KR101540852B1 - Molecular methods for identification of oyster species using species-specific probes, dna chip, and molecular kits - Google Patents

Abstract

The present invention relates to a species-specific probe of oyster, a DNA chip and kit comprising the same, and a method for distinguishing oysters using the same. According to the method of discriminating oyster species using a DNA chip comprising a primer for amplifying oyster mitochondrial cox 1 DNA of the present invention and an oyster-specific probe, it is possible to distinguish oysters having excellent accuracy within a short time.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an oyster-specific probe, a DNA chip, a kit, and a method for identifying an oyster using the same. BACKGROUND OF THE INVENTION 1. Field of the Invention [0001]

The present invention relates to a species-specific probe of oyster, a DNA chip and kit comprising the same, and a method for distinguishing oysters using the same.

Depending on the species, oysters may have different product values as aquatic products or different sensitivities to viral infections. In addition, the necessity of distinction between domestic species and exotic species in the aquatic products quarantine process is gradually increasing. Therefore, it is necessary to develop a molecular species classification technology that can accurately and quickly identify species using oyster-specific gene It is settled.

On the other hand, about eight major species are known among the oysters distributed on the coast of Korea, and the species can be identified only by some highly skilled taxonomists. In addition, it is almost impossible to classify the target species without errors even if only the shape of the shell (shell) in the shell (shell) is removed (in most modes of distribution) It is true.

Therefore, as the scale of oyster farming industry and import and export trade is gradually expanding, it is necessary to identify the species quickly and accurately in the fisheries management and quarantine process. However, the species identification technology developed so far is one of the classical methods It is not possible to distinguish between species because it uses classification method depending only on form, and even if it is a classification expert, there is a problem that it is impossible to be accurate, quick, and large-capacity in identification of oyster species.

Korean Patent Publication No. 10-1151747

SUMMARY OF THE INVENTION The present invention has been made to solve the problems of the prior art as described above, and it is an object of the present invention to provide a method of identifying oyster species which can not be solved by a classification method depending on the existing morphology, By analyzing the gene sequence and applying it to the development of DNA chip technology, it is aimed to secure a technology for quickly and accurately discriminating the species of each of the eight oysters distributed in Korea.

In order to solve the above-mentioned problems, the present invention provides a method for producing an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 16 and the oligonucleotide comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: Wherein the probe is selected from the group consisting of a probe and a probe.

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 . The species is called Crassostrea ariakensis ).

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: . The species is called Crassostrea gigas ).

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide consisting of the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: The species is the Portuguese oyster ( Crassostrea angulata .

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 and SEQ ID NO: 7 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 6 and SEQ ID NO: . The species is a rock oyster ( Crassostrea nippona ).

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9, and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: . The species is also called Crassostrea sikamea ).

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: 11 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: . The species is called Ostrea circumpicta ).

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: 14 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: . Preferably, the species is Ostrea denselamellosa .

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: . The species is called < RTI ID = 0.0 > Saccostrea & kegaki ).

The present invention also includes a probe comprising an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 16 and an oligonucleotide comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 16 The present invention provides a DNA chip for discriminating oyster species.

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip may include a probe selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO:

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 6 and SEQ ID NO: 7, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: 11 and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: 14 and an oligonucleotide consisting of the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: . ≪ / RTI >

In addition, the present invention provides a primer for amplifying the mitochondrial DNA cox1 gene of oysters, which comprises the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18.

In addition, the present invention provides a kit for determining the species of oysters, which comprises a DNA chip of the present invention and a primer of the present invention.

In a preferred embodiment, the kit may further comprise light emitting means.

The present invention also relates to a method for preparing a DNA sample, comprising the steps of: performing PCR using a primer of the present invention in a DNA sample; Hybridizing the result of the PCR with the DNA chip of the present invention; And confirming the pattern of the hybridization.

According to the method of distinguishing oyster species using a DNA chip comprising a primer for amplifying oyster mitochondrial cox 1 DNA of the present invention and an oyster-specific probe, it is possible to rapidly and precisely detect most oysters distributed without a shell Differentiation of species is possible.

1 is a flow chart of a DNA chip development process for identification of oysters.
FIG. 2 is a flow chart for identifying species of oysters using a DNA chip.
Figure 3 shows the location of species specific probes for eight oysters on the DNA chip for identification of the developed oysters. P denotes a reference marker probe, and 1 to 16 indicate the types of probes shown in Table 4 below.
Figure 4 shows the results of PCR using family Ostreidae species-specific primers.
Figure 5 compares the nucleotide sequences of the eight mitochondrial cox1 genes analyzed.
Fig. 6 shows results of species identification using eight DNA chips of oysters.
FIG. 7 is a general work flow chart for developing a DNA chip for identification for discrimination of eight species of oysters.

Hereinafter, the present invention will be described in detail.

Oyster is one of the most economically important fishery foods in the domestic consumption market and export / import market scale of aquaculture industry as well as aquaculture product. However, the oysters are too morphologically mutated in their morphology. Especially, when shell shells surrounding the overgrowth are removed, the species can be discriminated on the basis of molluscs only, It is almost impossible to identify.

The inventors of the present invention have found that, among the oysters that are one of commercially valuable aquaculture products, the present invention can be applied to the eight species listed in the following Table 1 by using the gene sequence of the species-specific mitochondrial gene cox1 region (679 bp) DNA chip technology for standard identification of oyster species was developed to enable discrimination.

Class Family Species name Country name One Bivalvia Ostreidae Crassostrea ariakensis Cave 2 Bivalvia Ostreidae Crassostrea gigas oyster 3 Bivalvia Ostreidae Crassostrea angulata Portugal oyster 4 Bivalvia Ostreidae Crassostrea nippona Rock oyster 5 Bivalvia Ostreidae Crassostrea sikamea I too 6 Bivalvia Ostreidae Ostrea circumpicta Born oyster 7 Bivalvia Ostreidae Ostrea denselamellosa crypt 8 Bivalvia Ostreidae Saccostrea kegaki Barbed oyster

In order to develop the DNA chip for identifying oyster species of the present invention, DNA was extracted from eight oyster tissue cells listed in Table 1 belonging to the oyster to be classified, and PCR was performed on the extracted DNA. PCR products were obtained.

The PCR used a polynucleotide having a nucleotide sequence of SEQ ID NO: 17 (Ost_CO1_F) shown in the following Table 2 or a polynucleotide having a nucleotide sequence complementary thereto as a forward primer and a polynucleotide having a nucleotide sequence of SEQ ID NO: 18 (Ost_CO1_R) Or by performing a polymerase chain reaction (PCR) using a polynucleotide having a nucleotide sequence complementary thereto as a reverse primer, respectively.

Primer Sequence (5'-3 ') Size Primer Location
(C.gigas CO1 gene phase) Ost_CO1_F ATRTCHACWAAYCAYTTRGAYATTGG (SEQ ID NO: 17) 26 bp 1 to 26 Ost_CO1_R CTTATTCTTCCDGGRTTYGGWAT (SEQ ID NO: 18) 23 bp 706 to 728

The primers of SEQ ID NO: 17 and SEQ ID NO: 18 used in the present invention are specific primers for amplifying DNA extracted from animals belonging to oyster. PCR primers (LCO1490 and HCO2198) which have been routinely used conventionally can not produce products of PCR in some species belonging to the oyster of the present invention. Therefore, the inventors of the present invention have developed a PCR primer specific for oyster (family Ostreidae) by obtaining multiple regions of the mitochondrial COX1 gene of the oyster species and performing multiple sequence alignment on them, The mitochondrial DNA < RTI ID = 0.0 > COX1 < / RTI >

The PCR reaction conditions using the primers of SEQ ID NO: 17 and SEQ ID NO: 18 of the present invention are shown in Table 3 below.

Temperature time Cycle Initial denatureation 94 ° C 1 minute 1 time Denaturation 94 ° C 1 minute
35 times Primer annealing 43 ℃ 30 seconds Extension 72 ℃ 2 minutes Final extension 72 ℃ 10 minutes 1 time

In order to design an oyster-specific probe of the present invention, the base sequence of the obtained species of the PCR was aligned using an analysis program, and an in-house program was used to identify the species A specific probe was designed. At this time, a certain range of temperature values was considered to be suitable for the hybridization reaction.

The probes designed as above can be used in the production of a DNA chip for oyster cell discrimination. Hereinafter, a method for producing an oyster-specific DNA chip will be described in detail.

The prepared probe can be integrated on a slide using a commercially available microarray system. Once the DNA chip integrated with the initially designed probe is prepared, the genomic DNA isolated from the oysters is transferred to the 5 'end of the primer set of SEQ ID NO: 17 and SEQ ID NO: 18 which are labeled with a light emitting means (for example, a fluorescent substance) To amplify the target region. The PCR amplification products are subjected to a hybridization reaction on the prepared DNA chip, and hybridization results are analyzed, and among the designed probes, desired probes can be selected in the present invention. Such a process can be repeatedly performed until a probe capable of accurately discriminating the bract species can finally be selected.

The oyster-specific probes finally selected by the above method are shown in Table 4 below.

DNA chip
(Figure 3)
Location on probe name Probe sequence (5'-3 ') Species One C.ari_4 GTTGGCGCTATTTCCATGGTCTATC (SEQ ID NO: 1) Cave
Crassostrea ariakensis 2 C.ari_5 GGTCTATCAAAGTCACATCATTTTT (SEQ ID NO: 2) 3 C.gig_2 CAATTCTAAGCCTTCACCTTGCTGG (SEQ ID NO: 3) oyster
Crassostrea gigas 4 C.gig_5 GCCTTCACCTTGCTGGTATTAGC (SEQ ID NO: 4) 5 C.ang_4 ATGTCTAACATCGTAGAAAACGC (SEQ ID NO: 5) Portugal oyster
Crassostrea angulata 6 C. nip_4 TTAAGCCTACATTTGGCTGGTATTA (SEQ ID NO: 6) Rock oyster
Crassostra nippona 7 C. nip_5 GCTCTGTTTCCTTGATCAATTAAAG (SEQ ID NO: 7) 8 C.sik_4 CAATTTTAAGTTTACACCTAGCTGG (SEQ ID NO: 8) I too
Crassostrea sikamea 9 C.six_5 TTATTGGCGCTGTTTCCCTGATCTA (SEQ ID NO: 9) 10 O.cir_3 CCTCCACTATCAACTTTTTCATATC (SEQ ID NO: 10) Born oyster
Ostrea circumpicta 11 O.cir_4 CGATCAGTGGACGGTCATTTACTGG (SEQ ID NO: 11) 12 O.den_3 CAAATATACGGTCAGTAGACGGCCA (SEQ ID NO: 12) crypt
Ostrea denselamellosa 13 O.den_4 CGGCCATTTATTAGCATTGTTTCCC (SEQ ID NO: 13) 14 O.den_5 GACTTCCTTTTTATTGTTAACTACG (SEQ ID NO: 14) 15 S.keg_1_AS GTCAGGCACTTCTAGTATCAACGGG (SEQ ID NO: 15) Barbed oyster
Saccostrea kegaki 16 S.keg_5 CCATCTGTTAAGGTTGTTCCCATGG (SEQ ID NO: 16)

Accordingly, the present invention provides an oligonucleotide comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 16 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: specific probes of the oyster.

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 . The species is preferably Crassostrea ariakensis .

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: . The species is called Crassostrea gigas ).

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide consisting of the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: The species is the Portuguese oyster ( Crassostrea angulata .

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 and SEQ ID NO: 7 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 6 and SEQ ID NO: . The species is preferably a rock oyster ( Crassostrea nippona ).

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9, and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: . Preferably, the species is Crassostrea sikamea .

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: 11 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: . Preferably, the species is Ostrea circumpicta .

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: 14 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: . Preferably, the species is Ostrea denselamellosa .

In a preferred embodiment, the probe may be selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: . The species is called < RTI ID = 0.0 > Saccostrea & kegaki ).

The final selected probes are brought into contact with the slides in the same manner as described above to finally produce a DNA chip for identifying oyster species.

Accordingly, the present invention provides a probe comprising an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 16, and a probe selected from the group consisting of oligonucleotide comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: The present invention provides a DNA chip for discriminating oyster species.

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip may include a probe selected from the group consisting of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO:

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 6 and SEQ ID NO: 7, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: 11 and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: 14 and an oligonucleotide consisting of the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: . ≪ / RTI >

In a preferred embodiment, the DNA chip comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16, and a probe selected from the group consisting of oligonucleotides comprising the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: . ≪ / RTI >

In addition, the present invention provides a kit for identifying an oyster comprising the DNA chip integrated with the probe designed in the present invention as described above, and an oyster mitochondrial COX1 gene specific primer.

The kit may further include a fluorescent material capable of attaching the light emitting means to the end of the primer. In a preferred embodiment, the fluorescent material may be cyanine-3 (Cy3), but is not limited thereto.

Further, the present invention relates to a method for amplifying a genomic DNA sample, which comprises: PCR using a primer of the present invention in a genomic DNA sample obtained from oysters; Hybridizing the amplification product of the PCR with the DNA chip of the present invention; And confirming the pattern of the hybridization.

This method of oyster classification is a rapid and highly accurate oyster classification method.

Hereinafter, the present invention will be described in more detail based on examples. It should be understood that the embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

[Example]

1. Amplification of the COX1 gene

In this Example, DNA was extracted from any oyster tissue cells belonging to the oyster to be classified, and PCR products were obtained by performing PCR (PCR) on the extracted DNA.

More specifically, the extracted DNA was amplified by PCR using a forward primer having a base sequence of Ost_CO1_F and a reverse primer having a base sequence of Ost_CO1_R, respectively.

The reaction mixture composition of the polymerase chain reaction was 5 μl of 10X Reaction buffer (20 mM Tris-HCl, 100 mM KCl, 2 mM MgCl ₂ pH 8.0), 4 μl of 2.5 mM dNTP, 2 μl of bidirectional primer, 2.5 μl of genomic DNA, (TaKaRa bio INC, EX Taq) were mixed and PCR was carried out under the reaction conditions shown in Table 3 above.

2. Development and production of DNA chip

The sequence of the acquired species is aligned using an analysis program and a species-specific probe is designed in a region with a difference of more than 1 base pair using the In-House program. Temperature values were considered. The amino group and poly T (10mer) were synthesized on the 5 'side of all probes. After the synthesis, the probe was mixed with the same volume of 2X spotting buffer (100Xole / μl, 6X SSC + 3M, transferred to a 384-well plate for integration, and kept at 25 ° C and 60% (SDS) (sodium dodecyl sulfate) was used for the reaction, and the reaction was carried out for 12 hours in the same humidity condition. After washing for 5 minutes in distilled water for 5 minutes and then for 5 minutes in sodium borohydride solution (0.625 g NaBH ₄ + 187.5 mL PBS + 62.5 ethanol), the plate was washed twice with distilled water for 5 minutes, centrifuged at 800 rpm for 5 minutes, So that the chip fabrication was completed.

Next, genomic DNA with a concentration of 10 to 100 ng / μl was PCR-amplified with a primer set labeled with Cyanine-3 (Cy3) fluorescent substance at the 5 'end. The gene amplification conditions were the same as those used in item 1 above. The PCR products labeled with 10 μl of the fluorescent substance were mixed with 90 μl of hybridization buffer (3 × SSC + 0.3% sarcosyl) and 0.5 μl of the position marker without purification, placed on a slide with integrated probes, and incubated at 55 ° C. for 1 hour Hybridization reaction was carried out. After hybridization, the slides are washed in a solution containing 1% SSC and 0.1% sarcosyl for 5 minutes, 1% SSC for 5 minutes, 0.1% SSC for 5 minutes, and then centrifuged at 800 rpm for 5 minutes to dry the slides. Analysis was performed by using a Genepix 4000B scanner (Aon Instruments, USA) to check the signal of the hybridization reaction in the microarray. The fluorescence signals of each probe were calculated using Genepix 4.1 software (Axon Instruments, USA) Probes were selected. Repeated experiments as described above were performed with the selected probe, and the DNA chip was completed by finally selecting the species-specific probe.

3. Species identification method

After securing the genomic DNA, the target species was PCR amplified with a fluorescent primer set for DNA chip hybridization. The gene amplification method was performed in the same manner as in item 1 above.

The PCR products labeled with 10 μl of the fluorescent substance were mixed with the hybridization buffer (3 × SSC + 0.3% sarcosyl) at 90 ° C. and 0.5 μl of the position marker without purification, Lt; / RTI > for 1 hour. After hybridization, the slides were washed 5 min in 1% SSC and 0.1% sarcosyl, 5 min in 1% SSC, 5 min in 0.1% SSC, and then centrifuged at 800 rpm for 5 min to dry the slides. Analysis was performed using a Genepix 4000B scanner (Aon Instruments, USA) to check the signals of the hybridization reactions in the microarray. The fluorescence signals of each probe were calculated using Genepix 4.1 software (Axon Instruments, USA). The signal of each probe is the value obtained by subtracting the background value from the median value, and standardized by the above analysis program.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> MOLECULAR METHODS FOR IDENTIFICATION OF OYSTER SPECIES USING          SPECIES-SPECIFIC PROBES, DNA CHIP, AND MOLECULAR KITS <160> 18 <170> Kopatentin 2.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 1 gttggcgcta tttccatggt ctatc 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 2 ggtctatcaa agtcacatca ttttt 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 3 caattctaag ccttcacctt gctgg 25 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 4 gccttcacct tgctggtatt agc 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Crassostrea angulata <400> 5 atgtctaaca tcgtagaaaa cgc 23 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 6 ttaagcctac atttggctgg tatta 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 7 gctctgtttc cttgatcaat taaag 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 8 caattttaag tttacaccta gctgg 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 9 ttattggcgc tgtttccctg atcta 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 10 cctccactat caactttttc atatc 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 11 cgatcagtgg acggtcattt actgg 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 12 caaatatacg gtcagtagac ggcca 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 13 cggccattta ttagcattgt ttccc 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 14 gacttccttt ttattgttaa ctacg 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 15 gtcaggcact tctagtatca acggg 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for oyster identification <400> 16 ccatctgtta aggttgttcc catgg 25 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer for mitochondria cox1 gene of oyster <400> 17 atrtchacwa aycayttrga yattgg 26 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for mitochondria cox1 gene of oyster <400> 18 cttattcttc cdggrttygg wat 23

Claims (14)

An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 16; And an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 16, and an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 16. The method according to claim 1,
An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2; And an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, is specific to Crassostrea ariakensis . The method according to claim 1,
An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; And an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 is selected from the group consisting of oysters ( Crassostrea gigas ). &lt; / RTI &gt; The method according to claim 1,
An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 5; And an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 5 is specific to a Portuguese oyster ( C rassostrea angulata ). The method according to claim 1,
An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 6 and SEQ ID NO: 7; And an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 6 and SEQ ID NO: 7 is selected from the group consisting of a Crassostrea nippona ). &lt; / RTI &gt; The method according to claim 1,
An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9; And an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9, is also specific to oyster ( Crassostrea sikamea ). The method according to claim 1,
An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: 11; And an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: 11, is specific to Ostrea circumpicta . The method according to claim 1,
An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 12 to SEQ ID NO: 14; And the oligonucleotide consisting of SEQ ID NO: 12 to SEQ ID NO: 14 of the nucleotide sequence complementary to the base sequence consisting of a nucleotide probe crypt (Ostrea denselamellosa. &lt; / RTI &gt; The method according to claim 1,
An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16; And a probe comprising an oligonucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16 is specific to Saccostrea kegaki . A DNA chip for distinguishing species of an oyster comprising the probe of claim 1. A primer for amplifying a mitochondrial DNA cox1 gene of oyster, which comprises the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18. A kit for identifying an oyster species, comprising the primer of claim 11. 13. The method of claim 12,
Wherein the kit further comprises a light emitting means. PCR using the primer of claim 11 in a DNA sample; Hybridizing the result of the PCR with the DNA chip of claim 10; And identifying the pattern of hybridization. &Lt; Desc / Clms Page number 19 &gt;

Images