CN113584188A - Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application - Google Patents
Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application Download PDFInfo
- Publication number
- CN113584188A CN113584188A CN202111060286.9A CN202111060286A CN113584188A CN 113584188 A CN113584188 A CN 113584188A CN 202111060286 A CN202111060286 A CN 202111060286A CN 113584188 A CN113584188 A CN 113584188A
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- low
- penaeus japonicus
- temperature
- japonicus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001124325 Marsupenaeus japonicus Species 0.000 title claims abstract description 68
- 239000003147 molecular marker Substances 0.000 title claims abstract description 49
- 239000002773 nucleotide Substances 0.000 claims abstract description 9
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 9
- 108091028043 Nucleic acid sequence Proteins 0.000 claims abstract description 3
- 238000012163 sequencing technique Methods 0.000 claims description 30
- 108020004414 DNA Proteins 0.000 claims description 29
- 241000238557 Decapoda Species 0.000 claims description 17
- 238000012408 PCR amplification Methods 0.000 claims description 15
- 230000003321 amplification Effects 0.000 claims description 9
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 9
- 230000002068 genetic effect Effects 0.000 claims description 6
- 238000004458 analytical method Methods 0.000 claims description 5
- 238000012216 screening Methods 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 4
- 238000010276 construction Methods 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 230000000366 juvenile effect Effects 0.000 claims description 2
- 210000003205 muscle Anatomy 0.000 claims description 2
- 230000002194 synthesizing effect Effects 0.000 claims description 2
- 238000009395 breeding Methods 0.000 abstract description 19
- 230000001488 breeding effect Effects 0.000 abstract description 17
- 238000000034 method Methods 0.000 abstract description 7
- 238000001514 detection method Methods 0.000 abstract description 5
- 238000011161 development Methods 0.000 abstract description 5
- 230000009286 beneficial effect Effects 0.000 abstract description 4
- 239000000047 product Substances 0.000 description 12
- 230000035772 mutation Effects 0.000 description 9
- 238000001179 sorption measurement Methods 0.000 description 9
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 7
- 238000001914 filtration Methods 0.000 description 6
- 238000002156 mixing Methods 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 239000007788 liquid Substances 0.000 description 5
- 239000003550 marker Substances 0.000 description 5
- 239000002699 waste material Substances 0.000 description 5
- 238000001962 electrophoresis Methods 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 210000001519 tissue Anatomy 0.000 description 4
- 239000000872 buffer Substances 0.000 description 3
- 230000000875 corresponding effect Effects 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108091092584 GDNA Proteins 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 239000002244 precipitate Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 239000013535 sea water Substances 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 206010057040 Temperature intolerance Diseases 0.000 description 1
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 239000000539 dimer Substances 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000012268 genome sequencing Methods 0.000 description 1
- 235000013372 meat Nutrition 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 229910052760 oxygen Inorganic materials 0.000 description 1
- 239000001301 oxygen Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 239000011541 reaction mixture Substances 0.000 description 1
- 239000012487 rinsing solution Substances 0.000 description 1
- 238000009394 selective breeding Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a low-temperature-resistant molecular marker C6101 of penaeus japonicus and application thereof. The nucleotide sequence of the molecular marker C6101 is shown in SEQ ID No.1, and the low-temperature tolerance genotype is CT genotype. The nucleotide sequences of the primer pair for amplifying the molecular marker C6101 are shown as SEQ ID No.2 and SEQ ID No. 3. The molecular marker C6101 provided by the invention can not be limited by the growth stage of the penaeus japonicus, obviously quickens the breeding process of the penaeus japonicus and quickly breeds a new penaeus japonicus species with excellent low temperature tolerance character, and the detection of the low temperature tolerance character of the penaeus japonicus by using the molecular marker C6101 is accurate, reliable and simple in operation, is beneficial to the healthy culture and development of the penaeus japonicus, and has wide application prospect.
Description
Technical Field
The invention belongs to the technical field of DNA molecular markers, and particularly relates to a low-temperature-resistant molecular marker C6101 of penaeus japonicus and application thereof.
