CN116732199A - Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof - Google Patents
Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof Download PDFInfo
- Publication number
- CN116732199A CN116732199A CN202310980383.2A CN202310980383A CN116732199A CN 116732199 A CN116732199 A CN 116732199A CN 202310980383 A CN202310980383 A CN 202310980383A CN 116732199 A CN116732199 A CN 116732199A
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- penaeus japonicus
- low
- penaeus
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001124325 Marsupenaeus japonicus Species 0.000 title claims abstract description 62
- 239000003147 molecular marker Substances 0.000 title claims abstract description 54
- 239000002773 nucleotide Substances 0.000 claims abstract description 10
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 10
- 239000003550 marker Substances 0.000 claims abstract description 8
- 108091028043 Nucleic acid sequence Proteins 0.000 claims abstract description 3
- 238000012163 sequencing technique Methods 0.000 claims description 31
- 108020004414 DNA Proteins 0.000 claims description 22
- 238000012408 PCR amplification Methods 0.000 claims description 12
- 230000035772 mutation Effects 0.000 claims description 11
- 241000238557 Decapoda Species 0.000 claims description 8
- 230000003321 amplification Effects 0.000 claims description 8
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 8
- 238000012216 screening Methods 0.000 claims description 8
- 238000004458 analytical method Methods 0.000 claims description 6
- 238000010276 construction Methods 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 4
- 230000002068 genetic effect Effects 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 238000009395 breeding Methods 0.000 abstract description 17
- 230000001488 breeding effect Effects 0.000 abstract description 15
- 238000000034 method Methods 0.000 abstract description 8
- 238000011161 development Methods 0.000 abstract description 5
- 230000009286 beneficial effect Effects 0.000 abstract description 4
- 238000003752 polymerase chain reaction Methods 0.000 description 14
- 239000000047 product Substances 0.000 description 13
- 238000001179 sorption measurement Methods 0.000 description 7
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 7
- 239000000243 solution Substances 0.000 description 6
- 241000238553 Litopenaeus vannamei Species 0.000 description 5
- 238000001514 detection method Methods 0.000 description 5
- 239000007788 liquid Substances 0.000 description 5
- 239000002699 waste material Substances 0.000 description 5
- 238000001962 electrophoresis Methods 0.000 description 4
- 238000001914 filtration Methods 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 238000000246 agarose gel electrophoresis Methods 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 238000002156 mixing Methods 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 241000927735 Penaeus Species 0.000 description 2
- 238000007792 addition Methods 0.000 description 2
- 238000003766 bioinformatics method Methods 0.000 description 2
- 239000000872 buffer Substances 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 238000012268 genome sequencing Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 241000237519 Bivalvia Species 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 108091092584 GDNA Proteins 0.000 description 1
- 241001454399 Metapenaeus Species 0.000 description 1
- 230000001133 acceleration Effects 0.000 description 1
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 235000020639 clam Nutrition 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 239000000539 dimer Substances 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 229910052760 oxygen Inorganic materials 0.000 description 1
- 239000001301 oxygen Substances 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 239000011541 reaction mixture Substances 0.000 description 1
- 239000013535 sea water Substances 0.000 description 1
- 235000014102 seafood Nutrition 0.000 description 1
- 238000009394 selective breeding Methods 0.000 description 1
- 238000010008 shearing Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a molecular marker T3368 for identifying low temperature resistance of Penaeus japonicus and application thereof. The nucleotide sequence of the molecular marker T3368 is shown as SEQ ID No.1, and the nucleotide sequences of the primer pair for detecting the molecular marker T3368 are shown as SEQ ID No.2 and SEQ ID No. 3. The molecular marker T3368 is SNP marker, and the low-temperature tolerance genotype is TC genotype. The molecular marker T3368 provided by the invention can be free from the limitation of the growth stage of the penaeus japonicus, obviously quickens the breeding process of the penaeus japonicus and rapidly breeds a new penaeus japonicus variety with excellent low-temperature resistance, and the use of the molecular marker T3368 for detecting the low-temperature resistance of the penaeus japonicus is accurate and reliable and simple in operation, is beneficial to healthy breeding and development of the penaeus japonicus and has wide application prospect.
Description
Technical Field
The invention belongs to the field of molecular marker assisted breeding of aquatic animals, and particularly relates to a molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof.
