-557번째 DNA 서열, 서열번호 77의 경우는 노래미(Hexagrammos agrammus)종의 598-618번째 DNA 서열과 특이적으로 결합하는 것을 특징으로 하는 어류의 종 판별 방법.
According to claim 5, The binding is different depending on the species of the fish, Probe comprising the nucleotide sequence of SEQ ID NO: 7 is the 385-407 DNA of the COI gene region of the mitochondrial DNA of Hexagrammos otakii species Specific binding to the sequence, and the probes of SEQ ID NOs: 8 and 9 are the 385-407 and 410-432 DNA sequences of the Hexagrammos octagrammos species, Sebastesschlegelii in the case of SEQ ID NOs: 10 and 11 584-606 DNA sequence of the species and 552-574 DNA sequence of SEQ ID NO: 12, 605-627 DNA sequence of Cynoglossus robustus species, Paraplagusia japonica for SEQ ID NOs: 13 and 14 ) The 605-627th DNA sequence of the species and the 592-614th DNA sequence of SEQ ID NOs: 15 and 16, the 605-627th DNA sequence of the Cynoglossus joyneri species and the 554-576th DNA sequence, SEQ ID NO: 17 In case of 18 anchovy ( Engraulis j aponicus ) 584-606 DNA sequence and 550-572 DNA sequence, SEQ ID NO: 19 is the 588-607 DNA sequence of Pictiblennius yatabei species, SEQ ID NO: 20 Omobranchus ( Omobranchus) elegans ) DNA sequence 596-616, SEQ ID NO: 21 and 22 for the 515-535 DNA sequence and 563-583 DNA sequence of SEQ ID NOs 23 and 24 of the Repomucenus sp. 513-533 DNA sequence and 595-615th DNA sequence of Zebrias fasciatus species, 460-480 DNA sequence of Konosirus punctatus species for SEQ ID NO 25, conger eel for SEQ ID NO 26 515-535 DNA sequence of Conger myriaster species, Muraenesox cinereus 555-575 DNA sequence of SEQ ID NO: 27, 593 of Lophimus litulon species of SEQ ID NO: 28 and SEQ ID NO: 29 The 613th DNA sequence and the 595-615th DNA sequence, SEQ ID NO: 30 and SEQ ID NO: 31 In the case of Pampus argenteus species, the 505-525th DNA sequence and the 516-536th DNA sequence, and in the case of SEQ ID NO: 32 were shown as Platycephalus sp. ) 557-577 DNA sequence, SEQ ID NO: 33 and SEQ ID NO: 34 for the 327-346 DNA sequence and 583-601 DNA sequence, SEQ ID NO: 35 and SEQ ID NO: 36 of the Hemicentrotus pulcherrimus species Is the 373-393 DNA sequence and the 511-531 DNA sequence of Hyporhamphus sajori species, in the case of SEQ ID NO: 37, the 581-599 DNA sequence of the Acanthopagrus schlegeli species, SEQ ID NO: 38 and SEQ ID NO: 39 The 563-583 DNA sequence and the 595-615th DNA sequence of the Scomber australasicus species, and the 559-579 DNA sequence of the Chelidonichthys spinosus species, SEQ ID 41 and the sequence of In the case of No. 42, the 505-525th DNA sequence of the Trachurus japonicus species and the 508-528th DNA sequence, and the 513-533th DNA sequence of the Sphyraena pinguis species of SEQ ID NO: 43 and SEQ ID NO: 44 And 586-605 DNA sequences of SEQ ID NO: 45 and SEQ ID NO: 46 Wu John Dory (Zeus faber) species of 462-482 second DNA sequence and a second DNA sequence 593-613, in the case of SEQ ID NO: 47 is a thermal clownfish dome (Apogon lineatus) species 551-571 second DNA sequence, SEQ ID NO: 48 and of SEQ ID NO: In the case of 49, the 514-534 DNA sequence and the 586-605 DNA sequence of Psenopsis anomala species, and the 428-448 DNA sequence and 455 of the Chionoecetes japonica species in SEQ ID NO: 50 and SEQ ID NO: 51 -474th DNA sequence, 555-575 DNA sequence of Ditrema temminckii species for SEQ ID NO: 52, 560-580 DNA sequence of Clupea pallasii species for SEQ ID NO: 53 and SEQ ID NO: 54, and The 595-615th DNA sequence, SEQ ID NO: 55 and SEQ ID NO: 56 for the 390-410 DNA sequence of the Takifugu niphobles species, and the 412-432 DNA sequence for the SEQ ID NO: 57, Mugil cephalus species 592-612 DNA sequence of SEQ ID NO: 58 and SEQ ID NO: 59 for red snapper ( Pagrus majo) r ) 553-573 DNA sequence and 555-575 DNA sequence of SEQ ID NO: 60, 547-567 DNA sequence of Scomberomorus niphonius species, Pholis nebulosa species of SEQ ID NO: 61 599-619 of the second DNA sequence, in the case of SEQ ID NO: 62 is a mackerel (Scomber japonicus) 514-534 species of second DNA sequence, in the case of SEQ ID NO: 63 is seaweed value (Hypodytes rubripinnis) 590-613 species of second DNA sequence, SEQ ID NO: In the case of No. 64, the 605-628th DNA sequence of Halichoeres poecilopterus species; in the case of SEQ ID NO: 65, the 423-445th DNA sequence of the Okamejei kenojei species, SEQ ID NO: 66, and SEQ ID NO: 67 In the case of the 454-476 DNA sequence and the 524-546 DNA sequence, SEQ ID NO: 68 and SEQ ID NO: 69 of the Trichiurus japonicus species, Pleuronichthys sp. ) 355-375 DNA sequence and 351-371 DNA sequence, SEQ ID NO: 70 and SEQ ID NO: 71 in the case of Inimicus sp. 380-400 DNA sequence and 389-409 DNA sequence, SEQ ID NO: 72 and SEQ ID NO: 73 for the 556-576 and 598-618 DNA sequences of the Pleuronectes schrenki species, Sebasticus sp. The 341-361th DNA sequence of the species and the 346-366th DNA sequence of SEQ ID NO: 76 are 537-557 DNA sequences of the species Hexagrammos agrammus / Hexagrammos octagrammos , and in the case of SEQ ID NO: 77 Hexagrammos agrammus ) species species of fish characterized in that specifically binding to the 598-618th DNA sequence.
제1항에 있어서, 상기 PCR 산물을 프로브에 결합시키는 단계는 적어도 2회 이상 수행되는 것을 특징으로 하는 어류의 종 판별 방법.
The method of claim 1, wherein the binding of the PCR product to the probe is performed at least twice.
제1항에 있어서, 상기 중합효소연쇄반응(PCR)을 수행하는 것은, 서열번호 1 내지 서열번호 6 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드를 정방향 프라이머 또는 역방향 프라이머로 사용하는 것을 특징으로 하는 어류의 종 판별 방법.
The method of claim 1, wherein the performing of the polymerase chain reaction (PCR) comprises a polynucleotide comprising at least one DNA sequence identical to or complementary to each DNA sequence selected from SEQ ID NO: 1 to SEQ ID NO: 6; A species identification method of fish, characterized by using nucleotides as forward primers or reverse primers.
서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드로 이루어진 어류의 종(species) 판별용 프로브 세트.
A probe set for discriminating fish species consisting of polynucleotides, each comprising a nucleotide sequence identical to or complementary to each DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77.
제9항의 프로브 세트를 포함하는 어류의 종(species) 판별용 DNA 칩.
DNA chip for species identification of fish comprising the probe set of claim 9.
제10항에 있어서, 위치 마커(position marker)를 더 포함하는 것을 특징으로 하는 어류의 종(species) 판별용 DNA 칩.
The DNA chip for species determination of fish according to claim 10, further comprising a position marker.
어류의 미토콘드리아 DNA 중 COI 유전자의 종간 염기서열 차이가 있는 DNA 부위와 결합하는 것으로, 서열번호 7 내지 서열번호 77의 각 DNA 서열과 동일하거나 상보적인(complementary) 15-30개의 연속 염기서열을 각각 포함하는 폴리뉴클레오티드로 이루어진 프로브 세트와;
상기 어류의 미토콘드리아 DNA를 중합효소연쇄반응(PCR)으로 증폭시키기 위한 프라이머를 포함하는 것을 특징으로 하는 어류의 종(species) 판별용 키트.
Binding to DNA sites with differences in species sequencing of COI genes in fish mitochondrial DNA, each containing 15-30 consecutive base sequences identical or complementary to each DNA sequence of SEQ ID NO: 7 to SEQ ID NO: 77 A probe set consisting of a polynucleotide;
Kit for determination of species of fish, characterized in that it comprises a primer for amplifying the mitochondrial DNA of the fish by a polymerase chain reaction (PCR).
제12항에 있어서, 상기 프라이머는 서열번호 1 내지 서열번호 4 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 정방향 프라이머 또는 역방향 프라이머인 것을 특징으로 하는 어류의 종(species) 판별용 키트.


The fish of claim 12, wherein the primer is a forward primer or a reverse primer, each of which comprises a base sequence identical to or complementary to each DNA sequence selected from SEQ ID NO: 1 to SEQ ID NO: 4 Kit for the determination of species.


KR1020100025431A 2010-03-22 2010-03-22 Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same KR101211068B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020100025431A KR101211068B1 (en) 2010-03-22 2010-03-22 Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100025431A KR101211068B1 (en) 2010-03-22 2010-03-22 Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Publications (2)

Publication Number Publication Date
KR20110106172A KR20110106172A (en) 2011-09-28
KR101211068B1 true KR101211068B1 (en) 2012-12-12

Family

ID=44956214

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100025431A KR101211068B1 (en) 2010-03-22 2010-03-22 Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Country Status (1)

Country Link
KR (1) KR101211068B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170005996A (en) 2015-07-07 2017-01-17 목포대학교산학협력단 Method for identifying abalone using polymorphism of calmodulin intron
KR101749545B1 (en) * 2016-09-09 2017-06-21 대한민국 Genetic markers and methods for identifying species belong to Cynoglossidae
KR101775219B1 (en) 2015-06-24 2017-09-06 배재대학교 산학협력단 Probe for identifying sea bream species and tilapia species and identifying method using the same

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103045589B (en) * 2012-12-25 2014-02-19 北京大学 Degenerate primer combination for amplifying soil nematode CO I genes and applications thereof
CN103689597B (en) * 2013-12-24 2015-04-22 南京中医药大学 Application of inimicus japonicus or liver extract thereof in preparation of healthcare product or medicine for improving immunity
KR101412062B1 (en) * 2014-01-20 2014-08-06 대한민국 Polynucleotide for identifying origin of blackmouth angler and Method for identifying origin of blackmouth angler the same
KR101412064B1 (en) * 2014-01-20 2014-08-06 대한민국 Polynucleotide for identifying origin of blackmouth angler and Method for identifying origin of blackmouth angler the same
KR101412058B1 (en) * 2014-01-20 2014-07-02 대한민국 Polynucleotide for identifying origin of blackmouth angler and Method for identifying origin of blackmouth angler the same
CN108085396B (en) * 2017-11-29 2021-03-02 暨南大学 Primer and probe for detecting pomfret based on fluorescence quantitative PCR (polymerase chain reaction), kit and method thereof
CN109136387A (en) * 2018-08-15 2019-01-04 浙江海洋大学 A kind of molecular labeling primer and method identifying foxiness Yong and India Yong
CN109234407A (en) * 2018-10-30 2019-01-18 中国计量大学 A method of identification Du Shi rib Anchovy and red nose rib Anchovy
CN109536618A (en) * 2018-12-13 2019-03-29 河南师范大学 A kind of Jian Dings the methods of Minnow subfamily fish
KR102224827B1 (en) * 2019-07-18 2021-03-08 곽인실 Primer set for analyzing gastric contents of Argyrosomus argentatus and Method for analyzing gastric contents of A. argentatus using the same
KR102206211B1 (en) * 2019-12-24 2021-01-25 경상북도 Genetic marker for parentage and thereof in Limanda yokohamae
KR102168820B1 (en) * 2020-04-06 2020-10-22 대한민국 Genetic markers and methods for identifying species belong to genus Takifugu
CN111944909A (en) * 2020-08-28 2020-11-17 海南热带海洋学院 DNA bar code for identifying ramose scouring spine and ramose scouring spine as well as identification method and application thereof
CN113080110B (en) * 2021-03-31 2022-05-17 山东大学 Method for promoting gonad maturation of parent fish of spotted-head fish

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
J Agric Food Chem, Vol. 51, No. 22, pp10594-10599; 2008.11.26

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101775219B1 (en) 2015-06-24 2017-09-06 배재대학교 산학협력단 Probe for identifying sea bream species and tilapia species and identifying method using the same
KR20170005996A (en) 2015-07-07 2017-01-17 목포대학교산학협력단 Method for identifying abalone using polymorphism of calmodulin intron
KR101749545B1 (en) * 2016-09-09 2017-06-21 대한민국 Genetic markers and methods for identifying species belong to Cynoglossidae

Also Published As

Publication number Publication date
KR20110106172A (en) 2011-09-28

Similar Documents

Publication Publication Date Title
KR101211068B1 (en) Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR101151747B1 (en) Identifying Method of Marine Species, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
CN104099405A (en) PCR (polymerase chain reaction) detection method and kit for one-time identification of mutton, chicken, duck and pork
KR100806208B1 (en) A Polynucleotide probe and chip kit for skate and ray species discrimination based on the single nucleotide polymorphisms in the mitochondrial COI gene
KR101802034B1 (en) Method and kit for identifying species of squids using real-time PCR
Schiefenhövel et al. Differentiation of Sparidae species by DNA sequence analysis, PCR-SSCP and IEF of sarcoplasmic proteins
CN107119143A (en) A kind of catfish DNA bar code standard detection sequence and its application
CN107058603A (en) A kind of catfish DNA bar code standard detection sequence and its application
KR101196640B1 (en) Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR101131789B1 (en) Identifying Method of species or origin about hairtails, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR101151757B1 (en) Identifying Method of jellyfish in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR20110092892A (en) Probe and dna chip for identifying freshwater fish species
Namikoshi et al. Species identification of Alaska pollock, Gadus spp., and Micromesistius spp. in cod roe products using a PCR-based method
KR101540852B1 (en) Molecular methods for identification of oyster species using species-specific probes, dna chip, and molecular kits
JP5566018B2 (en) Crab detection primer set
JP2007037468A (en) Method for discriminating variety of rice by using microsatelite marker
CN112280871B (en) Three-fish specific DNA molecular marker of arisaema tuber and application thereof
CN107841563A (en) Differentiate the molecular specificity labeled primers and method of catfish
CN101381769A (en) Molecular identification method for siniperca kneri garman and siniperca scherzeri and kit
KR102168820B1 (en) Genetic markers and methods for identifying species belong to genus Takifugu
Park et al. Development of a simple, rapid multiplex PCR method using the 16S rRNA gene to determine the country of origin of brackish water bivalve Corbicula japonica
CN107447020B (en) Molecular label for individual identification of sika deer, identification method and application
KR101764128B1 (en) Primer set for determining identity of shrimp material in food, method of determining identity of shrimp material in food using the same and kit comprising the same
Kamil et al. Molecular detection of Sarcocystis cruzi in slaughtered cattle at Baghdad city in Iraq
US20240026464A1 (en) Methods and compositions useful in discriminating between fish species

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20151012

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20161201

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20180913

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20190925

Year of fee payment: 8