Background
Japanese prawn (Marsupenaeus japonicus) Originally named as Japanese prawn, belongs to the order of ten-legged, prawns and Pacific shrimps, is distributed in the sea areas of India-Western Pacific tropical zone, African east coast, Malaysia, Japan, Korea, China southeast coast and the like, and is one of the main prawn culture varieties in China. The penaeus japonicus grows rapidly, is resistant to dry dew, is bright in color and high in economic value, is popular with water product markets and cultivators, is cultured in provinces and cities from south to north in China and coastal areas, and forms a certain scale, so that fine breed breeding has important significance for the penaeus japonicus breeding industry. Low temperature resistance is an important stress resistance character of the penaeus japonicus. On one hand, because the penaeus japonicus has higher market demand, the penaeus japonicus is mainly cultured in northern water areas in China, including northern provinces of seawater areas such as Shandong, Hebei, Jiangsu and the like, and low temperature resistance becomes an important stress resistance character pursued by the penaeus japonicus culture industry in northern China; on the other hand, in the spring festival of China, the market price of fresh and alive Japanese prawns is more than 3 times of that of ordinary seasons, farmers in northern areas and other places often risk to bring the time to market to winter, the cultured prawns are usually killed in a large scale due to sudden drop of water temperature caused by cold tide in winter, and the breeding of low-temperature-resistant varieties is also an urgent need of the Japanese prawn breeding industry.
The traditional breeding method depends on phenotype selection and has the disadvantages of long period, instability and the like. Molecular breeding, namely molecular marker-assisted selective breeding, refers to a technology for selecting breeding materials by using DNA molecular markers, and a molecular breeding method carries out backup parent selection according to effective molecular markers, so that the economic characters of filial generations can be improved more quickly. SNP (Single Nucleotide polymorphism) refers to single Nucleotide polymorphism on a genome, and is the most widely and latest molecular marker at present. At present, the research on the development of low temperature resistant molecular markers of penaeus japonicus is less, and the industry lacks markers applicable to molecular marker assisted breeding. Therefore, the development of molecular markers related to low-temperature resistance is of great significance to the healthy culture and the accelerated breeding process of the penaeus japonicus.
Disclosure of Invention
The invention provides a low-temperature-resistant molecular marker C6101 of penaeus japonicus and application thereof. The molecular marker C6101 of the invention has high identification efficiency and accuracy on the low temperature resistant shape of the Penaeus japonicus, can be used for screening the low temperature resistant individuals of the Penaeus japonicus, and is beneficial to the cultivation of the low temperature resistant shape of the Penaeus japonicus and the development of the breeding industry.
In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:
the invention provides a low-temperature-resistant molecular marker C6101 of Japanese prawn, and the nucleotide sequence of the molecular marker C6101 is shown in SEQ ID No. 1.
Further, the 501 th base in the molecular marker C6101 is T.
Further, the low-temperature tolerance genotype of the molecular marker C6101 is CT genotype.
Further, the molecular marker C6101 is an SNP marker.
The invention also provides a primer pair for amplifying the molecular marker C6101, and the nucleotide sequence of the primer pair is shown as SEQ ID No.2 and SEQ ID No. 3.
Further, the primer pair is C6101-F and C6101-R, and the nucleotide sequence is:
C6101-F：5’-GGGCTTCAGATGTTACCAGG-3’；
C6101-R：5’-GCTCGGAACAGAATTTTAGAGA-3’。
the invention also provides application of the molecular marker C6101 or the primer pair in screening the Penaeus japonicus low-temperature tolerant variety.
Further, the application steps of the molecular marker C6101 are as follows:
(1) synthesizing amplification primers C6101-F and C6101-R with the nucleotide sequences shown as SEQ ID No.2 and SEQ ID No. 3;
(2) extracting DNA of the penaeus japonicus;
(3) performing PCR amplification by using the extracted DNA as a template and using amplification primers C6101-F and C6101-R;
(4) and sequencing the amplified product, wherein the genotype of the molecular marker in the sequencing result is the CT genotype, and the penaeus japonicus is a low-temperature tolerant variety.
Further, the 501 th base of the molecular marker C6101 in the sequencing result in the step (4) is T, so that the penaeus japonicus is a low-temperature tolerant variety; if the 501 th base of the molecular marker C6101 is C, the Penaeus japonicus is a low-temperature intolerant variety.
Further, the PCR amplification conditions are as follows: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 30s, and repeating for 32 cycles; the circulation extends for 72 ℃ for 7 min.
Further, the PCR amplification reaction system is as follows: 2 XMatermix 10. mu.L, amplification primers 0.5. mu.L each, DNA 2. mu.L, ddH2O 7 μL。
Further, the extracted source of the DNA of the penaeus japonicus comprises muscle tissues of the penaeus japonicus and whole individuals in a juvenile period.
The invention also provides application of the molecular marker C6101 in the genetic diversity analysis, germplasm identification and genetic map construction of the Japanese prawn.
Compared with the prior art, the invention has the following advantages and beneficial effects:
1. the low-temperature-resistant molecular marker C6101 of the penaeus japonicus provided by the invention can not be limited by the growth stage of the penaeus japonicus, and can be used for breeding early-stage young penaeus japonicus and parents of the penaeus japonicus, thereby obviously accelerating the breeding process of the penaeus japonicus and rapidly breeding a new penaeus japonicus variety with excellent low-temperature tolerance.
2. The molecular marker C6101 provided by the invention is used for detecting the low temperature resistance of the penaeus japonicus, the method is accurate and reliable, the operation is simple, the characters meeting the requirements can be effectively and quickly screened, the short-time and low-cost breeding of the low temperature resistance penaeus japonicus variety can be realized in an early stage, the number of the excellent quality penaeus japonicus is increased, the breeding rate and the breeding period of the penaeus japonicus are improved, the yield of the penaeus japonicus is further improved, and the healthy propagation of the penaeus japonicus is promoted, so that the molecular marker C6101 has a wide application prospect.
Drawings
FIG. 1 is a diagram showing the sequencing peaks of the mixed template PCR product of the present invention.
FIG. 2 is an electrophoretogram of PCR products from individual low temperature tolerant and low temperature intolerant individuals of the present invention.
FIG. 3 is a graph showing the difference of sequencing results at two groups of corresponding positions of the low temperature tolerant group and the low temperature intolerant group in the present invention.
Detailed Description
The technical solution of the present invention will be described in further detail with reference to specific examples.
The penaeus japonicus used in the invention is from the experimental base of Retzhei treasure Co., Ltd. 300 penaeus japonicus with the weight of 10 +/-3 g are placed in 4 culture ponds (500 cm multiplied by 300 cm multiplied by 150 cm) for temporary culture for 7d, the water temperature is kept at 28 +/-1 ℃ during the temporary culture, water is added to the pond to reach 20 cm, the pH value is 8.2 +/-0.5, oxygen supply is continuously carried out, fresh seawater is replaced at 8 o 'clock in the morning, fresh clam meat is fed at 5 o' clock in the afternoon, and the feeding amount is about 10% of the weight of the penaeus japonicus. And 7d, selecting the penaeus japonicus with good activity and complete body surface for subsequent experiments.
The low-temperature tolerance test is carried out on 300-tailed Japanese prawns under the stress condition of 10 +/-0.5 ℃, the individual tolerance time is counted, 20-tailed prawns which die first are taken as a low-temperature intolerant group (UT), and 20-tailed prawns which survive last are taken as a low-temperature tolerant group (T). Genomic DNAs of Penaeus japonicus in the low-temperature intolerant group and the low-temperature tolerant group were extracted using a Tiangen marine animal tissue genome extraction kit (TIANGEN, Tiangen Biochemical technology Co., Ltd.).
Example 1
Screening of low temperature-resistant related candidate molecular markers
1. Sequencing data filtering and alignment
Genomic DNA of Penaeus japonicus was extracted, and 20 individuals were used for each of the low-temperature-tolerant group and the low-temperature-intolerant group. The genomic DNA of the penaeus japonicus is extracted by using a centrifugal adsorption column which can be specifically combined with the DNA and a unique buffer solution system. First, approximately 30 mg of tissue sample was placed into a 1.5 mL sterile enzyme centrifuge tube, 200. mu.L of buffer GA and 20. mu.L of protease K solution were added, vortexed, and incubated at 56 ℃ until the tissue was completely lysed. Then 200. mu.L of buffer GB was added, mixed well by inversion, left at 70 ℃ for 10 min, the solution cleared and centrifuged briefly to remove inner wall water droplets. Adding 200 μ L of anhydrous ethanol, mixing thoroughly, adding flocculent precipitate, centrifuging briefly, adding the obtained solution and flocculent precipitate into adsorption column CB3 (adsorption column is placed in collecting tube), centrifuging at 12000 rpm for 30s, discarding waste liquid, and returning adsorption column CB3 to collecting tube. Add 500. mu.L of buffer GD to adsorption column CB3, centrifuge at 12000 rpm for 30s, discard waste, place adsorption column CB3 in the collection tube. 600. mu.L of the rinsing solution PW was added to the adsorption column CB3, and centrifuged at 12000 rpm for 30s, and the waste liquid was discarded, and the adsorption column CB3 was put into the collection tube. Discard the waste liquid (repeat once), add 700. mu.L of rinsing liquid PW, centrifuge at 12000 rpm for 30s, and discard the waste liquid. The reaction mixture was then air-separated at 12000 rpm for 2min to completely remove the residual reagents. The adsorption column CB3 was placed in a clean centrifuge tube, 40. mu.L of distilled water was added to the center of the column, and the column was allowed to stand at room temperature for 15min, centrifuged at 12000 rpm for 2min, and the DNA was eluted. The concentration and purity of the DNA was determined using a Nanodrop spectrophotometer.
Respectively randomly breaking single DNA samples including low-temperature tolerant groups and low-temperature intolerant groups into fragments with the length of 350bp by a Covaris crusher, constructing a Library by adopting a TruSeq Library Construction Kit, and completing the preparation of the whole Library by the steps of end repairing, ployA tail adding, sequencing joint adding, purification, PCR amplification and the like of the DNA fragments. The constructed library was sequenced by Illumina HiSeq PE 150.
And strictly filtering sequencing data to obtain high-quality clean data. And (4) counting the output data of the 40 samples, wherein the statistics comprise effective data after sequencing filtration, the number of the compared fragments and the like. The total sequencing data amount is 611.10 Gb, the high-quality clean data amount is 605.67 Gb, and the sequencing data results are shown in Table 1.
TABLE 1 summary of sequencing data quality
Remarking: t stands for low temperature tolerance and UT stands for low temperature intolerance.
The filtered effective data are compared by Burrows-Wheeler alignment tool (BWA) software, and the comparison result is subjected to SAMTOOLS to remove duplication. The alignment result shows that the alignment rate of all samples is more than 85%, the average sequencing depth is more than 25 x, and the method can be used for subsequent analysis.
2. Marker detection and annotation
SNP detection was performed using SAMTOOLS software. Detecting polymorphic sites in a population by using a Bayesian model, and filtering and screening to obtain SNPs with high quality as follows:
1) q20 quality control;
2) SNP sites are at least 5 bp apart from each other;
3) the support number (depth of coverage) of SNPs was between [ 1/3, 5] times the average depth.
The SNP detection results were then annotated with ANNOVAR. The SNP results are shown in Table 2 and are statistics after filtering according to the Depth (DP) of more than 4, the deletion rate of 0.2 and the minimum allele frequency of 0.05.
TABLE 2 statistics of SNP detection results
| Grouping | Number of SNPs |
| Upstream of | 64,625 |
| Exon(s) | 164,828 |
| Intron | 813,147 |
| Shear-connecting body | 237 |
| Downstream | 67,117 |
| Between genes | 1,738,584 |
| Total of | 2,848,538 |
3. SNP differential analysis
The SNP-index of each site of the low-temperature tolerant group and the low-temperature intolerant group is analyzed and counted according to the following method:
var _ T = number of individuals with variation (heterozygous mutation 0/1, homozygous mutation 1/1)/number of individuals in the tolerant group;
var _ UT = number of individuals with variation (heterozygous mutation 0/1, homozygous mutation 1/1)/number of individuals in the non-tolerant group.
And calculating the SNP frequency difference distribution in the following directions: Δ (index) = Var _ UT (low temperature resistant group) -Var _ T (low temperature non-resistant group), filtering out sites with absolute value of Δ index less than 0.6, finally obtaining 79 SNP markers with difference between groups, and then verifying the markers.
Second, verification of low temperature resistance related molecular marker
Verifying the candidate molecular markers related to the low-temperature resistance in a low-temperature tolerant group and a low-temperature intolerant group by adopting a PCR product sequencing method:
(1) firstly, designing primers on flanking sequences of marker sites, wherein at least one primer is more than 70 bp away from the marker sites;
(2) carrying out PCR amplification by using the designed primers and respectively using mixed DNA materials of a low-temperature tolerant group T and a low-temperature intolerant group UT as templates, sequencing the PCR products which are successfully amplified, and selecting the primer which is far away from the marking site by using a sequencing primer;
(3) analyzing the sequencing peak maps by using Bio-edit software, selecting markers with larger difference between the sequencing peak maps of the low-temperature tolerant population and the low-temperature intolerant population at corresponding positions, and continuing to perform PCR amplification and sequencing analysis on the individual DNA templates;
(4) the genotype of each individual was counted from the sequencing results and analyzed by SPSS software whether the markers correlated with the low temperature resistance profile.
The specific operation steps are as follows:
1. DNA mixing pool construction
Mixing 1 mu g of DNA of each individual, preparing DNA mixing pools of a low-temperature resistant group and a low-temperature intolerant group, diluting the DNA mixing pools to 200 ng/mu L of final concentration, and containing 20 individuals in each mixing pool for subsequent experiments.
2. Primer design
SNP mutation sites are screened by comparing the genome sequencing and bioinformatics analysis methods in the two populations, and then low temperature resistant molecular markers are screened. Primers are designed at two ends of the low temperature resistant candidate SNP locus by using Primer Premier 5.0 software.
The design criteria for the primers were:
(1) the annealing temperature of the primer is 55-60 ℃;
(2) the formation of stable dimer and hairpin structures between the primers and the primers is avoided as much as possible;
(3) the fragment size is greater than 200 bp.
The designed primer information is shown in Table 3:
TABLE 3 primer information
3. Mixed template PCR amplification and electrophoresis
Mixed gDNA is used as a template, enzyme of Kangji century company is used for PCR amplification, and the reaction program is set as follows: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 30s, and repeating for 32 cycles; the circulation extends for 72 ℃ for 7 min.
The PCR system was as follows:
| 2×Matermix | 10 μL |
| forward primer | 0.5 μL |
| Reverse primer | 0.5 μL |
| gDNA | 2 μL |
| ddH2O | 7 μL |
| Total volume | 20 μL |
The obtained PCR amplification product is firstly subjected to agarose gel electrophoresis, and the rest product is subjected to first-generation sequencing. As shown in FIG. 1, the sequencing result showed that the Japanese prawn was a low-temperature-resistant individual when the peak pattern of the sequencing result showed a CT mutation at the 501 th base, and that the Japanese prawn was a low-temperature-intolerant individual when the peak pattern of the sequencing result showed no CT mutation at the 501 th base.
Then, the genotype of each individual is counted according to the sequencing result, and the genotype information is introduced into SPSS software for calculationPValue, selectP<0.01Marking, and finally selecting 1 SNP marker with the number of C6101.
As shown in table 4, the low temperature tolerance genotype of C6101 was found to be CT genotype. The nucleotide sequence of the molecular marker C6101 is shown in SEQ ID No.1, the 501 th base is T, wherein the amplification primers for developing the molecular marker are C6101-F and C6101-R shown in Table 3.
TABLE 4 statistics of SNP sites of C6101 in different groups
| Name of label | Type of mutation | SNP intolerance group at Low temperature | SNP in Low temperature resistant group | PValue of |
| C6101 | CT mutation | C:14/19；T:5/19 | C:5/19；T:14/19 | 0.003 |
4. Low temperature tolerant and non-tolerant individuals PCR amplification and electrophoresis
Extracting tissue DNA of 40 Penaeus japonicus individuals as a template for PCR amplification, wherein PCR primers are as follows:
C6101-F：GGGCTTCAGATGTTACCAGG；
C6101-R：GCTCGGAACAGAATTTTAGAGA。
the PCR system and amplification conditions were the same as described above. After amplification, the obtained individual template PCR product was subjected to 1% agarose gel electrophoresis, and the electrophoresis results are shown in FIG. 2. The remaining PCR products were then sequenced, the sequencing result is shown in FIG. 3, and the base of the low temperature tolerant individual Penaeus japonicus was mutated to T.
In conclusion, the molecular marker C6101 obtained by the invention can accurately identify individuals with low-temperature tolerance characters in the penaeus japonicus, and the specific application steps are as follows: extracting DNA in a penaeus japonicus sample, and carrying out PCR amplification reaction by using the extracted DNA as a template and using amplification primers C6101-F and C6101-R of a molecular marker C6101; sequencing the PCR amplification product, and if the genotype of C6101 is CT and the 501 th base of the molecular marker is T, the Penaeus japonicus has low temperature resistance; if the 501 th base is C, the Penaeus japonicus does not have low temperature resistance.
In addition, the molecular marker C6101 can also be used for identifying the low temperature resistant parent and the offspring of the penaeus japonicus, analyzing the genetic diversity and the germplasm identification of the penaeus japonicus and constructing the genetic map of the penaeus japonicus, and is beneficial to the breeding development of the penaeus japonicus.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> research institute for aquatic products in yellow sea of China institute for aquatic science
<120> low-temperature-resistant molecular marker C6101 of penaeus japonicus and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1001
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aggagttggg atggggaggg ggagggggaa ggggagaagg aaatggaaga ggaggaggag 60
gaggaggagg aggaggagga ggcggaggag gaggaggagg aggaggagga ggaggaggag 120
gaggagaaga agtagaagag gaagaggggg aggagaatga agacatacaa aagaataggt 180
aataaaagat ggcaattaaa ataagagtaa caataatgat tttaaaaata ataattcaaa 240
gaatccattt ctctctccca cgtcttcctc tctccctatt tatctttctg tcacgagggg 300
gagtgggggg aggggcgagg gaggcccgga ctcacgtagc cgcccagcga gacagcccgt 360
gggaagaagt ctggtccagc ctgggttcct aagaagggct tcagatgtta ccaggcgggg 420
gcgaagacga accccaaggt gctctgaggg gaaggggggt caggagaaaa ggtctccggc 480
cgggaaaggt cacctccgtt tgatgatgcg tttgccatta tttttcatgt gttttcaatg 540
catgacaggt tgagagaatc gcgctgacct ttccggggac ggagacgaga aatagatgag 600
aaaaagaaaa tgaatattaa atttttctct tctttttctc taaaattctg ttccgagcta 660
tccatttcct agtttttaat agctcgattt atacgagctc gctgtcgcta tcgtattgat 720
attcgtttta ctcctctccg tatgagcatt tcatcaagac ttgcataatc gttaatcagc 780
atcattatcc tccattatca tcgtcatcat catcagctca tccctttatc atacctcaaa 840
accctcacaa aaaggacggt cagaaaaatg agaatctgcc ttatcactcc tagggggggg 900
gagagggaag aggtaagaaa gaaagggaga ggaggggaag gcgggggaaa cagacaaaga 960
cattgcaatt accttcgatt acgctcgtct acccccaccc c 1001
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gggcttcaga tgttaccagg 20
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gctcggaaca gaattttaga ga 22
Claims (10)
1. A low-temperature-resistant molecular marker C6101 of Japanese prawn is characterized in that the nucleotide sequence of the molecular marker C6101 is shown in SEQ ID No. 1.
2. The cryogenically-resistant molecular marker C6101 of Penaeus japonicus according to claim 1, wherein the 501 st base in the molecular marker C6101 is T.
3. The Penaeus japonicus low temperature resistant molecular marker C6101 according to claim 1, wherein the low temperature resistant genotype of the molecular marker C6101 is CT genotype.
4. The primer pair for amplifying the molecular marker C6101 of any one of the claims 1 to 3, wherein the nucleotide sequence of the primer pair is shown as SEQ ID No.2 and SEQ ID No. 3.
5. The application of the molecular marker C6101 of claim 1 or the primer pair of claim 4 in screening low-temperature tolerant Penaeus japonicus breed.
6. The use according to claim 5, wherein the molecular marker C6101 is applied by the steps of:
(1) synthesizing amplification primers C6101-F and C6101-R with the nucleotide sequences shown as SEQ ID No.2 and SEQ ID No. 3;
(2) extracting DNA of the penaeus japonicus;
(3) performing PCR amplification by using the extracted DNA as a template and using amplification primers C6101-F and C6101-R;
(4) and sequencing the amplified product, wherein the genotype of the molecular marker in the sequencing result is the CT genotype, and the penaeus japonicus is a low-temperature tolerant variety.
7. The use according to claim 6, wherein the 501 st base of the molecular marker C6101 in the sequencing result in the step (4) is T, so that the penaeus japonicus is a low-temperature tolerant variety; if the 501 th base of the molecular marker C6101 is C, the Penaeus japonicus is a low-temperature intolerant variety.
8. The use of claim 6, wherein the PCR amplification conditions are: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 30s, and repeating for 32 cycles; the circulation extends for 72 ℃ for 7 min.
9. The use according to claim 6, wherein the extracted source of DNA from Penaeus japonicus comprises the muscle tissue of Penaeus japonicus, whole individuals in the juvenile stage.
10. The use of the molecular marker C6101 of claim 1 in the genetic diversity analysis, germplasm identification and genetic map construction of Japanese prawn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111060286.9A CN113584188A (en) | 2021-09-10 | 2021-09-10 | Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111060286.9A CN113584188A (en) | 2021-09-10 | 2021-09-10 | Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113584188A true CN113584188A (en) | 2021-11-02 |
Family
ID=78241836
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111060286.9A Pending CN113584188A (en) | 2021-09-10 | 2021-09-10 | Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113584188A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116732199A (en) * | 2023-08-07 | 2023-09-12 | 中国水产科学研究院黄海水产研究所 | Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105002267A (en) * | 2015-06-15 | 2015-10-28 | 浙江省海洋开发研究院 | Penaeus japonicus molecule marking method and application |
| CN105567865A (en) * | 2016-03-23 | 2016-05-11 | 厦门大学 | SNP (single-nucleotide polymorphism) marker related to Marsupenaeus japonicus heat resistance and detection method thereof |
-
2021
- 2021-09-10 CN CN202111060286.9A patent/CN113584188A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105002267A (en) * | 2015-06-15 | 2015-10-28 | 浙江省海洋开发研究院 | Penaeus japonicus molecule marking method and application |
| CN105567865A (en) * | 2016-03-23 | 2016-05-11 | 厦门大学 | SNP (single-nucleotide polymorphism) marker related to Marsupenaeus japonicus heat resistance and detection method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 李凤晨等: "日本对虾耐低温试验", 《水利渔业》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116732199A (en) * | 2023-08-07 | 2023-09-12 | 中国水产科学研究院黄海水产研究所 | Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105506162B (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof | |
| CN113913533A (en) | SNP molecular marker related to grass carp traits and application thereof | |
| CN111910008A (en) | Molecular marker related to chicken growth and development and application thereof | |
| CN114836543A (en) | Female molecular marker primer of channa maculata, application thereof and method for identifying sex of channa maculata | |
| US20220411882A1 (en) | Snp molecular marker for weight gain trait selection and genetic sex identification of ictalurus punctatus as well as screening method and application of snp molecular marker | |
| CN113789394B (en) | Molecular marker C13 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN115896298A (en) | Siniperca chuatsi X chromosome molecular marker primer and application thereof | |
| CN113736891B (en) | Molecular marker G2997 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN113604587B (en) | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN113584188A (en) | Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application | |
| CN110564867B (en) | SNP molecular marker of Qinchuan cattle CFL1 gene and detection method thereof | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN110724748B (en) | Molecular marker C3 of portunus trituberculatus parahaemolyticus and application thereof | |
| CN111996261A (en) | Macrobrachium rosenbergii sex molecular marker primer and application thereof | |
| CN109439771B (en) | Method for identifying family of hybrid porgy by using microsatellite marker | |
| CN113801945B (en) | Molecular marker C768 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN113846172B (en) | SNP molecular marker related to nitrite resistant character of litopenaeus vannamei and application thereof | |
| CN113621714B (en) | Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof | |
| CN110747282B (en) | Low-salt-resistant molecular marker C22 of portunus trituberculatus and application thereof | |
| CN114875157A (en) | SNP (Single nucleotide polymorphism) marker related to individual growth traits of pelteobagrus fulvidraco and application | |
| CN114657263A (en) | Molecular marker for Cyprinus carpiod No. 2 identification, identification method and application | |
| CN110747281B (en) | Low-salt-resistant molecular marker C62 of portunus trituberculatus and application thereof | |
| CN110724749B (en) | Molecular marker C104 of portunus trituberculatus resistant vibrio parahaemolyticus and application thereof | |
| CN109136392B (en) | Genetic diversity identification method and reagent for multi-generation meiotic gynogenesis megalobrama amblycephala | |
| CN113584187A (en) | Molecular marker A2629 for screening penaeus japonicus with low temperature resistance, amplification primer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20211102 |