Background
Penaeus japonicusMarsupenaeus japonicus) The penaeus vannamei, the penaeus species and the metapenaeus species are distributed in the sea areas of India-western Pacific tropical zone, african east coast, malaysia, japan, korean, southeast coastal China and the like, are one of main penaeus vannamei species, and the penaeus vannamei species grow rapidly, resist dry dew, have bright color and high economic value, are welcomed by aquatic product markets and breeders, are bred in various provinces from south China to north coastal China, and form a certain scale. The annual output of the Penaeus vannamei Boone in 2022 exceeds 4.62 ten thousand tons, the annual demand of offspring exceeds 200 hundred million, and the fine breed breeding has important significance for the Penaeus vannamei Boone breeding industry. The low temperature resistance is an important stress resistance property of the Penaeus japonicus. On the one hand, as the Penaeus japonicus has higher market demand, the Penaeus japonicus is mainly cultivated in northern China water areas, wherein the northern water areas comprise northern provinces such as Shandong, hebei, jiangsu and the like, and the low temperature resistance is an important stress resistance property pursued by the Penaeus japonicus cultivation industry in northern China; on the other hand, in the spring festival of China, the market price of the fresh Penaeus japonicus is more than 3 times of that of the ordinary season, the market time of the Penaeus japonicus in northern land is often adventure to be dragged to winter, and the large-scale death of the cultivated Penaeus japonicus is often caused by the sudden drop of the water temperature due to the cold tide in winter, so that the breeding of low-temperature-resistant varieties is also an urgent requirement of the Penaeus japonicus cultivation industry.
Traditional breeding methods rely on phenotypic selection and have the disadvantages of long period, instability and the like. Molecular breeding, namely molecular marker assisted selective breeding, refers to a technology for selecting breeding materials by using DNA molecular markers, and the molecular breeding method carries out backup parent selection according to effective molecular markers, so that the economic character of offspring can be improved more rapidly. SNP (Single Nucleotide Polymorphism) refers to a polymorphism of a single nucleotide on a genome, and is the most widely used and latest molecular marker at present. At present, little research is done on the development of low temperature resistant molecular markers for Penaeus japonicus, and there is a lack of markers in industry that can be applied to molecular marker assisted breeding. Therefore, the development of the low-temperature-resistant shape related molecular marker has important significance for healthy breeding and acceleration of breeding process of the Penaeus japonicus.
Disclosure of Invention
The invention provides a molecular marker T3368 for identifying low temperature resistance of Penaeus japonicus and application thereof. The SNP mutation sites are screened by a genome sequencing and bioinformatics analysis method for low-temperature resistant groups and intolerant low-temperature groups, and a Penaeus japonicus molecular marker T3368 is obtained by further identification and screening; the molecular marker can be used for rapidly identifying the low-temperature resistance of the penaeus japonicus, has high identification efficiency and accuracy, can be used for screening low-temperature resistant individuals of the penaeus japonicus, and is beneficial to the cultivation of the low-temperature resistance of the penaeus japonicus and the development of the breeding industry.
In order to achieve the aim of the invention, the invention is realized by adopting the following technical scheme:
the invention provides a molecular marker T3368 for identifying low temperature resistance of Penaeus japonicus, and the nucleotide sequence of the molecular marker is shown as SEQ ID No. 1.
Further, the 501 th base in the molecular marker T3368 is C.
Further, the molecular marker T3368 is a SNP marker.
Further, the low-temperature tolerance genotype of the molecular marker T3368 is TC genotype.
The invention also provides a group of primer pairs, which are primer pairs for detecting the molecular marker T3368; the nucleotide sequence of the forward primer in the primer pair is shown as SEQ ID No.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 3.
The invention also provides application of the molecular marker in identifying or screening low-temperature resistant varieties of Penaeus japonicus, which is the molecular marker T3368.
Further, the specific steps of identifying or screening the low-temperature resistant varieties of the Penaeus japonicus are as follows:
(1) Extracting genomic DNA of an individual Penaeus japonicus;
(2) Performing PCR amplification on the genome DNA of the step (1) by using primer pairs T3368-F and T3368-R with nucleotide sequences shown as SEQ ID No.2 and SEQ ID No.3 to obtain an amplification product;
(3) Sequencing the amplified product; if TC genotype mutation occurs in the sequencing result, the Penaeus japonicus individual is a low-temperature tolerant variety.
Further, the sequencing result of the amplified product in the step (3) shows that: the 501 th base of the molecular marker T3368 is C, so that the Penaeus japonicus is a low-temperature tolerant variety; if the 501 st base of the molecular marker T3368 is T, the Penaeus japonicus is a low-temperature intolerant variety.
