CN112280871B - Three-fish specific DNA molecular marker of arisaema tuber and application thereof - Google Patents

Three-fish specific DNA molecular marker of arisaema tuber and application thereof Download PDF

Info

Publication number
CN112280871B
CN112280871B CN202011260450.6A CN202011260450A CN112280871B CN 112280871 B CN112280871 B CN 112280871B CN 202011260450 A CN202011260450 A CN 202011260450A CN 112280871 B CN112280871 B CN 112280871B
Authority
CN
China
Prior art keywords
fish
dna
germplasm
dna molecular
molecular marker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011260450.6A
Other languages
Chinese (zh)
Other versions
CN112280871A (en
Inventor
常玉梅
梁利群
赵雪飞
孙博
张立民
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Heilongjiang River Fisheries Research Institute of Chinese Academy of Fishery Sciences
Original Assignee
Heilongjiang River Fisheries Research Institute of Chinese Academy of Fishery Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Heilongjiang River Fisheries Research Institute of Chinese Academy of Fishery Sciences filed Critical Heilongjiang River Fisheries Research Institute of Chinese Academy of Fishery Sciences
Priority to CN202011260450.6A priority Critical patent/CN112280871B/en
Publication of CN112280871A publication Critical patent/CN112280871A/en
Application granted granted Critical
Publication of CN112280871B publication Critical patent/CN112280871B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K61/00—Culture of aquatic animals
    • A01K61/10—Culture of aquatic animals of fish
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
    • Y02A40/81—Aquaculture, e.g. of fish

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Biotechnology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a method for rapidly identifying and purifying the germplasm of three fish species of Armillariella tabescens, wherein the three fish species of Armillariella tabescens are specifically DNA molecular markers, DNA barcodes and the three fish species of Armillariella tabescens. Aiming at the existing problem of hybridization of the germplasm of three fish of the aristichthys, the invention screens and identifies three fish of the aristichthys through phenotype screening, DNA bar code screening and specificity DNA molecular marker screening, and finally screens out stable germplasm resources of three fish of the aristichthys. The method for rapidly purifying the germplasm of the three fish with the arisaema cum bile disclosed by the invention is simple to operate, high in accuracy, short in period, good in stability and high in germplasm purity, and provides technical support for germplasm protection, reasonable utilization and germplasm biodiversity.

Description

Three-fish specific DNA molecular marker of arisaema tuber and application thereof
Technical Field
The invention relates to a fish germplasm purification method, in particular to a method for identifying three-block fish specificity DNA molecular markers and variety identification and fast germplasm purification.
Background
Three fishes (Tribolodon) are a common name of several indigenous economic species of the genus three fishes of the subfamilies of the order Cypriorder, cypridae and Oncomelania, are mainly distributed in Japanese sea in the northwest of the Pacific ocean and some inland freshwater rivers, and are the only species of Cypridae fishes which fall in the sea and travel. In China, the water is only distributed in the river basin of the seiid finnish and the drawings. The three fishes are traditional rare fishes, have tender meat quality and delicious meat taste, and have higher content of human essential amino acids such as methionine and lysine than common fishes, and are rich in unsaturated fatty acid, vitamin A, vitamin D and the like. Proved by researches, the three fish bodies contain a polysaccharide-mucoprotein, have the functions of promoting cell development, improving body immunity, reducing cholesterol and preventing arteriosclerosis and coronary heart disease, and have better curative effects on metabolic diseases, physical weakness and the like. Historically, three fish were combined with large whitefish in Xingshi lake and salmon in Wusu river and referred to as "Jisai Sanzhen".
In recent years, three fish resources are exhausted due to the fact that the water area environment is destroyed, pollution, cool fishing and other natural and artificial factors are added. In order to increase the number of wild population of three fishes, a salmon hatching and releasing station (seif river) in Dongning county in China starts from 1989 to the population spawning by fishing and migration every year, and wild resources of three fishes are supplemented by artificial propagation and releasing. Three fishes are traced from Japan sea to China's seiid river for spawning in batches in 4-6 months each year, and local fishermen divide the fishes into 3 types of ' Jin Tantou ', ' silver beach head ' and ' black beach head ' according to marital color and migration time of migration groups. However, more and more evidence such as anatomies, isozymes, mitochondrial DNA and nuclear DNA molecular markers prove that there are only 2 species of three fish which are commonly called Mars three fish (T.hakonensis) of Jintao and three fish commonly called Hei tao (T.brandti) from the river to the seiid of China.
The three fish species of the Mars are similar to the three fish species, and only marital color of the Mars when the Mars are sexually mature (the sexual maturity can be achieved at the age of 4) and spawn, namely, distribution and quantity of red lines on the body side are obviously different, so that classification judgment can be carried out according to the marital color. The three fish body sides of the bead star are 3 red lines, the three fish body sides are 1 red line near the abdomen under the lateral line, and the red line phenotype characteristics of many individuals are between the two or not provided with the red line characteristics, so that the identification is difficult. The phenotype identification and molecular marker detection show that the germplasm of three fish species of the Armillariella mellea is seriously mixed, and the phenotype characteristics and gene traces specific to the three fish species appear in the phenotype and genome of some individuals. Early, japanese scholars Miura Masao and OkataAhiro performed systematic morphological studies of early development of two species, three fish species of Martin and three fish (Masao and Ahiro.1995A study on morphological disrimation between Triobolodonbrandtii and T. Hakonensis at the early development stations.45:103-109.) using melanocytes to differentiate fish fries of these two species at different locations in the body segment. However, the method is not easy to grasp in practical operation, and requires careful observation and comparison of different young fishes at the same development time, and the screening period is longer. Patent CN107365872B provides a method for identifying different migration groups of three fish in seism by using microsatellite primers SSR-1 and SSR-2, and hybridization of three fish in zucchini, three fish or both can be distinguished. Patent CN109439762a provides a more simplified pair of molecular marker primers A8 and a11 for identifying garrupa (three-fish) and three-fish.
DNA sequence assisted classification has been an ideal assisted morphological classification approach for more than 30 years. In 2003, herbert first proposed DNA barcoding (DNA barcoding) definition, i.e., species identification is performed by using short, standardized gene fragments, so as to improve the efficiency of eukaryotic organism identification, and meanwhile, the DNA sequence auxiliary classification method is unified to a certain extent, so that the development process is accelerated. Currently, DNA barcode technology has become a widely accepted species identification tool, with emphasis on standardization and data validation, also known as DNA taxonomy. Currently, the mitochondrial cytochrome C oxidase subunit I (COI) gene is the most widely used standard gene in animal DNA barcode studies because it has: (1) moderate degree of sequence variation; (2) sequences at both ends of the variant region are highly conserved; (3) proper sequence length, etc. This conclusion is well verified in many fish, insect and bird animals, but the study of three fish species, the Mars, has not been blank.
Because the three fishes are very similar in morphology and difficult to distinguish, hybridization and germplasm mixing are very easy to occur, and the traditional screening and germplasm purification means have long consumption period and are not easy to operate, the purification of the three fishes with impure germplasm is needed, the proliferation and release of the three fishes with the germplasm are scientifically guided, and the pure germplasm of the three fishes with the germplasm and the sustainable utilization of natural wild resources are ensured.
Disclosure of Invention
Aiming at the defects, the invention provides the three-fish specific DNA molecular marker, the DNA bar code and the three-fish germplasm rapid purification method, which are simple in operation, high in accuracy, short in period and high in germplasm purity, are favorable for solving the problem of germplasm mixing, and provide technical support for germplasm protection, reasonable utilization and germplasm biodiversity.
In order to achieve the above object, the present invention has the following technical scheme:
in one aspect, the invention provides a DNA molecular marker closely linked with the specificity of the germplasm of three fish species of the arisaema with the DNA molecular marker sequence shown in SEQ ID NO. 1.
On the other hand, the invention provides a primer pair for amplifying the DNA molecular markers of the three fish, wherein the primer pair comprises a primer Gene-F and a primer Gene-R, the sequence of the Gene-F is shown as SEQ ID NO. 2, and the sequence of the Gene-R is shown as SEQ ID NO. 3.
In still another aspect, the invention provides an application of the primer pair of the DNA molecular marker or the amplified DNA molecular marker of the three fish species of the arisaema with the primers in the identification, the germplasm purification or the variety improvement of the three fish species of the arisaema with the primers.
In yet another aspect, the invention provides the use of a primer pair for DNA molecular markers or amplified DNA molecular markers of three fish species of Armillariella tabescens in the preparation of a tool for variety identification, germplasm purification or variety improvement of three fish species of Armillariella tabescens.
In particular, the means are separate reagents or kits.
In yet another aspect, the invention provides a kit for variety identification, germplasm purification or variety improvement of three fish species of the genus Armillariella, said kit comprising a primer pair for DNA molecular markers or amplified DNA molecular markers of three fish species of the genus Armillariella.
Specifically, the tool is an independent reagent, a kit, a DNA fingerprint card or a DNA amplification and comparison device.
Further specifically, the tool also comprises three bead fish DNA bar code sequences and amplification primer pairs thereof, wherein the three bead fish DNA bar code sequences are shown as SEQ ID NO. 4; the amplification primer pair of the three fish DNA bar code sequences of the arisaema with the bead comprises COI-F and COI-R, wherein the sequence of the COI-F is shown as SEQ ID NO. 5, and the sequence of the COI-R is shown as SEQ ID NO. 6.
In still another aspect, the invention provides a method for rapidly purifying the germplasm of three fish blocks, wherein the method for rapidly purifying the germplasm comprises the following steps:
(1) Selecting three bead-star fish body color characteristic individuals, wherein the body color characteristic is that three red lines are arranged on the three bead-star fish body sides;
(2) Extracting total genome DNA from the individual selected in the step (1);
(3) Identifying the DNA extracted in the step (2), and selecting an individual with a major haplotype of Hap3;
(4) Identifying the DNA of the individual selected in the step (3), and selecting the individual with the DNA molecular markers of three fish with the arisaema with the DNA molecular markers;
(5) Selfing the individuals selected in the step (4), and selecting individuals which accord with the three fish haplotypes of the arisaema with the characteristics of DNA molecular markers and body colors in the offspring F1.
Specifically, in the step (1), the three red colors are respectively positioned on three fish side scales, a side scale and a side scale under the side scales of the bead star.
Specifically, in the step (3), the DNA identification method is PCR.
Further specifically, in the step (3), the PCR reaction system is 25 mu L, and comprises 1 mu L of self-made PCR buffer mix18 mu L, 1 mu L of 5U/L of Taq DNA polymerase, 0.2 mu L of DNA sample and 2.8 mu L of deionized and sterilized water, wherein the concentration of each of the upstream primer and the downstream primer is 10 mu mol/L; the self-made PCR buffer mix comprises 50mmol/L KCl, 10mmol/L Tris-HCl, 0.10% TritonX-100, 1.5mmol/L MgCl 2 0.10% NP-40, 0.01% gelatin, and 200. Mu. Mol/L4 dNTPs; wherein, the upstream and downstream primers are amplification primers COI-F and COI-R of the three fish DNA bar code sequences of the bead star.
Further specifically, in the step (3), the PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 95℃for 15s, annealing at 57.7℃for 30s, elongation at 72℃for 30s,35 cycles; finally, the extension is carried out at 72 ℃ for 7min.
More specifically, in the step (3), the PCR product is a three-block fish DNA bar code of a bead star, and the effective sequence length of the bar code is 632bp.
Specifically, in the step (4), the DNA identification method is PCR.
Further specifically, in the step (4), the PCR reaction system is 25 mu L, and comprises 1 mu L of self-made PCR buffer mix18 mu L, 1 mu L of 5U/L of Taq DNA polymerase, 0.2 mu L of DNA sample and 2.8 mu L of deionized and sterilized water, wherein the concentration of each of the upstream primer and the downstream primer is 10 mu mol/L; the self-made PCR buffer mix comprises 50mmol/L KCl, 10mmol/L Tris-HCl, 0.10% TritonX-100, 1.5mmol/L MgCl 2 0.10% NP-40, 0.01% gelatin, and 200. Mu. Mol/L4 dNTPs; wherein the upstream and downstream primers are primers Gene-F and Gene-R for amplifying the three-fish specific DNA molecular markers of the Margaret.
Further specifically, in the step (4), the PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 94℃for 30s, annealing at 56℃for 1min, extension at 72℃for 30s,35 cycles; finally, the extension is carried out for 5min at 72 ℃.
In the step (4), the PCR product is a three-fish specificity DNA molecular marker, and the effective sequence length of the DNA molecular marker is 188bp.
Specifically, in the step (5), the three fish haplotypes of the arisaema with the pearl star are Hap3; the effective sequence length of the three fish DNA molecular markers of the bead star is 188bp; the three fish body colors of the bead star are characterized in that three red lines are arranged on the body side, and the three red lines are respectively positioned on the lateral line scales, the lateral line scales and the lower side of the lateral line scales.
In still another aspect, the present invention provides a method for identifying three species of fish in the genus zhuxing, the method comprising the steps of:
(1) Phenotype identification, wherein the phenotype is three red lines on the body sides of three fish bodies of the Margaret;
(2) Extracting total genome DNA from three fish individuals qualified in the phenotype identification in the step (1);
(3) Carrying out major haplotype identification on the DNA extracted in the step (2), wherein the haplotype is Hap3;
(4) And (3) further carrying out bead star three-fish DNA molecular marker identification on the individual with the haplotype of Hap3 identified in the step (3).
Specifically, in the step (1), the three red colors are respectively positioned on three fish side scales, a side scale and a side scale under the side scales of the bead star.
Specifically, in the step (3), the major haplotype identification method is PCR.
Further specifically, in the step (3), the PCR reaction system is 25 mu L, and comprises 1 mu L of self-made PCR buffer mix18 mu L, 1 mu L of 5U/L of Taq DNA polymerase, 0.2 mu L of DNA sample and 2.8 mu L of deionized and sterilized water, wherein the concentration of each of the upstream primer and the downstream primer is 10 mu mol/L; the self-made PCR buffer mix comprises 50mmol/L KCl, 10mmol/L Tris-HCl, 0.10% TritonX-100, 1.5mmol/L MgCl 2 0.10% NP-40, 0.01% gelatin, and 200. Mu. Mol/L4 dNTPs; wherein, the upstream and downstream primers are amplification primers COI-F and COI-R of the three fish DNA bar code sequences of the bead star.
Further specifically, in the step (3), the PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 95℃for 15s, annealing at 57.7℃for 30s, elongation at 72℃for 30s,35 cycles; finally, the extension is carried out at 72 ℃ for 7min.
More specifically, in the step (3), the PCR product is a three-block fish DNA bar code of a bead star, and the effective sequence length of the bar code is 632bp.
Specifically, in the step (4), the DNA molecular marker identification method is PCR.
Further specifically, in the step (4), the PCR reaction system is 25 mu L, and comprises 1 mu L of self-made PCR buffer mix18 mu L, 1 mu L of 5U/L of Taq DNA polymerase, 0.2 mu L of DNA sample and 2.8 mu L of deionized and sterilized water, wherein the concentration of each of the upstream primer and the downstream primer is 10 mu mol/L; the self-made PCR buffer mix comprises 50mmol/L KCl, 10mmol/L Tris-HCl, 0.10% TritonX-100, 1.5mmol/L MgCl 2 0.10% NP-40, 0.01% gelatin, and 200. Mu. Mol/L4 dNTPs; wherein the upstream and downstream primers are primers Gene-F and Gene-R for amplifying the three-fish specific DNA molecular markers of the Margaret.
Further specifically, in the step (4), the PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 94℃for 30s, annealing at 56℃for 1min, extension at 72℃for 30s,35 cycles; finally, the extension is carried out for 5min at 72 ℃.
In the step (4), the PCR product is a three-fish specificity DNA molecular marker, and the effective sequence length of the DNA molecular marker is 188bp.
Compared with the prior art, the invention has the following positive and beneficial effects:
(1) The invention adopts phenotype and genotype (mitochondrial DNA bar code identification and nuclear DNA specific molecular marker identification) to screen and improve the purity of the three fish germplasm of the Armillariella mellea, has simple germplasm purification operation and more accurate identification result, can avoid germplasm mixing caused by artificial propagation and protects germplasm resources.
(2) In order to avoid interference of mitochondrial DNA maternal inheritance, the invention further carries out genome specific DNA molecular marker identification on individuals with phenotype of three lines and main effect haplotype of Hap3, thereby eliminating the condition of nuclear genome gene pollution and improving the purity of three fish germplasm of the arisaema with the characteristics of high efficiency, low cost and low cost.
(3) The invention carries out DNA bar code judgment, DNA molecular marker identification and phenotype identification on the selfing offspring F1 again, thereby further improving the stability of germplasm purification.
(4) The obtained sub-generation, namely the selfing offspring F1, can realize genome purification at the seedling stage, and can realize phenotype identification after 4 years of sexual maturity, thereby realizing germplasm purification and shortening the purification period.
Drawings
FIG. 1 is a graph showing the comparison of three fish stocks (three line individuals) and three fish-type variant forms (single line individuals).
FIG. 2 is a phylogenetic tree constructed by selecting grass carp as an outer group.
FIG. 3 is a gel electrophoresis chart of specific DNA molecular markers PCR products of 20 sexually mature individuals (three parents of Margaret) among three fish individuals selected in step 5 of example 5. Wherein M is DNA marker, and serial numbers 1-20 are 20 selected sexually mature individuals (three parents of the Martin fish).
FIG. 4 is a gel electrophoresis chart of specific DNA molecular marker identification performed on the offspring F1 of step 6 of example 5. Wherein M is DNA marker, the left side sequence numbers 1-10, 11-20 and 21-30 of the drawing are the sexually mature individuals (parents) selected in the step 5, and the right side sequence numbers 1-10, 11-20 and 21-30 of the drawing are the 30 selfing offspring individuals (offspring) selected in the step 6.
Detailed Description
The present invention will be described in further detail with reference to the following examples, which are not intended to limit the present invention, but are merely illustrative of the present invention. The experimental methods used in the following examples are not specifically described, but the experimental methods in which specific conditions are not specified in the examples are generally carried out under conventional conditions, and the materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.
Example 1 three-block fish specific DNA molecular markers and primer pairs thereof
The sequence of the bead star three-fish specific DNA molecule marker is shown as follows (SEQ ID NO: 1):
CTGGGGTTGACAAAGAATGGTCAGAAAAAGTGAAAATATCCAGTGAGCAGGAGTTCTGTGGGTTCGAGGGGATAGAAAGGCAACAGTAACTCAAATAACCACTCACTGAGGTCTACAGAAGAGCATCTCTGAATGCACAACATGTCGAACCTTGAAGCAAATGAGCTACAGCAGAAACGAACACACCA。
the amplification primer sequences of the specific DNA molecular marker sequences are shown as follows:
Gene-F(SEQ ID NO:2)：5’-CTGGGGTTGACAAAGAATGGT-3’；
Gene-R(SEQ ID NO:3)：5’-TGGTGTGTTCGTTTCTGCTG-3’。
example 2 three-block fish DNA bar code and primers therefor
The three fish DNA barcode sequences of the bead star are shown below (SEQ ID NO: 4):
GGGGACCGCTTTAAGCCTTCTCATTCGGGCTGAATTAAGTCAACCCGGGTCACTTCTAGGTGACGACCAAATTTATAACGTTATTGTTACTGCCCACGCCTTCGTAATAATTTTCTTTATAGTGATGCCAATTCTTATCGGAGGATTTGGAAATTGACTGGTGCCACTAATGATTGGGGCACCTGACATGGCATTCCCCCGAATAAATAATATAAGCTTCTGACTACTACCGCCATCATTCCTACTACTACTAGCCTCTTCTGGCGTTGAAGCCGGAGCTGGGACAGGATGAACAGTATACCCACCACTTGCAGGCAACCTCGCCCACGCAGGAGCATCAGTAGACTTAACAATCTTCTCTTTACATCTGGCAGGTGTATCATCTATCCTAGGGGCAGTAAATTTTATTACTACAATTATTAATATGAAACCCCCAGCCATCTCCCAGTACCAAACACCCTTATTTGTATGGTCCGTACTCGTAACAGCCGTCCTCCTCCTTCTGTCGCTACCAGTCCTAGCTGCCGGAATTACAATGCTCCTTACAGACCGTAACCTAAACACTACATTCTTTGACCCAGCAGGCGGAGGCGACCCAATTCTGTATCAACACCTATTCTGATTCTTTGGTC。
the amplification primer sequences of the three fish DNA barcode sequences of the bead are as follows:
COI-F(SEQ ID NO:5)：5’-TCAACCAACCACAAAGACATTGGCAC-3’；
COI-R(SEQ ID NO:6)：5’-TAGACTTCTGGGTGGCCAAAGAATCA-3’。
example 3 method for identifying germplasm of three fish
1. Three fish phenotypes of the pearl star are identified: and selecting the individual with unique body color characteristics of three fishes of the arisaema with three red lines on the body sides, wherein the individual is positioned on the lateral line scales, the lateral line scales and the individual under the lateral line scales respectively.
2. Extracting the total DNA of the genome of the individual selected in the step 1:
the extraction steps are as follows: cutting a small amount of fin stored by 95% ethanol, sucking the ethanol by filter paper, placing the fin into a 2mL centrifuge tube, adding 600 mu LDNA extraction lysate, and placing the lysate at 55 ℃ for overnight digestion, wherein the DNA extraction lysate comprises the following components: 1mol/L Tris (pH 8.0), 5mol/L NaCl, 0.5mol/L EDTA (pH 8.0), 10% SDS and 200. Mu.g/mL proteinase K; adding an equal volume of phenol/chloroform mixture (volume ratio of 1:1) for extraction 1 time the next day, centrifuging at room temperature for 10min at 12000r/min, sucking the supernatant (about 550 mu L), adding 1mL of absolute ethanol for precipitation, centrifuging at room temperature for 10min at 12000r/min, washing with 70% ethanol for 1 time, drying at room temperature for 10min, and adding 0.1 xTE for dissolution. The integrity of the DNA was checked by 1% agarose gel electrophoresis, the DNA concentration was determined by Nanodrop 8000 (Thermo Fisher Scientific, MA, USA) and diluted to 10 ng/. Mu.L, and stored at 4℃for further use.
3. And (3) performing PCR reaction on the total genome DNA extracted in the step (2), judging DNA barcode sequences of three fish of the arisaema with the characteristics of main effect haplotype of Hap 3.
Wherein, the PCR reaction system is 25 mu L, which comprises 18 mu L of self-made PCR buffer mix, 1 mu L of upstream and downstream primers with the concentration of 10 mu mol/L, 0.2 mu L of Taq DNA polymerase with the concentration of 5U/L, 2 mu L of DNA sample and 2.8 mu L of deionized and sterilized water; the self-made PCR buffer mix comprises 50mmol/L KCl, 10mmol/L Tris-HCl, 0.10% TritonX-100, 1.5mmol/L MgCl2, 0.10% NP-40, 0.01% gelatin and 200 mu mol/L4 dNTPs; wherein, the upstream and downstream primers are the amplification primers COI-F and COI-R of the three-block fish DNA barcode sequence of the Margaret in example 2.
The PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 95℃for 15s, annealing at 57.7℃for 30s, elongation at 72℃for 30s,35 cycles; finally, the extension is carried out at 72 ℃ for 7min.
The effective sequence length of the three fish DNA barcodes COI of the bead star is 632bp. And (5) sequencing the PCR amplified product after the PCR amplified product is qualified by 1.5% agarose gel electrophoresis. After alignment with the three fish DNA barcode sequences of example 2, individuals with a major haplotype of Hap3 were selected.
4. And (3) performing PCR reaction on the total genome DNA of the individual selected in the step (3), performing identification of the molecular markers of the specific DNA of the three fish species of the Armillariella, and selecting the individual with the molecular markers of the specific DNA of the three fish species of the Armillariella.
Wherein, the PCR reaction system is 25 mu L, which comprises 18 mu L of self-made PCR buffer mix, 1 mu L of upstream and downstream primers with the concentration of 10 mu mol/L, 0.2 mu L of Taq DNA polymerase with the concentration of 5U/L, 2 mu L of DNA sample and 2.8 mu L of deionized and sterilized water; the self-made PCR buffer mix comprises 50mmol/L KCl, 10mmol/L Tris-HCl, 0.10% TritonX-100, 1.5mmol/L MgCl2, 0.10% NP-40, 0.01% gelatin and 200 mu mol/L4 dNTPs; wherein, the upstream and downstream primers are primers Gene-F and Gene-R labeled with three fish-specific DNA molecules of the amplified bead in example 1.
The PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 94℃for 30s, annealing at 56℃for 1min, extension at 72℃for 30s,35 cycles; finally, the extension is carried out for 5min at 72 ℃.
The effective sequence length of the molecular marker of the specificity DNA of the three fishes in the arisaema with the bead is 188bp. The PCR amplified products were detected by 1.5% agarose gel electrophoresis, and individuals with the bead-star three-fish-specific DNA molecular bands were selected, or individuals consistent with the bead-star three-fish-specific DNA molecular marker sequences of example 1 were selected by sequencing.
Example 4 method for purifying the germplasm of three fish species of Arisaema cum bile
Steps 1-4 are the same as in example 3.
5. Selfing the individual selected in the step 4, judging the DNA bar code and identifying the specific DNA molecular marker by the offspring F1, and selecting the individual which accords with the characteristics of three fish of the arisaema with the following characteristics: the effective sequence length of DNA bar code identification is 632bp, the haplotype is Hap3 (or the sequence alignment is consistent); specific DNA molecular markers identify that the effective sequence length is 188bp (or consistent by sequence alignment); the three red color is respectively positioned on the side line scale, the side line scale and the lower side line scale to finish the purification of three fish blocks of the arisaema with beads.
EXAMPLE 5 Rapid germplasm purification of Triplopus niveus
1. Three fishes of wild arisaema with 4 ages are selected from the three fishes cultured in the outdoor pond of the hula laboratory station of the institute of aquatic products of Heilongjiang, china.
2. Three fish phenotypes of the pearl star are identified:
the three fish with the wild arisaema with the red lines are respectively positioned on the lateral line scale, the lateral line scale and the lower part of the lateral line scale, and the three fish with the wild arisaema with the red lines are respectively positioned under the lateral line scale. And selecting 93 individuals with three red lines as the body color characteristics from 162 individuals with pure body colors.
3. And (3) carrying out electronic marking on the 162 wild three fish, and respectively extracting total genome DNA. The extraction steps are as follows: cutting a small amount of fin stored by 95% ethanol, sucking the ethanol by filter paper, placing the fin into a 2mL centrifuge tube, adding 600 mu LDNA extraction lysate, and placing the lysate at 55 ℃ for overnight digestion, wherein the DNA extraction lysate comprises the following components: 1mol/L Tris (pH 8.0), 5mol/L NaCl, 0.5mol/L EDTA (pH 8.0), 10% SDS and 200. Mu.g/mL proteinase K; adding an equal volume of phenol/chloroform mixture (volume ratio of 1:1) for extraction 1 time the next day, centrifuging at room temperature for 10min at 12000r/min, sucking the supernatant (about 550 mu L), adding 1mL of absolute ethanol for precipitation, centrifuging at room temperature for 10min at 12000r/min, washing with 70% ethanol for 1 time, drying at room temperature for 10min, and adding 0.1 xTE for dissolution. The integrity of the DNA was checked by 1% agarose gel electrophoresis, the DNA concentration was determined by Nanodrop 8000 (Thermo Fisher Scientific, MA, USA) and diluted to 10 ng/. Mu.L, and stored at 4℃for further use.
4. And (3) carrying out PCR amplification on the total DNA of the genome of the 162 tail wild three fish extracted in the step (3), and further judging the DNA barcode sequence.
The PCR reaction system is 25 mu L, comprising 18 mu L of self-made PCR buffer mix, 1 mu L of upstream and downstream primers with the concentration of 10 mu mol/L, 0.2 mu L of Taq DNA polymerase with the concentration of 5U/L, 2 mu L of DNA sample and 2.8 mu L of deionized and sterilized water; the self-made PCR buffer mix comprises 50mmol/L KCl, 10mmol/L Tris-HCl, 0.10% TritonX-100, 1.5mmol/L MgCl2, 0.10% NP-40, 0.01% gelatin and 200 mu mol/L4 dNTPs; wherein, the upstream and downstream primers are the amplification primers COI-F and COI-R of the three-block fish DNA barcode sequence of the Margaret in example 2.
The PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 95℃for 15s, annealing at 57.7℃for 30s, elongation at 72℃for 30s,35 cycles; finally, the extension is carried out at 72 ℃ for 7min.
And (3) detecting the PCR amplified product by using 1.5% agarose gel electrophoresis, and sending the PCR amplified product to a biological sequencing company for sequencing. The three fish DNA barcodes of the arisaema with the effective sequence length of 632bp are obtained after the comparison treatment with the three fish DNA barcodes of the arisaema with the example 2. Grass carp is selected as an outer group, and simultaneously, a phylogenetic tree is constructed by adopting an adjacent method (NJ) by combining three fish sequences published by NCBI. Apart from the grass carp outer group (haplotype is Hap 5), the phylogenetic tree is divided into two branches, the individuals with haplotypes Hap3 and Hap4 are clustered into three fish with Margaret (Jin Tantou), the individuals with haplotypes Hap1 and Hap2 are clustered into three fish (black beach head), and the phylogenetic tree is shown in figure 2. In addition, individuals clustered into three fish species of the Margaret have both three-line and single-line individuals, as shown in Table 1 below, from different individual haplotype distributions. Three fish from the Margaret are shown to be mixed to varying degrees at both the phenotype and DNA level. Therefore, the individual (88 tails) with main effect haplotype of Hap3 and body color of three red lines is selected for further purification.
TABLE 1 haplotype statistics
Figure BDA0002774483160000101
Figure BDA0002774483160000111
5. And (3) carrying out specific DNA molecular marker identification on the individuals (88 tails) with the main effect haplotype of Hap3 and the body color of three red lines selected in the step (4), and selecting the individuals with the specific DNA molecular markers.
The PCR reaction system is 25 mu L, comprising 18 mu L of self-made PCR buffer mix, 1 mu L of upstream and downstream primers with the concentration of 10 mu mol/L, 0.2 mu L of Taq DNA polymerase with the concentration of 5U/L, 2 mu L of DNA sample and 2.8 mu L of deionized and sterilized water; the self-made PCR buffer mix comprises 50mmol/L KCl, 10mmol/L Tris-HCl, 0.10% TritonX-100, 1.5mmol/L MgCl2, 0.10% NP-40, 0.01% gelatin and 200 mu mol/L4 dNTPs; wherein, the upstream and downstream primers are primers Gene-F and Gene-R labeled with three fish-specific DNA molecules of the amplified bead in example 1.
The PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 94℃for 30s, annealing at 56℃for 1min, extension at 72℃for 30s,35 cycles; finally, the extension is carried out for 5min at 72 ℃.
The effective sequence length of the molecular marker of the specificity DNA of the three fishes in the arisaema with the bead is 188bp. The PCR amplified products were detected by agarose gel electrophoresis at 1.5%. The result shows that the electrophoresis bands of the three fish gels of the 88 tail-bead stars are consistent, the bands consistent with the three fish gels of the wild-bead stars can be amplified, the unique DNA bands of the three fish do not appear, and the electrophoresis result diagram of the three fish gels of the 20 tail-bead stars is selected for display, as shown in figure 3.
6. And (3) selfing the 88 tail star three fish individuals selected in the step (5), extracting genome total DNA from the offspring F1, judging DNA barcode sequences and identifying specific DNA molecular markers, and determining the individuals with haplotypes of Hap3, three fish specific DNA molecular markers with the pearl star and three red lines on the body side as purified germplasm resources.
As shown in FIG. 4, the offspring F1 is identified by specific DNA molecular markers, 30 parents and 30 offspring F1 are selected respectively, the offspring F1 gel electrophoresis result is consistent with that of three fishes of the parent arisaema with beads, and the genotype of the germplasm resource is proved to be consistent with that of the parent.
Example 6 verification
And (3) selfing the obtained germplasm resources to obtain F2 generation 1500 tail, wherein all individual body sides of the F2 generation are provided with three red lines, the haplotype is Hap3, and the F2 generation has three fish-specific DNA molecular markers of the Margaret. The verification result shows that the purification method is effective, stable and reliable.
The foregoing examples illustrate only a few embodiments of the invention and are described in detail herein without thereby limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.
Sequence listing
<110> institute of aquatic products of Heilongjiang, national institute of aquatic products
<120> a molecular marker of three fish-specific DNA of Margaret and application thereof
<130> 20201020
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 188
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 1
ctggggttga caaagaatgg tcagaaaaag tgaaaatatc cagtgagcag gagttctgtg 60
ggttcgaggg gatagaaagg caacagtaac tcaaataacc actcactgag gtctacagaa 120
gagcatctct gaatgcacaa catgtcgaac cttgaagcaa atgagctaca gcagaaacga 180
acacacca 188
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 2
ctggggttga caaagaatgg t 21
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 3
tggtgtgttc gtttctgctg 20
<210> 4
<211> 632
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 4
ggggaccgct ttaagccttc tcattcgggc tgaattaagt caacccgggt cacttctagg 60
tgacgaccaa atttataacg ttattgttac tgcccacgcc ttcgtaataa ttttctttat 120
agtgatgcca attcttatcg gaggatttgg aaattgactg gtgccactaa tgattggggc 180
acctgacatg gcattccccc gaataaataa tataagcttc tgactactac cgccatcatt 240
cctactacta ctagcctctt ctggcgttga agccggagct gggacaggat gaacagtata 300
cccaccactt gcaggcaacc tcgcccacgc aggagcatca gtagacttaa caatcttctc 360
tttacatctg gcaggtgtat catctatcct aggggcagta aattttatta ctacaattat 420
taatatgaaa cccccagcca tctcccagta ccaaacaccc ttatttgtat ggtccgtact 480
cgtaacagcc gtcctcctcc ttctgtcgct accagtccta gctgccggaa ttacaatgct 540
ccttacagac cgtaacctaa acactacatt ctttgaccca gcaggcggag gcgacccaat 600
tctgtatcaa cacctattct gattctttgg tc 632
<210> 5
<211> 26
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 5
tcaaccaacc acaaagacat tggcac 26
<210> 6
<211> 26
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 6
tagacttctg ggtggccaaa gaatca 26

Claims (7)

1. The DNA molecular marker closely linked with the specificity of the three fish germplasm of the arisaema with the bead is characterized in that the DNA molecular marker is a sequence shown as SEQ ID NO. 1.
2. A primer pair for amplifying the DNA molecular marker of claim 1, wherein the primer pair comprises a primer Gene-F and a primer Gene-R, the sequence of the Gene-F is shown as SEQ ID NO. 2, and the sequence of the Gene-R is shown as SEQ ID NO. 3.
3. Use of the DNA molecular marker of claim 1 or the primer pair of claim 2 in identification, germplasm purification or breed improvement of a three-piece fish variety of the zucchini.
4. Use of a DNA molecular marker according to claim 1 or a primer pair according to claim 2 in the preparation of a tool for identification, germplasm purification or breed improvement of three fish species of the genus zucchini.
5. The use according to claim 4, wherein the means is a separate reagent or kit.
6. A tool for variety identification, germplasm purification or variety improvement of three fish of the genus zucchini, characterized in that said tool comprises the DNA molecular marker of claim 1 or the primer pair of claim 2.
7. The tool of claim 6, wherein the tool is a stand-alone reagent, a kit, a DNA fingerprinting card, or a DNA amplification and alignment device.
CN202011260450.6A 2020-11-12 2020-11-12 Three-fish specific DNA molecular marker of arisaema tuber and application thereof Active CN112280871B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011260450.6A CN112280871B (en) 2020-11-12 2020-11-12 Three-fish specific DNA molecular marker of arisaema tuber and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011260450.6A CN112280871B (en) 2020-11-12 2020-11-12 Three-fish specific DNA molecular marker of arisaema tuber and application thereof

Publications (2)

Publication Number Publication Date
CN112280871A CN112280871A (en) 2021-01-29
CN112280871B true CN112280871B (en) 2023-07-14

Family

ID=74397963

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011260450.6A Active CN112280871B (en) 2020-11-12 2020-11-12 Three-fish specific DNA molecular marker of arisaema tuber and application thereof

Country Status (1)

Country Link
CN (1) CN112280871B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113528677B (en) * 2021-08-11 2022-02-18 华中农业大学 Leaf-specific notopterygium plateau loach microsatellite molecular marker, and primer and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107365872A (en) * 2017-09-15 2017-11-21 中国水产科学研究院黑龙江水产研究所 The method for identifying the three pieces of fish difference migration colonies in the Suifenhe
CN109439762A (en) * 2018-11-13 2019-03-08 中国水产科学研究院黑龙江水产研究所 Identify the molecular labeling and method of pearl star graining and three pieces of fishes

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107365872A (en) * 2017-09-15 2017-11-21 中国水产科学研究院黑龙江水产研究所 The method for identifying the three pieces of fish difference migration colonies in the Suifenhe
CN109439762A (en) * 2018-11-13 2019-03-08 中国水产科学研究院黑龙江水产研究所 Identify the molecular labeling and method of pearl star graining and three pieces of fishes

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
Biological identifications through DNA barcodes;Paul D. N. Hebert et al.;《Proc. R. Soc. Lond. B》;313–321 *
MF450499.1;NCBI;《GenBank》;全文 *
MG388101.1;NCBI;《GenBank》;全文 *
XM_021476774.1;NCBI;《GenBank》;全文 *
中国绥芬河三块鱼不同群体的种属划分及起源;常玉梅等;《中国水产科学》;第25卷(第4期);811-818 *
绥芬河三块鱼和珠星三块鱼种群的生化遗传变异及亲缘关系;马波等;《中国水产科学》;第12卷(第6期);688-693 *
绥芬河三块鱼和珠星三块鱼种群的生化遗传变异及亲缘关系的RAPD分析;陈金平等;《中国水产科学》;第9卷(第1期);1-4 *

Also Published As

Publication number Publication date
CN112280871A (en) 2021-01-29

Similar Documents

Publication Publication Date Title
CN106381331B (en) The relevant SNP marker of Growth of Grass Carps Ctenopharyngodon Idellus speed and its application
CN102134593B (en) Gender-specific microsatellite marker for Cynoglossus semilaevis and application of same in identification of superfemale Cynoglossus semilaevis
CN105969845B (en) The molecular labeling of eye muscle area character related gene SVEP1 and its application
CN105506162B (en) SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof
CN112746111B (en) Northern snakehead male molecular marker primer and application thereof
CN107779516A (en) A kind of SNP marker for influenceing pig birth weight character and its application
CN114836543A (en) Female molecular marker primer of channa maculata, application thereof and method for identifying sex of channa maculata
CN112280871B (en) Three-fish specific DNA molecular marker of arisaema tuber and application thereof
CN111254202A (en) Primer group, kit and detection method for detecting Atlantic salmon
CN107365872B (en) Method for identifying different migration populations of three fishes in seiunhe
CN110144406B (en) Method for screening DNA bar codes of Kebao broiler chickens and application thereof
CN114959056B (en) SSR (simple sequence repeat) marker for identifying female procambarus clarkia and application thereof
CN113736891B (en) Molecular marker G2997 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof
CN110438245B (en) SNP (single nucleotide polymorphism) marker of clam and application thereof
CN113584188A (en) Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application
CN113604587A (en) Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof
CN110724749B (en) Molecular marker C104 of portunus trituberculatus resistant vibrio parahaemolyticus and application thereof
CN105603097A (en) Microsatellite marker primers used for pinctada fucata martensii microsatellite family identification, identification method and application
CN112029868A (en) Portunus trituberculatus microsatellite markers and application thereof in growth trait association analysis
CN110607377A (en) Primer, probe and method for identifying Antarctic canine fish based on 16S rRNA gene
CN110592239A (en) Primer, probe and method for identifying Antarctic canis based on Cyt b gene
JP2008237129A (en) Genetic sex determination method for flounder and primer to be used in genetic sex determination method
CN113621714B (en) Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof
CN112813172B (en) Primer and method for identifying zander population
KR102584621B1 (en) Genetic markers for discriminating fish species of Lagocephalus and identification method using the same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant