KR20230090167A - SNP marker set and method to identify Korean black cornish population - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphism (SNP) marker set capable of selecting a Korean black cornish population and a method for identifying a black Korean Cornish population using the same, the SNP marker set according to the present invention and a composition using the same, It is possible to quickly and accurately discriminate native chickens by using the kit and the method of group identification of native chicken purebreds, and distinguish native chickens and crossbreeds.

Description

SNP marker set and method for identifying Korean black cornish population {SNP marker set and method to identify Korean black cornish population}

The present invention relates to a single nucleotide polymorphism (SNP) marker set capable of identifying a Korean Black Cornish population and a method for identifying a Korean Black Cornish population using the same, specifically, an identification method for identifying a Korean Black Cornish population, and an identification composition And it relates to a kit comprising the same.

In Korea, the preservation of livestock genetic resources is being carried out centered on the National Institute of Livestock Science, and in relation to chickens, starting with the process of collecting native chickens scattered across the country in 1992, high-quality native chickens with the Korea Poultry Association in 1994 For 15 years after the start of the meat breeding project, native chickens were selected based on their economic characteristics. As a result, the Poultry Research Institute of the National Institute of Animal Science and Technology established 12 native chicken purebred groups, including reddish-brown native chicken, tanned native chicken, and black Korean Cornish, and registered the purebred group in DAD-IS under FAO.

‘Pure chicken’ is the highest level of ‘original breed, breeder, and practical chicken’, which is the stage for commercializing chickens, and must be separated from other pure chickens and kept genetically pure. If the blood of other pure hens is mixed by careless mistake on the farm, the problem of deteriorating the value of the product may occur because the uniformity of the search and economic ability of the original breed, breeder, and practical heir is lowered.

Therefore, the need for a scientific proof method that can give consumers confidence in the pure black Korean Cornish group is emerging. In this regard, a verification system that can trust and eat native chicken is needed to promote native chicken consumption, and it is necessary to enhance consumers' trust in native chicken through genetic verification of 'purebred', the highest stage of domestic chicken production. do.

However, in order to select the Jeokgalsaek Jaerae-jong group, the Hwanggalsaek Jaerae-jong group, and the Korean black cornish group among the native chicken purebred groups owned by the Poultry Research Institute of the National Institute of Animal Science and Technology, Studies on methods of using genomic information or related genomic or DNA markers are limited.

Korea Patent No. 1751932

One aspect is to provide a SNP marker set comprising a polynucleotide containing a single nucleotide polymorphism (SNP) or a polynucleotide complementary thereto, capable of selecting a native chicken purebred population.

Another aspect is to provide a composition for screening native chicken purebred population comprising an agent capable of detecting or amplifying the single nucleotide polymorphism (SNP).

Another aspect is to provide a kit for selecting a group of native chicken purebreds comprising the composition.

Another aspect is to provide a microarray for selecting a native chicken purebred population comprising a polynucleotide containing a single nucleotide polymorphism (SNP) capable of selecting a native chicken purebred population or a polynucleotide complementary thereto.

Another aspect is to provide a method for selecting a pure breed population of native chickens by identifying a base of a polynucleotide containing a single nucleotide polymorphism (SNP) capable of selecting a pure population of native chickens or a polynucleotide complementary thereto.

Other objects and advantages of the present invention will become more apparent from the following detailed description, claims and drawings.

1. In polynucleotides composed of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, a polynucleotide composed of 8 or more consecutive bases including a single nucleotide polymorphism (SNP) base located at 61st position among each nucleotide sequence, or a polynucleotide thereof A set of single nucleotide polymorphism (SNP) markers comprising complementary polynucleotides capable of selecting a population of native chickens.

2. The SNP marker set according to 1 above, which is for selecting Korean black cornish among the pure population of native chickens.

3. The SNP marker set according to 1 above, characterized in that the contiguous nucleotides are 8 to 100 contiguous nucleotides.

4. A composition for selecting a group of native chickens, comprising an agent capable of detecting or amplifying one or more of the single nucleotide polymorphisms (SNPs) on the polynucleotide sequence consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18 in 1 above .

5. In the above 4, a population of native chickens, including all agents capable of detecting or amplifying 18 single nucleotide polymorphisms (SNPs) on the polynucleotide sequence consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18 Composition for selection.

6. In the above 4, the agent capable of detecting or amplifying the single nucleotide polymorphism (SNP) is a primer, probe, bead, or bead chip necessary for hybridization reaction with the polynucleotide or a nucleic acid expression product expressed therefrom (Bead chip) at least one selected from the group consisting of, composition.

7. The agent capable of detecting the SNP according to 6 above is a polynucleotide composed of 8 or more consecutive bases each containing SNPs of polynucleotides composed of the nucleotide sequences represented by SEQ ID NOs: 1 to 18 A composition comprising primers capable of amplifying these or their complementary polynucleotides.

8. In the above 6, the agent capable of detecting the SNP is a polynucleotide composed of 8 or more consecutive bases each containing the SNP of the polynucleotide composed of the nucleotide sequences represented by SEQ ID NOs: 1 to 18 A composition comprising a probe that specifically hybridizes with these or its complementary polynucleotides.

9. The composition according to 4 above, which is for selecting Korean black cornish among the purebred population of native chickens.

10. A kit for selecting a group of native chickens comprising the composition of 4 above.

11. A microarray for screening native chickens, comprising at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18 in 1 above.

12. The microarray for selection of native chicken purebred groups according to 11 above, comprising all polynucleotides consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18.

13. The microarray according to 11 above, for selecting Korean black cornish among the pure-bred population of native chickens.

14. Isolating genomic DNA from the subject; and

Determining the genotype of the single nucleotide polymorphism (SNP) positional base of the polynucleotide according to claim 1 in the isolated genomic DNA;

15. In the above 14,

The step of determining the genotype of the base of the SNP position is to use a machine learning model, as a method for selecting a group of native chickens,

The machine learning model is a random forest (RF), a method for selecting a group of native chickens.

16. In the above 14,

If the base of the determined polymorphic site is a polynucleotide containing a single nucleotide polymorphism (SNP) base or a polynucleotide complementary thereto, selecting a pure-bred population of native chickens of the individual as Korean black cornish; Including, a method for selecting a group of native chicken purebreds.

Using the SNP marker of the present invention, it is possible to quickly and accurately identify native chickens, and to determine hybrids with native chickens.

According to one embodiment of the present invention, it is possible to prevent the occurrence of illegal fraud in breeder trade in advance in the process of activating the domestic domestic chicken market and to establish a transparent distribution order.

According to one embodiment of the present invention, it is possible to develop excellent trait-related breeding technology through functional analysis of gene marker regions.

According to one embodiment of the present invention, it is possible to develop a hybridization system using excellent genes for each breed of native chicken.

However, the effects of the present invention are not limited to the above effects, and should be understood to include all effects that can be inferred from the detailed description of the present invention or the configuration of the invention described in the claims.

1 is a diagram showing the results of identifying the Korean Black Cornish population using 100 SNPs.
Figure 2 is a diagram showing the results of identifying the Korean Black Cornish population using 18 SNPs.

Hereinafter, the present invention will be described in more detail.

The present invention is a polynucleotide composed of 8 or more consecutive bases including a SNP (single nucleotide polymorphism) base located at 61st position among the polynucleotides composed of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, or It relates to a set of single nucleotide polymorphism (SNP) markers capable of selecting a pure population of native chickens, including a polynucleotide complementary thereto.

In one embodiment of the present invention, (a) in the polynucleotide represented by SEQ ID NO: 1, the 61st base is A or G, and 50 to 200 consecutive nucleotides including the 61st base as the internal nucleotide sequence of SEQ ID NO: 1 a polynucleotide consisting of a natural base or a polynucleotide complementary thereto;

(b) in the polynucleotide represented by SEQ ID NO: 2, the 61st base is T or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 2; or polynucleotides complementary thereto;

(c) in the polynucleotide represented by SEQ ID NO: 3, the 61st base is T or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 3; or polynucleotides complementary thereto;

(d) In the polynucleotide represented by SEQ ID NO: 4, the 61st base is A or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 4, or polynucleotides complementary thereto;

(e) in the polynucleotide represented by SEQ ID NO: 5, the 61st base is T or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 5; or polynucleotides complementary thereto;

(f) In the polynucleotide represented by SEQ ID NO: 6, the 61st base is A or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 6, or polynucleotides complementary thereto;

(g) In the polynucleotide represented by SEQ ID NO: 7, the 61st base is A or G, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 7, or a polynucleotide complementary thereto,

(h) In the polynucleotide represented by SEQ ID NO: 8, the 61st base is T or G, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 8, or polynucleotides complementary thereto;

(i) In the polynucleotide represented by SEQ ID NO: 9, the 61st base is A or G, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 9, or polynucleotides complementary thereto;

(j) In the polynucleotide represented by SEQ ID NO: 10, the 61st base is T or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 10, or polynucleotides complementary thereto;

(k) In the polynucleotide represented by SEQ ID NO: 11, the 61st base is A or G, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 11, or polynucleotides complementary thereto;

(l) In the polynucleotide represented by SEQ ID NO: 12, the 61st base is T or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 12, or polynucleotides complementary thereto;

(m) In the polynucleotide represented by SEQ ID NO: 13, the 61st base is T or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 13, or polynucleotides complementary thereto;

(n) In the polynucleotide represented by SEQ ID NO: 14, the 61st base is A or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 14, or polynucleotides complementary thereto;

(o) In the polynucleotide represented by SEQ ID NO: 15, the 61st base is T or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 15, or polynucleotides complementary thereto;

(p) In the polynucleotide represented by SEQ ID NO: 16, the 61st base is A or G, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 16, or polynucleotides complementary thereto;

(q) in the polynucleotide represented by SEQ ID NO: 17, the 61st base is T or G, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 17; or polynucleotides complementary thereto; and

(r) In the polynucleotide represented by SEQ ID NO: 18, the 61st base is T or C, and a polynucleotide consisting of 50 to 200 consecutive bases including the 61st base as an internal base sequence of SEQ ID NO: 18, or It may be a single nucleotide polymorphism (SNP) marker set capable of selecting a pure-bred population of native chickens, including one or more polynucleotides selected from the group consisting of polynucleotides complementary thereto.

As used herein, the term "nucleotide" is a deoxyribonucleotide or ribonucleotide that exists in single-stranded or double-stranded form, and includes analogs of natural nucleotides unless specifically stated otherwise.

As used herein, the term "polymorphism" refers to the appearance or unique characteristics of organisms of the same species appearing in various ways, or the presence of two or more alleles in one locus, Among the polymorphic sites, only a single nucleotide differs depending on the individual is called a "single nucleotide polymorphism (SNP)". Various studies using SNP DNA analysis methods using single nucleotide polymorphisms have been conducted for research on genetic resources unique to Korea and conservation of genetic resources, but studies related to native chickens are limited. The polymorphic marker for identifying the polymorphism may be one having two or more alleles showing an incidence of 1% or more, preferably 5% or more, or 10% or more in the selected population.

In one embodiment of the present invention, the SNP marker set may be a SNP marker set including all of the polynucleotides (a) to (r) or their complementary polynucleotides.

In the present invention, the polynucleotide or its complementary polynucleotide is 1 to 500, 1 to 400, 1 to 300, 10 to 300, 20 to 300, 30 to 300, 40 to 300, 50 to 300, 50 to 200 bases or nucleotides.

In this specification, the term "native chicken" includes pure-line native chickens and breeds that have been derived from foreign countries, but have a clear introduction history and have been stably settled in Korea's climate and climate for at least 7 generations through improvement.

In the present specification, the native chicken purebred group includes Jeokgalsaek Jaerae-jong (R line), tan native chicken (Hwanggalsaek Jaerae-jong (Y line)) and Korean black Cornish (H line) do. In one embodiment, the native chicken purebred group may be a native chicken purebred group possessed by the Poultry Research Institute of the National Institute of Animal Science and Technology.

In the present specification, the 'Korean black cornish' is one of the native chicken purebreds held by the Poultry Research Institute of the National Institute of Animal Science and Technology, and the color is black, and the breed is Cornish and has good meat quality.

In the present invention, the SNP location base is 61st in all base sequences of SEQ ID NOs: 1 to 18, and polymorphic base information is indicated by [/] in the SNP base sequence information in Table 1.

In one embodiment of the present invention, when the polymorphic site of the SNP marker of the individual (the 61st base of each marker, indicated in parentheses ([])) is the base shown in Table 1 below, Korean black cornish lineage ( H system) can be judged.

Using the SNP marker of the present invention, it is possible to quickly and accurately determine the Korean black cornish strain (H strain), and effectively distinguish between black Korean Cornish and hybrids.

In addition, the present invention includes an agent capable of detecting or amplifying one or more of the single nucleotide polymorphisms (SNPs) on the polynucleotide sequence consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, a breed of a pure population of native chickens It relates to a composition for selection.

In one embodiment of the present invention, the composition includes all agents capable of detecting or amplifying 18 single nucleotide polymorphisms (SNPs) on a polynucleotide sequence consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18. It may be a composition for screening of chicken purebred populations.

In the present invention, any agent capable of detecting or amplifying the single nucleotide polymorphism (SNP) may be used without limitation as long as it can be used for a hybridization reaction with the polynucleotide or a nucleic acid expression product expressed therefrom. For example, the formulation may include primers, probes, beads, bead chips, and the like.

In the present invention, the "agent" may further include a reagent necessary for a hybridization reaction with the gene or a nucleic acid expression product expressed therefrom. In addition, the formulation may further include a buffer, a solvent, and the like as a reaction medium.

As used herein, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow for the synthesis of extension products to begin.

The oligonucleotide used as the primer may also contain a nucleotide analog, such as a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid, or an intercalating material agent) may be included.

The primers each contain SNPs of polynucleotides consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, 1 to 500, 1 to 400, 1 to 300, 10 to 300, 20 to 300 , 30 to 300, 40 to 300, 50 to 300, 50 to 200, 8 to 100 or 15 to 30 bases or nucleotides.

In the present invention, the primers may be composed of a forward alignment primer and a reverse alignment primer as one set.

The term "probe" used in the present invention may be a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a probe extension product. The length and sequence of the probe should allow for initiation of synthesis of the extension product.

The oligonucleotide used as the probe may also contain a nucleotide analog, such as a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid, or an intercalating material. agent) may be included.

The probes each contain SNPs of polynucleotides consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, 1 to 500, 1 to 400, 1 to 300, 10 to 300, 20 to 300 , 30 to 300, 40 to 300, 50 to 300, 50 to 200, 8 to 100 or 15 to 30 bases or nucleotides.

Using the composition for selection of native chicken purebred groups of the present invention, it is possible to quickly and accurately determine the Korean black cornish strain (H strain), and effectively distinguish black Korean Cornish and hybrids.

SNP markers, primers, etc. are as described above.

In addition, the present invention relates to a kit for breed screening of a pure population of native chickens, including the composition.

In the present invention, when the kit is applied to the PCR amplification process, the kit optionally includes a reagent necessary for PCR amplification, such as a buffer, a DNA polymerase (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , thermostable DNA polymerase obtained from Thermisflavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs. The kit may be manufactured in a number of separate packaging or compartments containing the reagent components described above.

In the present invention, the kit may be an RT-PCR kit or a DNA chip kit.

In the present invention, the RT-PCR kit may include each primer pair specific for the marker gene, and in addition, a test tube or other suitable container, a reaction buffer (pH and magnesium concentration vary), deoxynucleotide ( dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC-water, sterile water, and the like. In the present invention, the RT-PCR kit may include each primer pair specific for the marker gene, and in addition, a test tube or other suitable container, a reaction buffer (pH and magnesium concentration vary), deoxynucleotide ( dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC-water, sterile water, and the like.

In the present invention, the DNA chip kit is a generally flat solid support plate, typically a glass surface no larger than a microscope slide, in which nucleic acid species are attached in a gridded array, and nucleic acids are uniformly distributed on the surface of the chip. Arranged, multiple hybridization reactions occur between the nucleic acids on the DNA chip and the complementary nucleic acids included in the solution treated on the surface of the chip, thereby enabling mass parallel analysis.

In one embodiment of the present invention, the DNA chip kit may include Illumina Chicken 60K Beadchip and Affimetrix 600K Chicken SNP Array.

SNP markers, primers, etc. are as described above.

In addition, the present invention relates to a microarray for selecting a group of native chickens, comprising at least one selected from polynucleotides consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18.

In one embodiment of the present invention, the microarray may include all polynucleotides composed of the nucleotide sequences represented by SEQ ID NOs: 1 to 18.

In the present invention, the term "microarray" refers to a microarray in which groups of polynucleotides are immobilized on a substrate at a high density, and each group of polynucleotides is immobilized in a certain area. Such microarrays are well known in the art. Microarrays are disclosed in, for example, U.S. Patent Nos. 5,445,934 and 5,744,305, the contents of these patents are incorporated herein by reference. SNP markers are as described above.

The term “substrate” refers to any substrate that possesses hybridization properties and to which a marker can be attached under conditions where the background level of hybridization is kept low. Typically, the substrate may be a microtiter plate, membrane (eg nylon or nitrocellulose) or microsphere (bead) or chip. Prior to application or immobilization to the membrane, nucleic acid probes may be modified to facilitate immobilization or improve hybridization efficiency. The modifications may include homopolymer tailing, coupling with different reactive functional groups such as aliphatic groups, NH2 groups, SH groups and carboxyl groups, or coupling with biotin, haptens or proteins.

SNP markers, primers, etc. are as described above.

In addition, the present invention comprises the steps of isolating genomic DNA from an individual; and

It relates to a method for selecting a group of native chickens, including determining the genotype of a single nucleotide polymorphism (SNP) positional base of the polynucleotide in the isolated genomic DNA.

In the present invention, the subject may be a purebred group of native chickens, and specifically may be Jeokgalsaek Jaerae-jong, Hwanggalsaek Jaerae-jong, or Korean black cornish. In one embodiment, the subject is a black Korean Cornish.

The step of isolating genomic DNA from an individual may be performed according to a method commonly used in the art (see: Rogers & Bendich (1994)), or may be performed using a commercially available extraction kit.

In the present invention, the method for isolating genomic DNA from an individual may be performed through a conventional method known in the art. For example, it can be achieved by directly purifying DNA from tissues or cells or by specifically amplifying and isolating a specific region using an amplification method such as PCR. In the present invention, DNA includes not only DNA but also cDNA synthesized from mRNA. The step of obtaining nucleic acid from a subject includes, for example, PCR amplification, ligase chain reaction, transcription amplification, self-sustained sequence replication system; Guatelli et al., Proc. Natl. Acad. Sci. USA (1990) 87:1874-1878) and nucleic acid sequence-based amplification may be used, but are not limited thereto.

The sample isolated from the individual may include the individual's genomic DNA, and the genomic DNA may be obtained from various sources of the individual, such as muscle, epidermis, blood, bone, or organ.

In the present invention, a step of amplifying the separated genomic DNA may be included after the separating step.

In the amplifying step, the target sequence may be amplified by performing an amplification reaction using the isolated genomic DNA as a template and a primer set complementary thereto. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer set that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used. PCR can be performed using a PCR reaction mixture containing various components known in the art required for PCR reactions. The PCR reaction mixture contains appropriate amounts of DNA polymerase, dNTP, PCR buffer, and water in addition to genomic DNA extracted from ginseng to be analyzed and a primer set complementary thereto. The PCR buffer solution includes Tris-HCl, MgCl2, KCl, and the like. At this time, the concentration of MgCl2 greatly affects the specificity and quantity of amplification, and may be preferably used in the range of 1.5-2.5 mM. In general, when Mg2+ is excessive, non-specific PCR amplification products increase, and when Mg2+ is insufficient, the yield of PCR products decreases. An appropriate amount of Triton X-100 may be further included in the PCR buffer.

In the present invention, the step of determining the base of each polymorphic site amplified in the amplification step may be performed by comparing or confirming the bases of the amplified DNA to determine the type of base at a specific position.

Analysis of the nucleotide sequence of the DNA in the present invention can be performed by various methods known in the art. For example, by determining the nucleotide sequence of a nucleic acid directly by the dideoxy method, or by hybridizing a probe containing the sequence of the SNP site or a probe complementary thereto to the DNA and measuring the degree of hybridization obtained therefrom, the polymorphic site can be determined. A method of determining/analyzing a nucleotide sequence may be used, but is not limited thereto. The degree of hybridization may be achieved by, for example, labeling the target DNA with a detectable label and specifically detecting only the hybridized target DNA, and other electrical signal detection methods may be used, but are not limited thereto.

In one embodiment of the present invention, the step of determining the base of each amplified polymorphic site may be characterized in that it is performed by electrophoresis, but is not limited thereto, according to a method well known in the art. Any method capable of separating the DNA of the PCR product by size may be applicable. Specifically, it can be confirmed by agarose gel or polyacrylamide gel electrophoresis or fluorescence analyzer (ABIprism 3100 genetic analyzer-electropherogram). At this time, in order to use a fluorescence analyzer, PCR may be performed in the amplification step using a primer pair attached with a fluorescent dye known in the art. PCR amplification results can preferably be confirmed by agarose gel electrophoresis. After electrophoresis, the electrophoresis result can be analyzed by ethidium bromide staining.

ve Bayes, nearest neighbor classification (9개 이웃 분류), 선형 판별 분석(Linear discriminant Analysis, LDA) 및 의사 결정 트리(Decision Tree, DT) 분류로 이루어진 군에서 선택된 하나 이상인 것일 수 있으며, 구체적으로 랜덤 포레스트(Random Forest, RF)를 이용한 것일 수 있다.In the present invention, the step of determining the genotype of the base of the SNP position may be to use a machine learning model. For example, the machine learning model includes random forest (RF), AdaBoost (AB), quadratic discrimination analysis (QDA), na

It may be one or more selected from the group consisting of ve Bayes, nearest neighbor classification (nine neighbor classification), linear discriminant analysis (LDA), and decision tree (DT) classification, specifically, random forest ( Random Forest, RF) may be used.

In one embodiment of the present invention, the selection method is such that when the base of the determined polymorphic site is a polynucleotide containing a single nucleotide polymorphism (SNP) base or a polynucleotide complementary thereto, the individual's native chicken purebred population is black Korean Cornish (Korean black cornish) may be further included.

In one embodiment of the present invention, the selection method is performed when the 61st base in the polynucleotide represented by SEQ ID NO: 1 is A or G; When the 61st base in the polynucleotide represented by SEQ ID NO: 2 is T or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 3 is T or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 4 is A or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 5 is T or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 6 is A or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A or G; When the 61st base in the polynucleotide represented by SEQ ID NO: 8 is T or G; When the 61st base in the polynucleotide represented by SEQ ID NO: 9 is A or G; When the 61st base in the polynucleotide represented by SEQ ID NO: 10 is T or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 11 is A or G; When the 61st base in the polynucleotide represented by SEQ ID NO: 12 is T or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 13 is T or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 14 is A or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 15 is T or C; When the 61st base in the polynucleotide represented by SEQ ID NO: 16 is A or G; When the 61st base in the polynucleotide represented by SEQ ID NO: 17 is T or G; And when the 61st base in the polynucleotide represented by SEQ ID NO: 18 is T or C, the pure breed of native chickens can be selected as black Korean Cornish.

Hereinafter, a preferred embodiment is presented to aid understanding of the present invention. However, the following examples are provided to more easily understand the present invention, and the content of the present invention is not limited by the following examples.

[Experimental Example]

Experimental Example 1. Test subject and DNA extraction method

In order to extract the SNP marker set for black Korean Cornish group identification, 12 pure-bred chickens owned by the Poultry Research Institute of the National Institute of Animal Science and Technology, 11 pure-bred pure-bred chickens owned by the Sorae Farming Association Corporation, practical broiler chickens (Ross, Cobb, Indian River), and laying hens A total of 5,408 commercial chickens (Hy-line brown) and Korean Matdak Nos. 1 and 2 breeders were used for analysis.

All samples used in this experiment were conducted according to the regulations and permission (2020-480) of the Laboratory Animal Management and Research Ethics Committee of the National Institute of Animal Science and Poultry Research. Genomic DNA (gDNA) was extracted from whole blood samples taken from wing veins of birds using EDTA (ethylenediaminetetraacetic acid) coated tubes to prevent coagulation. Muscle tissue samples were obtained from chicken purchased from the market. PrimePrep?? for blood and tissue extraction of gDNA. It was performed using a genomic DNA isolation kit according to the manufacturer's protocol (GeNetBio, Daejeon, Korea). The quality and concentration of the extracted gDNA were verified by electrophoresis using a 1% agarose gel and spectroscopic analysis using a nanodrop spectrophotometer (Termo Fisher Scientific, Waltham, MA, USA).

Experimental Example 2. SNP genotype classification for black Korean Cornish population identification

To analyze the SNPs using machine learning, PLINK software (version 1.9), R software v4.1, and 'randomForest' package programs were used.

Among a total of 57,636 SNPs extracted from Illumina chicken 60k Beadchip, SNPs with a Minor Allele frequency of 0.05 or less and SNPs with a genotype call error ratio of less than 10% were considered outliers and removed, and the final 49,491 SNPs were used for analysis.

Genetic distances in chicken populations were calculated using Nei's equation, and fixed index (Fst) values were estimated. The formula for this calculation is:

where u is the total number of alleles, l is the total number of positions, pop1 is the frequency of alleles in population 1, and pop2 is the frequency of alleles in population 2. This value was calculated using the “poppr” package of R software.

where expHtol is the average total population dimorphism and expHsub is the average subpopulation dimorphism. The Fst value was derived using the calculation method of Weir and Cockerham, and the "SNPRelate" package is R.

Population structure analysis was performed based on multidimensional scale (MDS) plots and admixture analysis to identify similarities and differences between the target population and other chicken populations. The MDS picture obtained by PLINK was used to analyze information on the genetic distance per base pair through a 4-dimensional scale. The genetic component of each population was analyzed using ADMIFIX software (version 1.3), and the distribution of the genetic component of the population was compared according to the number of random common ancestors based on the optimal K value. The results of both analyzes were graphically expressed as scatter plots and bar graphs using R software.

Experimental Example 3. SNP marker selection for black Korean Cornish population identification

3.1. Selection of 100 SNP markers for black Korean Cornish population identification

In order to select 100 candidate SNP markers related to Korean black cornish, they were analyzed in two steps.

First, with the black Korean Cornish as an example and the rest of the chicken group as a control group, the p-value for each SNP was estimated using the case / control association analysis tool of PLINK 1.9, and the SNP with a low p-value It was selected assuming that it was a SNP with significant group differentiation.

Thereafter, 100 SNPs were selected by analyzing linkage disequilibrium (LD) so that the selected SNP markers were spread evenly throughout the genome.

3.2. Selection of 18 SNP markers for black Korean Cornish population identification

The selected 100 SNPs were used as a training data set for machine learning. In addition, the data obtained through the validation study through Fluidigm analysis was used as a test data set with the target population identified using the classification algorithm of machine learning technology. A Random Forest (RF; maximum decision tree coefficient—maximum number of subpopulations is 20) model was applied for classification.

The “Carrot” machine learning package of R software was used to build the classification model. The eight machine learning models shared a common classification method, and in the PCA based on the selected marker information, 75.8% of principal component 1 (PC1) and 10.7% of principal component 2 (PC2) showed the most skill. Kerr new native chicken stock was entered as an independent variable regardless of whether or not it was set as a dependent variable. The resampling method used to fit each model was "cross-validation".

Each machine learning model had its own criteria for determining whether the target population was consistently classified.

Sensitivity represents an accurately determined positive value, i.e. the true-positive rate (TPR).

Specificity represents the proportion of correctly determined negative values, that is, the true-negative rate (TNR).

where TP is the number of true-positive outcomes, TN is the number of true-negative outcomes, FN is the number of false-negative outcomes, and FP is the number of false-positive outcomes. is the number of outcomes.

In order to identify the 'Black Korean Cornish' population, the minimum genetic markers required for group identification were reselected through the machine learning method for the 100 SNP markers primarily selected in Experimental Example 3.1, and the final 18 Dog SNPs were selected.

As a result, as shown in FIG. 1, compared to the PCA result of identifying the 'Black Korean Cornish' group using 100 primarily selected SNPs, the 'Black Korean Cornish' group performed well with only the 18 selected SNPs. It was confirmed that it was identified (Fig. 2).

Finally, the selected SNP marker set for identifying the black Korean Cornish population is shown in Table 1 below.

sequence number SNP name chromosome location on the chromosome base sequence One Gga_rs13844265 One 31044791 CTGTTTCAGCTATGCCATAAGATGATGGAAATGAAAAATGTACAAAAAATGAGACAAGGC[A/G]ATATTTTAAGGTCCAGCAACTGGACCTAAGACCTTTAGAGCTGGGACAGTGTTATTCTTC 2 Gga_rs13875017 One 62286779 TCATCAACAAGTCAAACCAGGCAGCATGTGGCTTCAGATAGCACACACTGAGAGGTCCTC[T/C]GTCATTCAGTGGAGCCAACATTAGAGGTTTTCTGTCCATACCTGTCTATGCACTGCACCA 3 Gga_rs14075690 14 7363185 AAAGAATTACTAAATTACCGATTTTTAATGTGCCAAGAGCCACCAATCTTAAGGCTGTGAT[T/C]GTGTGAGAGAGGACAGAGAGACATCTGAAAATTCAGCCCCAGTTTGGGCACATTTTGGTA 4 Gga_rs14187043 2 58201096 TTCAGTATCCTATACACTCTGGTATATATTCATAACAGAATTGGGTCCTCTTCTGTCAAG[A/C]TGTGTTAGAGACTAGTTCTTACGATGGTTAAAAGCTTTGAATTCTTCCGCAATAAGAATGA 5 Gga_rs14199520 2 68171926 CAGAAGAAACATTTACCCAGCATCTTATTTGGCTGTAGTTCATCCTACACTATTTATCTG[T/C]TTTTTTATTTAATGCAATTCACATTATCAGCTCCACCAGAAACACTGAGTTTGCTAAGTG 6 Gga_rs14205453 2 77003280 GCAGAGATACCAAGTCTTTAGCTATTTAGGGGAAGAATATGGATGTTAGTTGTTTTCTAG[A/C]CTTCTTGATACTCCAGAAATATTATTGCAGCTTACTGTTTATGTATAGTTAAAGCCGAAA 7 Gga_rs14394872 3 94205501 AAATGCAAGATTATAAGAGAGGGTGGCTATAGTCCTTTATGTTGCAAAGACTTTACTAAC[A/G]AAGAACAAGCTCTTCTTTCTATCAGTGAATTAACAACATCTGCAGCACCATGCTAATAT 8 Gga_rs14472847 4 56159277 GGCAGCTCTAGTGGAAGTGAAGAGCTGTGAAAAGGCTCCTCTGACAGATACAGTAATACA[T/G]TCAACATACGGAGGGAGCTGGTAGCAGTTAGCACAGAGCTATCTTGACAATAAAAAGCAA 9 Gga_rs14619398 7 27244414 TGAGAGGGGGTGGAATTGGGTGGTACAATGATGACTTTGCTGTCAAAGGTTGAAAACCTC[A/G]TAGCCTCACCCAGAGATTTTGCTGCTGGTACCGCCGGAGGAGCTGAGTCTCCTGAACCAG 10 Gga_rs15739514 14 11057255 GCAGCCTGCTCAATCCATCTACAGCTAACATGAGCCAGACTCTCCATATCTAGGTGCAGT[T/C]TGAATTACAGAAATTYGCCATGTTTTACATGCAAATATGGAAAGCAGTTACAAATATCTC 11 GGaluGA003476 One 4030863 GTTGGAAGACCTGAGAAAATCATTGGTGCTGTGCCCCAGCTGTGCTGTSCTTGGAGCACC[A/G]TGGGTGCTTCTCCTTGGGGTTAAGTGATTTAACACAAGCCTCAATCTGTTCTCCTTGTTG 12 GGaluGA056813 One 179108912 GTATTGAAAGGTCAGCATCAAGGCCCTGAGCATCTCCTCTTCCTCCTYRCCCAGGAATTA[T/C]GTGGCTGTGCTCAAGGGCAGCTCCTCTGCAATGCAGAGAGCTGTGAGAAAAGCTGCTGGG 13 GGaluGA134011 2 13539126 ACCCATTTTCTTCCTGCTGCTGCTGCTGCTGCAGCAAAATGAAGACATTATTTCTCTGCC[T/C]TCTCCACTTGTTCTCTCAGCTTATGGTTCCTGAACCTTGTGGTTATGGGCTGCCTCACCT 14 GGaluGA215531 3 34067068 CTAAATTGCTACAGGAGCAAATGCCTTATTTTATCAAAGTAGAGGTACAAAGAATACTCT[A/C]TGAGCAGCTGCCATTAAATGTTAGAAATGTGTAATTTCCTGGTTAACCCTTTACCAGTTT 15 GGaluGA221831 3 52463727 AGTCCTTTTGTAGTCTCCTTCAGTCAAATACAAATGACTTTATGCAGTTTTCTGTGAGAG[T/C]AAGGAGAAGCTTGGTGATTTGGGGCCTTTAGCCCACCTCTTTTTTCACAGGGGATTCCCA 16 GGaluGA243755 4 4821369 AAGACTAGCTTTAATAATTAGCTGCAAAACCTTTATGAGAGCTGCATTACTGTAAGCAGAC[A/G]TATTTTTTATGTGGCCAAAAGGCACTTGTGTAGCACTGGCATTCCTGTGTGTGCCTGTGC 17 GGaluGA306677 6 35405187 AAGGCAATTAAGCCTGAAAGTGGATTTTCTTTCTTTATGTAGATCTCCTGAAACCRACTT[T/G]CCCAAAGCTGTTTTACTGCCTGCTCCCTGTTCCTGTGATAAAGGCCCACCTGCAAGAAGC 18 GGaluGA312418 7 13575464 GATGAGGTGTATACCAGAATCATTTCGCTGTACTCTCTTATCAGCTACCATGTAACGCAA[T/C]GCCTAAAGTATAATGTGAAAAGACTATCATCTGAAAATTGGTGCTCTTTTCATTGGCACA

Since the genotypes of the Korean 'Black Korean Cornish' H line-specific SNPs shown in Table 1 are found only in the Korean 'Black Korean Cornish' H line, it can be determined that the individuals in which these genotypes are found are hybrids with the Korean 'Black Korean Cornish' H line. and using these genotypes, it is possible to preserve the Korean 'Black Korean Cornish' H-lineage population.

Experimental Example 4. Verification of selected SNP marker combinations

A validation test was conducted based on the selected SNP marker combination. The group identification accuracy of the marker combination was evaluated by randomly dividing the SNP information of 1,063 chickens into 70% of the training data set and 30% of the test data set. As a result of the accuracy evaluation of the SNP marker combination, the random forest model showed a high level of accuracy with accuracy, sensitivity, and specificity exceeding 99%.

Model Accuracy Sensitivity Specificity Random forest 100.0 100.0 100.0

As above, specific parts of the present invention have been described in detail, and for those skilled in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> SNP marker set and method to identify Korean black cornish population <130> PD21-364 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 1 ctgtttcagc tatgccataa gatgatggaa atgaaaaatg tacaaaaaat gagacaaggc 60 aatattttaa ggtccagcaa ctggacctaa gacctttaga gctggggacag tgttattctt 120 c 121 <210> 2 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 2 tcatcaacaa gtcaaaccag gcagcatgtg gcttcagata gcacacactg agaggtcctc 60 tgtcattcag tggagccaac attagaggtt ttctgtccat acctgtctat gcactgcacc 120 a 121 <210> 3 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 3 aaagaattac taaattaccg atttttaatg tgccaagagc caccaatctt aggctgtgat 60 tgtgtgagag aggacagaga gacatctgaa aattcagccc cagtttgggc acattttggt 120 a 121 <210> 4 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 4 ttcagtatcc tatacactct ggtatatatt cataacagaa ttgggtcctc ttctgtcaag 60 atgtgttaga gactagttct tacgatggtt aaagctttga attcttccgc aataagaatg 120 a 121 <210> 5 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 5 cagaagaaac atttacccag catcttattt ggctgtagtt catcctacac tatttatctg 60 tttttttatt taatgcaatt cacattatca gctccaccag aaacactgag tttgctaagt 120 g 121 <210> 6 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 6 gcagagatac caagtcttta gctatttagg ggaagaatat ggatgttagt tgttttctag 60 acttcttgat actccagaaa tattattgca gcttactgtt tatgtatagt taaagccgaa 120 a 121 <210> 7 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 7 aaatgcaaga ttataagaga gggtggctat agtcctttat gttgcaaaga cttactaac 60 aaagaacaag ctcttctttc tatcagtgaa ttaacaaaca tctgcagcac catgctaata 120 t-121 <210> 8 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 8 ggcagctcta gtggaagtga agagctgtga aaaggctcct ctgacagata cagtaataca 60 ttcaacatac ggagggagct ggtagcagtt agcacagagc tatcttgaca ataaaaagca 120 a 121 <210> 9 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 9 tgagaggggg tggaattggg tggtacaatg atgactttgc tgtcaaaggt tgaaaacctc 60 atagcctcac ccagagattt tgctgctggt accgccggag gagctgagtc tcctgaacca 120 g 121 <210> 10 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 10 gcagcctgct caatccatct acagctaaca tgagccagac tctccatatc taggtgcagt 60 ttgaattaca gaaattygcc atgttttaca tgcaaatatg gaaagcagtt acaaatatct 120 c 121 <210> 11 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 11 gttggaagac ctgagaaaat cattggtgct gtgccccagc tgtgctgtsc ttggagcacc 60 atgggtgctt ctccttgggg ttaagtgatt taacacaagc ctcaatctgt tctccttgtt 120 g 121 <210> 12 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 12 gtattgaaag gtcagcatca aggccctgag catctcctct tcctcctyrc ccaggaatta 60 tgtggctgtg ctcaagggca gctcctctgc aatgcagaga gctgtgagaa aagctgctgg 120 g 121 <210> 13 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 13 acccattttc ttcctgctgc tgctgctgct gcagcaaaat gaagacatta tttctctgcc 60 ttctccactt gttctctcag cttatggttc ctgaaccttg tggttatggg ctgcctcacc 120 t-121 <210> 14 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 14 ctaaattgct acaggagcaa atgccttatt ttatcaaagt agaggtacaa agaatactct 60 atgagcagct gccattaaat gttagaaatg tgtaatttcc tggttaaccc tttaccagtt 120 t-121 <210> 15 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 15 agtccttttg tagtctcctt cagtcaaata caaatgactt tatgcagttt tctgtgagag 60 taaggagaag cttggtgatt tggggccttt agcccacctc ttttttcaca ggggattccc 120 a 121 <210> 16 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 16 aagactagct ttaataatta gctgcaaacc tttatgagag ctgcattact gtaagcagac 60 atatttttta tgtggccaaa aggcacttgt gtagcactgg cattcctgtg tgtgcctgtg 120 c 121 <210> 17 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 17 aaggcaatta agcctgaaag tggattttct ttctttatgt agatctcctg aaaccractt 60 tcccaaagct gttttactgc ctgctccctg ttcctgtgat aaaggcccac ctgcaagaag 120 c 121 <210> 18 <211> 121 <212> DNA <213> artificial sequence <220> <223> Korean black cornish <400> 18 gatgaggtgt ataccagaat catttcgctg tactctctta tcagctacca tgtaacgcaa 60 tgcctaaagt ataatgtgaa aagactatca tctgaaaatt ggtgctcttt tcattggcac 120 a 121

Claims (16)

In the polynucleotide consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, a polynucleotide consisting of 8 or more consecutive bases including a single nucleotide polymorphism (SNP) base located at 61st position among each nucleotide sequence, or its complementary A single nucleotide polymorphism (SNP) marker set comprising a polynucleotide capable of selecting a population of native chickens.
The SNP marker set according to claim 1, which is for selecting Korean black cornish among the pure population of native chickens.
The SNP marker set according to claim 1, characterized in that the contiguous nucleotides are 8 to 100 contiguous nucleotides.
A composition for screening native chicken purebred populations, comprising an agent capable of detecting or amplifying one or more of the single nucleotide polymorphisms (SNPs) on a polynucleotide sequence consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18 of claim 1.
The method according to claim 4, comprising all agents capable of detecting or amplifying 18 single nucleotide polymorphisms (SNPs) on the polynucleotide sequence consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, for selection of a pure breed population of native chickens composition.
The method according to claim 4, wherein the agent capable of detecting or amplifying the single nucleotide polymorphism (SNP) is a primer, a probe, a bead, or a bead chip required for a hybridization reaction with the polynucleotide or a nucleic acid expression product expressed therefrom At least one composition selected from the group consisting of chip).
The method according to claim 6, wherein the agent capable of detecting the SNP is polynucleotides composed of 8 or more consecutive bases, each containing the SNP of the polynucleotide composed of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, or A composition comprising a primer capable of amplifying its complementary polynucleotides.
The method according to claim 6, wherein the agent capable of detecting the SNP is polynucleotides composed of 8 or more consecutive bases, each containing the SNP of the polynucleotide composed of the nucleotide sequences represented by SEQ ID NOs: 1 to 18, or A composition comprising a probe that specifically hybridizes with its complementary polynucleotides.
The composition according to claim 4, which is for selecting Korean black cornish among the native chicken purebred population.
A kit for selecting a group of native chicken purebreds, comprising the composition of claim 4.
A microarray for screening native chickens, comprising at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18 of claim 1.
The microarray according to claim 11, comprising all polynucleotides consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 18.
The microarray according to claim 11, which is for selecting Korean black cornish among the pure breed of native chickens.
isolating genomic DNA from the subject; and
Determining the genotype of the single nucleotide polymorphism (SNP) positional base of the polynucleotide according to claim 1 in the isolated genomic DNA;
The method of claim 14,
The step of determining the genotype of the base of the SNP position is to use a machine learning model, as a method for selecting a group of native chickens,
The machine learning model is a random forest (RF), a method for selecting a group of native chickens.
The method of claim 14,
If the base of the determined polymorphic site is a polynucleotide containing a single nucleotide polymorphism (SNP) base or a polynucleotide complementary thereto, selecting a pure-bred population of native chickens of the individual as Korean black cornish; Including, a method for selecting a group of native chicken purebreds.

Images