Further, the PCR amplification conditions are as follows: pre-denaturation at 94℃for 5min; denaturation 94 ℃,30s, annealing 55 ℃,30s, extension 72 ℃,30s, repeating 32 cycles; the circulation is extended to 72 ℃ for 7min.
The invention also provides application of the molecular marker in genetic diversity analysis, germplasm identification and genetic map construction of the Japanese prawns, which is the molecular marker T3368.
Compared with the prior art, the invention has the following advantages and beneficial effects:
1. the molecular marker T3368 of the Penaeus japonicus, provided by the invention, can be used for breeding early-stage Penaeus japonicus seedlings and parents of the Penaeus japonicus without being limited by the growth stage of the Penaeus japonicus, so that the breeding process of the Penaeus japonicus is obviously accelerated, and a new Penaeus japonicus variety with excellent low-temperature tolerance properties is quickly bred.
2. The molecular marker T3368 provided by the invention is used for detecting the low-temperature-resistant characters of the penaeus japonicus, the method is accurate and reliable, the operation is simple, the characters meeting the requirements can be effectively and rapidly screened out, the low-temperature-resistant penaeus japonicus variety can be bred in a short time and at low cost in an assisted early stage, the quantity of the penaeus japonicus with good quality is increased, the culture rate and the culture period of the penaeus japonicus are improved, the output of the penaeus japonicus is further improved, and the healthy reproduction of the penaeus japonicus is promoted, so that the molecular marker T3368 has a broad application prospect.
Drawings
FIG. 1 is a diagram showing the sequencing peaks of the mixed template PCR product of the present invention.
FIG. 2 is an electrophoretogram of PCR products from individual low temperature intolerant and low temperature tolerant individuals according to the present invention.
FIG. 3 is a graph showing the peak difference between the sequencing results of two groups of corresponding positions of the low temperature tolerant group and the low temperature intolerant group in the invention.
Detailed Description
The technical scheme of the invention is further described in detail below with reference to specific embodiments.
The Penaeus japonicus used in the invention is all from experimental bases of Qingdao Ruiz seafood Limited. 300 penaeus japonicus with the weight of 10+/-3 g are put into 4 culture ponds (500 cm multiplied by 300 cm multiplied by 150 cm) for temporary culture for 7 days, the water temperature is kept at 28+/-1 ℃ during temporary culture, water is added to 20 cm, the pH is 8.2+/-0.5, oxygen is continuously supplied, fresh sea water is replaced every morning at 8 hours, fresh clams are fed at 5 pm, and the feeding amount is about 10% of the weight of the penaeus japonicus. And after 7d, selecting the Japanese prawns with good vitality and complete body surface for subsequent experiments.
The low temperature tolerance experiment is carried out on 300 Japanese prawns under the condition of 10+/-0.5 as stress, the tolerance time of individuals is counted, the first dead 20 prawns are taken as a low temperature sensitive group (UT), and the last still living 20 prawns are taken as a low temperature tolerance group (T). The extraction method of the low-temperature sensitive group and the low-temperature tolerant group prawn genome DNA is carried out according to a TIANGEN marine animal tissue genome extraction kit (TIANGEN Biochemical technology Co., ltd.).
Example 1
1. Screening of low temperature resistant related candidate molecular markers
1. Sequencing data filtration and alignment
Extracting genome DNA of Japanese prawn, and 20 individuals of low temperature tolerant group and intolerant group. Extracting the genomic DNA of the Penaeus japonicus by using a centrifugal adsorption column capable of specifically binding to the DNA and a unique buffer solution system. First, about 30. 30 mg tissue samples were placed in a 1.5 mL sterile enzyme centrifuge tube, 200. Mu.L of GA buffer and 20. Mu.L of protease K solution were added, vortexed, and incubated at 56℃until the tissue was completely lysed. Then 200 mu L GB is added, fully and reversely mixed, and the mixture is placed for 10min at 70 ℃, the solution becomes clear, and the inner wall water drops are removed by shearing and centrifugation. Adding 200 μl of absolute ethanol, mixing thoroughly upside down, centrifuging briefly, adding the obtained solution and flocculent precipitate into an adsorption column CB3 (the adsorption column is placed in a collecting tube), centrifuging at 12000 rpm for 30s, pouring out waste liquid, and placing the adsorption column CB3 back into the collecting tube. 500. Mu.L of buffer GD was added to the adsorption column CB3, centrifuged at 12000 rpm for 30s, and the waste liquid was poured off to place the adsorption column CB3 into a collection tube. 600. Mu.L of the rinse PW was added to the column CB3, centrifuged at 12000 rpm for 30s, the waste liquid was poured off, and the column CB3 was placed in a collection tube. The waste liquid was discarded (repeated once), 700. Mu.L of the rinse PW was added thereto, and the mixture was centrifuged at 12000 rpm for 30 seconds, and the waste liquid was discarded. 12000 The reaction mixture was air-cooled at rpm for 2min to completely remove the residual reagent. The adsorption column CB3 is placed in a clean centrifuge tube, 40 mu L of water is added in the center of the column, the column is kept stand at room temperature for 15min, and the column is centrifuged at 12000 rpm for 2min to elute DNA. The concentration and purity of the DNA were measured using Nanodrop.
The DNA samples which are qualified in inspection comprise a low-temperature tolerant group and a low-temperature intolerant group, the single DNA samples are randomly broken into fragments with the length of 350 bp through a covarias breaker, truSeq Library Construction Kit is adopted for library construction, and the DNA fragments are subjected to the steps of end repair, ployA tail addition, sequencing joint addition, purification, PCR amplification and the like to complete the whole library preparation. The constructed library was sequenced through Illumina HiSeq PE 150.
And (5) strictly filtering the sequencing data to obtain high-quality clean data. Statistics (Table 1-T stands for low temperature resistance, UT stands for non-low temperature resistance) were performed on 40 sample output data, including sequencing filtered valid data, comparing fragment numbers, etc. The total sequencing data amount was 611.10 Gb, the high quality clean data amount was 605.67 Gb, and the sequencing data results are shown in table 1.
Table 1 summary of sequencing data quality
The filtered valid data were aligned by means of Burrows-Wheeler alignment tool (BWA) software and the alignment was removed from duplicates by means of SAMTOOLS. The comparison result shows that the comparison rate of all samples is above 85%, and the average sequencing depth is above 25 x, so that the method can be used for subsequent analysis.
2. Tag detection and annotation
SNP detection was performed using SAMTOOLS software. Detecting polymorphic sites in the population by using a Bayesian model, and obtaining high-quality SNPs by the following filtering and screening:
1) Q20 quality control;
2) SNP loci are at least 5 bp apart from each other;
3) The number of supported SNPs (coverage depth) was between [ 1/3, 5] times the average depth.
The SNP detection results were then annotated with ANNOVAR. The results of the detection are shown in Table 2, and the SNP results are statistics obtained by filtering the SNP with a Depth (DP) of more than 4, a deletion rate of 0.2 and a minimum allele frequency of 0.05.
TABLE 2 SNP detection results statistics
3. SNP differential analysis
The analysis statistics were performed on SNP-index for each site of the low temperature tolerant group and the low temperature intolerant group as follows:
Var_T = number of individuals with variation (heterozygous mutation 0/1, homozygous mutation 1/1)/resistant group;
Var_UT=number of individuals with variation (heterozygous mutation 0/1, homozygous mutation 1/1)/non-tolerant group.
Meanwhile, the SNP frequency difference distribution is calculated in the following direction: delta (index) =var_ut (low temperature resistant group) -var_t (low temperature intolerant group), the sites with delta index absolute value less than 0.6 were filtered out, and finally 79 SNPs with differences between groups were obtained, and these markers were verified.
2. Low temperature resistant related molecular marker validation
The PCR product sequencing method is adopted to verify the low temperature resistance related candidate molecular markers in low temperature resistant populations and intolerant populations:
(1) Firstly, designing primers on flanking sequences of a marker locus, wherein at least one primer is more than 70 and bp away from the marker locus;
(2) Carrying out PCR (polymerase chain reaction) amplification by using designed primers and taking mixed DNA materials of low-temperature tolerant groups and intolerant groups as templates, sequencing successfully amplified PCR products, and selecting primers far away from a marker locus by using the sequencing primers;
(3) Analyzing the sequencing peak diagram by using Bio-kit software, selecting marks with large differences between the sequencing peak diagrams of the low-temperature tolerant population and the intolerant population at corresponding positions, and continuing to perform PCR amplification and sequencing analysis of the individual DNA templates;
(4) Based on the sequencing results, the genotypes of each individual were counted and analyzed by SPSS software for the correlation of markers with low temperature resistance.
The specific operation steps are as follows:
1. DNA mixing pool construction
1. Mu.g of DNA was mixed for each individual, and low temperature tolerant and intolerant DNA mixing pools were prepared, each pool containing 20 individuals, each diluted to a final concentration of 200 ng/. Mu.L, for subsequent experiments.
2. Primer design
SNP mutation sites are screened by comparing genome sequencing and bioinformatics analysis methods in the two populations, and then low temperature resistant molecular markers are screened. Primers were designed at both ends of the low temperature resistant candidate SNP site using Primer Premier 5.0 software.
The design criteria of the primer are as follows:
(1) Primer annealing temperature is 55-60 ℃;
(2) Avoiding the formation of stable dimer and hairpin structure between the primers as much as possible;
(3) Fragment sizes were greater than 200bp.
The information on the primers used in this example is shown in Table 3:
TABLE 3 primer information
3. Mixed template PCR amplification and electrophoresis
PCR amplification was performed using the mixed gDNA as a template and the enzyme from Kangji corporation, and the reaction procedure was set as follows: pre-denaturation at 94℃for 5min; denaturation 94 ℃,30s, annealing 55 ℃,30s, extension 72 ℃,30s, repeating 32 cycles; the circulation is extended to 72 ℃ for 7min. The PCR system is as follows:
the PCR amplification product thus obtained was subjected to agarose gel electrophoresis. Sequencing the rest products for the first generation; if the sequencing result peak pattern showed TC mutation at 501 bp, the penaeus japonicus was a low temperature resistant individual, and if the sequencing peak pattern showed no TC mutation at 501 bp, the penaeus japonicus was not a low temperature resistant individual (fig. 1).
Counting the genotype of each individual according to the sequencing result, importing the genotype information into SPSS software, and calculatingPValue, pick outP<0.01The marker, finally 1 SNP marker was selected, numbered T3368.
The sequencing result statistical result after PCR amplification is carried out on the primers with obvious corresponding position difference of the single template of the screened low-temperature tolerant individual and the single template of the low-temperature intolerant individual. From the table 4, it can be seen that the low temperature tolerance genotype of T3368 is TC genotype. The nucleotide sequence of the molecular marker T3368 is shown as SEQ ID No.1, and the 501 th base is C.
TABLE 4 statistical cases of SNP loci in different groups
4. PCR amplification and electrophoresis of low temperature tolerant individuals and intolerant individuals
Extracting tissue DNA of 40 Penaeus japonicus individuals as a template for PCR, wherein PCR primers are as follows:
T3368-F: TGCCAGAAGAAGTGAGAACCA；
T3368-R: TGACCCATGACTTTCGGTG。
the PCR system and amplification conditions were the same as described above. After amplification, the obtained individual template PCR products were subjected to 1% agarose gel electrophoresis, and the electrophoresis results are shown in FIG. 2. The remaining PCR products were then sequenced and the sequencing results are shown in FIG. 3.
Research results show that the molecular marker T3368 obtained by the invention can accurately identify individuals with low temperature resistance in Penaeus japonicus, and the application steps can be summarized as follows: extracting genome DNA in a Penaeus japonicus sample, and carrying out PCR (polymerase chain reaction) amplification reaction by using the extracted genome DNA as a template and using molecular marked amplification primers T3368-F and T3368-R; and (3) agarose gel electrophoresis and sequencing are carried out on the PCR amplification product, and if the sequencing result shows that the molecular marker T3368 has mutation at the 501 th bp th site, the Penaeus japonicus is low-temperature resistant. In addition, the molecular marker T3368 can also be used for identifying low-temperature resistant parents and offspring of the penaeus japonicus, and is beneficial to the breeding development of the penaeus japonicus.
The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Claims (10)
1. The molecular marker T3368 for identifying the low temperature resistance of the penaeus japonicus is characterized in that the nucleotide sequence of the molecular marker T3368 is shown as SEQ ID No. 1.
2. The molecular marker T3368 according to claim 1, wherein the 501 th base in the molecular marker T3368 is C.
3. The molecular marker T3368 according to claim 1, wherein the molecular marker T3368 is a SNP marker.
4. The molecular marker T3368 according to claim 1, wherein the low-temperature tolerance genotype of the molecular marker T3368 is TC genotype.
5. A set of primer pairs, wherein the primer pairs are primer pairs for detecting the molecular marker T3368 according to claim 1; the nucleotide sequence of the forward primer in the primer pair is shown as SEQ ID No.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 3.
6. The application of a molecular marker in identifying or screening low-temperature resistant varieties of penaeus japonicus, which is characterized in that the molecular marker is the molecular marker T3368 in claim 1.
7. The use according to claim 6, wherein the specific steps of identifying or screening the low temperature tolerant varieties of penaeus japonicus are:
(1) Extracting genomic DNA of an individual Penaeus japonicus;
(2) Performing PCR amplification on the genome DNA of the step (1) by using primer pairs T3368-F and T3368-R with nucleotide sequences shown as SEQ ID No.2 and SEQ ID No.3 to obtain an amplification product;
(3) Sequencing the amplified product; if TC genotype mutation occurs in the sequencing result, the Penaeus japonicus individual is a low-temperature tolerant variety.
8. The use of claim 7, wherein the sequencing result of the amplification product in step (3) shows that: the 501 th base of the molecular marker T3368 is C, so that the Penaeus japonicus is a low-temperature tolerant variety; if the 501 st base of the molecular marker T3368 is T, the Penaeus japonicus is a low-temperature intolerant variety.
9. The use according to claim 7, wherein the conditions of the PCR amplification are: pre-denaturation at 94℃for 5min; denaturation 94 ℃,30s, annealing 55 ℃,30s, extension 72 ℃,30s, repeating 32 cycles; the circulation is extended to 72 ℃ for 7min.
10. The application of the molecular marker in the genetic diversity analysis, germplasm identification and genetic map construction of the Japanese prawns is characterized in that the molecular marker is the molecular marker T3368 of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310980383.2A CN116732199A (en) | 2023-08-07 | 2023-08-07 | Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310980383.2A CN116732199A (en) | 2023-08-07 | 2023-08-07 | Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116732199A true CN116732199A (en) | 2023-09-12 |
Family
ID=87906246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310980383.2A Pending CN116732199A (en) | 2023-08-07 | 2023-08-07 | Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116732199A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113584188A (en) * | 2021-09-10 | 2021-11-02 | 中国水产科学研究院黄海水产研究所 | Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application |
| CN113604587A (en) * | 2021-09-10 | 2021-11-05 | 中国水产科学研究院黄海水产研究所 | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof |
-
2023
- 2023-08-07 CN CN202310980383.2A patent/CN116732199A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113584188A (en) * | 2021-09-10 | 2021-11-02 | 中国水产科学研究院黄海水产研究所 | Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application |
| CN113604587A (en) * | 2021-09-10 | 2021-11-05 | 中国水产科学研究院黄海水产研究所 | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105506162B (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof | |
| CN113789394B (en) | Molecular marker C13 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN115896298A (en) | Siniperca chuatsi X chromosome molecular marker primer and application thereof | |
| CN110724748B (en) | Molecular marker C3 of portunus trituberculatus parahaemolyticus and application thereof | |
| CN113604587B (en) | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN113736891B (en) | Molecular marker G2997 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN109439771B (en) | Method for identifying family of hybrid porgy by using microsatellite marker | |
| CN111996261A (en) | Macrobrachium rosenbergii sex molecular marker primer and application thereof | |
| CN113584188A (en) | Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application | |
| CN113584187A (en) | Molecular marker A2629 for screening penaeus japonicus with low temperature resistance, amplification primer and application thereof | |
| CN111254203A (en) | Saline-alkali-resistant molecular marker C325 of portunus trituberculatus and application thereof | |
| CN113801945B (en) | Molecular marker C768 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN113846172B (en) | SNP molecular marker related to nitrite resistant character of litopenaeus vannamei and application thereof | |
| CN110724749B (en) | Molecular marker C104 of portunus trituberculatus resistant vibrio parahaemolyticus and application thereof | |
| CN110747281B (en) | Low-salt-resistant molecular marker C62 of portunus trituberculatus and application thereof | |
| CN110747282B (en) | Low-salt-resistant molecular marker C22 of portunus trituberculatus and application thereof | |
| CN113621714B (en) | Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof | |
| CN116732199A (en) | Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof | |
| CN113981112B (en) | InDel marker C3082 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof | |
| CN113930518B (en) | Molecular marker C49 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN110724750B (en) | Molecular marker C242 of portunus trituberculatus parahaemolyticus and application thereof | |
| CN113981113B (en) | InDel marker C142 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof | |
| CN110791572B (en) | Molecular marker C7 of portunus trituberculatus parahaemolyticus and application thereof | |
| CN117487931B (en) | Sillago sihama hypoxia tolerance character related SNP molecular marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |