KR102206211B1 - Genetic marker for parentage and thereof in Limanda yokohamae - Google Patents

Abstract

Provided is a microsatellite marker composition which comprises a first microsatellite marker set consisting of eight microsatellite markers of PlYo15, PlYo69, PlYo144, PlYo184, PlYo83, PlYo185, PlYo14, and PlYo182 and a second microsatellite marker set consisting of eight microsatellite markers of PlYo32, PlYo51, PlYo70, PlYo152, PlYo27, PlYo169, PlYo41, PlYo57 to identify parentage of Limanda yokohamae. Accordingly, the most suitable marker for securing the diversity of genetic resources and testing identity of individuals is selected and an identification probability in accordance with the marker is statistically suggested, thereby being applied to a diversity-secured Limanda yokohamae production and history system, a discharge effect investigation, and the like.

Description

[Genetic marker for parentage and thereof in Limanda yokohamae}

The present invention relates to a method for genotyping so that the selection, breeding guidelines, genetic diversity, and blood ties can be known scientifically and easily, and more specifically, by performing Next-Generation Sequencing (NGS) By providing a simultaneous amplification marker (multiplex PCR set) that can save time and cost by securing the nucleotide sequence information of and discovering the microsatellite region (supersatellite region), accurate genotyping analysis of the locust, investigation of release effects, selection breeding, and breeding The present invention relates to a genetic marker for identification of paternity of Limanda yokohamae, capable of scientifically and systematically conducting overall molecular genetic studies such as guidelines, and a method of paternity identification using the same.

Munchi flounder belonging to the Flounder family is distributed in Korea, Japan, Taiwan, and China, and unlike the four species of the same genus, it lives only in the south and west coasts of Korea. On the west coast of Korea, it is a seasonal migratory fish that has a distinct distribution in summer and winter at 37° north latitude, and grows up to about 30 cm and 50 cm in length, respectively, for males and females. In general, flatfish are the same neck as flatfish, but flatfish have the tilt of their eyes. The true direction is the other side. As a method of distinguishing between flounder and flounder, flounder and flounder can be classified as flounder when the fisheye is tilted to the left and raised to the right.

Munchi flounder, like many flounder and fish, is caught by fishing, perilla nets, and prawn nets. It is a fishery resource with high commercial value that it is traded at high prices throughout the year in fish markets and fish markets such as sashimi and grilled food. Many species of fish in the common flounder family are highly valuable as high-quality foods, and are therefore managed through artificial fertilization and fry release, but efficient resource management is not yet achieved. Therefore, in order to secure industrial economic power, it is necessary to develop excellent aquaculture varieties using breeding technology.

Selective breeding is to select individuals or groups that are genetically superior to existing cultured varieties and improve their offspring to better varieties. This is not limited to the improvement of existing varieties, but includes the industrialization of new lines or varieties with high practical value. The amount of genetic improvement according to the selection breeding can gradually increase with generations, so that productivity can be continuously improved, and the qualitative phenotype of halibut culture can affect the value and production cost of aquaculture. In particular, fish have an advantage in genetic improvement by selective breeding because they have a large number of spawning at a time and have a large phenotype genetic variation. Therefore, major measurement traits of fish such as weight and length can be used for direct selection as productivity-related traits. I can.

Moreover, in a situation where it is urgent to increase the economic added value of excellent seedlings and aquatic products to secure the competitiveness of the aquaculture industry according to the FTA, the introduction and use of aquatic organisms breeding technology is very inadequate. It is necessary to develop a molecular breeding technology method using

Genetic markers are a means to identify known locations of chromosomes in organisms with DNA sequences, and as a technology that can analyze genetic characteristics of organisms, they can be used in evaluation studies for preservation of genetic resources. Genetic markers can reveal diversity caused by mutations or modifications at loci. Genetic markers are short DNA sequences, such as single nucleotide polymorphism (SNP), RFLP (restriction fragment length polymorphism), SSLP (simple sequence length polymorphism) resulting from a change in one base. polymorphism), AFLP (Amplified fragment length polymorphism), RAPD (Random amplification of polymorphic DNA) VNTR (Variable number tandem repeat) SSR (Simple sequence) There are things like repeat).

SSR (simple sequence repeat, or microsatellite) is a structure in which a nucleotide sequence of 1-6 bp existing on an organism's genome is simply repeated, and is a part where polymorphism appears due to the difference in the number of repetitions of the nucleotide sequence. Therefore, it is widely used as a useful DNA marker in population genetics, paternity identification, and individual identification, as well as evaluating genetic diversity and relationships due to its frequent distribution, high discrimination ability, and easy detection. The fishery field also investigates the release effect using SSR markers. , Genetic diversity analysis, household identification, and selective breeding.

In general, when many genome studies have been conducted as in humans and animals, it is possible to develop markers by checking and selecting SSR information in the database.However, in the fisheries field, there are currently not many genome analysis studies, so a large amount of sequencing data information is directly secured. You have to find a marker that fits your purpose and proceed.

Recently, a fishery specialized institution is conducting NGS (next generation sequencing) analysis for each fishery species, as well as other genomic analysis methods to discover and develop markers suitable for the purpose. First of all, there is a trend to develop SSR markers by searching the SSR region using the secured full-length genome sequence and verifying discrimination power, efficiency, and accuracy. In addition, since it is used as a scientific investigation method for discrimination, group, phylogenetic analysis, paternity, etc. for many species, the rationale for marker development is increasing.

Accordingly, Korean Patent Laid-Open Publication No. 10-2019-0135789 provides a genetic marker for identifying the parent-child of halibut by developing a marker capable of finding and amplifying the SSR site of a halibut individual and a method for identifying paternity using the same, but the target fish species As silver flounder, which is different from the present invention, the present invention is to provide a marker for parental identification, group structure analysis, selection, family analysis, etc., using NGS to identify the nucleotide sequence of the plait and using the SSR site.

In Korean Patent Publication No. 10-2019-0135789, based on next-generation sequencing (NGS), a marker that can find and amplify the SSR site of a flounder individual was developed to analyze the genotype through the marker and the parent-child relationship and blood relationship of flounder. The site of the marker developed by providing a genetic marker for identifying parent-child and kinship, and a method for identifying parent-child and kinship using the same, is a marker with high discrimination power and excellent amplification rate. When genotype is analyzed using the marker In addition to the production of basic data for paternity identification, we would like to provide a genetic marker for identification of flounder paternity capable of higher paternity identification, and a paternity identification method using the same. Korean Patent No. 10-1211068 includes the steps of obtaining a PCR product by performing a polymerase chain reaction (PCR) on DNA extracted from fish; Binding the PCR product to a probe each comprising a nucleotide sequence identical to or complementary to each of one or more DNA sequences of SEQ ID NOs: 7 to 77; And, determining the species to which the fish belongs according to the binding status; and a method for determining the species of fish in South Korea, including a polynucleotide probe for determining the species of fish, a DN chip, and a kit according to the method. In Korean Patent Registration No. 10-1418139, Figα is specifically expressed in females of halibut, and Scp3 gene is confirmed to be specifically expressed only in males of halibut, so that Figα or Scp3 is a marker gene for determining the sex of halibut. When used as, it discloses a composition for discriminating the sex of flounder and a method for discriminating sex of flounder, which has the effect of quickly and accurately diagnosing male and female discrimination of flounder whose external morphological sex cannot be determined. In Korean Patent No. 10-2000878, a marker for HRM-PCR is amplified based on real-time PCR, a real-time chain polymerase reaction, so that the results for male and female distinction can be easily and quickly derived within 3 to 4 hours. Disclosed is a marker for male and female halibut, which has the effect of confirming the result of the DNA alone, and a marker for male and female halibut using the same, and a HRM-PCR analysis method.

The present invention secures diversity of genetic resources by analyzing genetic differences and molecular biological relationships between populations of P. flounder, and statistically presents the probability of individual identification according to the markers and selection of the most suitable marker for individual identity testing. The purpose of this study is to provide a genetic marker for parental identification of Limanda yokohamae, which can be applied to the production and history system of Munchi flounder, and investigation of discharge effects, and a method for paternity identification using the same.

The microsatellite marker composition capable of identifying the parent-child of Limanda yokohamae according to an embodiment of the present invention is a microsatellite consisting of 8 groups of PlYo15, PlYo69, PlYo144, PlYo184, PlYo83, PlYo185, PlYo14, and PlYo182. Forward and reverse primer pairs of SEQ ID NOs: 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10, 11 and 12, 13 and 14, 15 and 16, which are specific for light markers; PlYo32, PlYo51, PlYo70, PlYo152, PlYo27, PlYo169, PlYo41, PlYo57 are specific for microsatellite markers consisting of the group consisting of 8 and SEQ ID NOs: 17 and 18, 19 and 20, 21 and 22, 23 and 24, 25 and It may be a composition comprising a pair of forward and reverse primers of 26, 27 and 28, 29 and 30, 31 and 32.

The primer set for parental identification of Limanda yokohamae according to another embodiment of the present invention is specific to microsatellite markers consisting of 8 groups of PlYo15, PlYo69, PlYo144, PlYo184, PlYo83, PlYo185, PlYo14, and PlYo182. And may be composed of forward and reverse primer pairs of SEQ ID NOs: 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10, 11 and 12, 13 and 14, 15 and 16.

The primer set for parental identification of Limanda yokohamae according to another embodiment of the present invention is specific to microsatellite markers consisting of 8 groups of PlYo32, PlYo51, PlYo70, PlYo152, PlYo27, PlYo169, PlYo41, and PlYo57. And SEQ ID NOs: 17 and 18, 19 and 20, 21 and 22, 23 and 24, 25 and 26, 27 and 28, 29 and 30, 31 and 32 may be composed of forward and reverse primer pairs. In addition, the present invention may be to provide a kit for parent-child identification including the primer set, Limanda yokohamae.

By developing a multiplex PCR set that can amplify a total of 2 sets simultaneously by consisting of 8 markers in 1 set, it is possible to analyze quickly and quickly, and the discrimination power, amplification efficiency, stability, diversity of markers are excellent, and the discrimination for paternity is 1.14 x It has an effect that can be applied to the production and history system, and discharge effect investigation of the mulberry flounder, which has a high diversity of 10-14.

Figure 1 shows the combination of the multiplex PCR set of the plaque.
2 shows a graph comparing allele frequencies for each marker.
3 shows a graph comparing allele frequencies for each marker.
4 shows a calculation formula for marker discrimination power.
Figure 5 shows the results of genotyping of the parental individuals of the vulgaris.
Figure 6 shows the results of genotyping of the offspring of the vulva.
7 shows the results of genotyping analysis for paternity of the vulgaris.
8 shows the normal distribution using the log likelihood ratio (parent-child index).
9 shows the analysis results for False positive & False negative.

The term "marker" of the present invention means a nucleotide sequence used as a reference point when identifying genetically unspecified related loci.

Microsatellite, also referred to as Simple Sequence Repeats (SSR) of the present invention, is a part in which a simple nucleotide sequence of 1-6 bp existing in the non-coding site is repeated. It is a marker that has frequent distribution in the genome, high discrimination ability, and easy detection. Refers to a DNA marker useful in relationship analysis, paternity, and individual identification.

In the present invention, the term "multiplex PCR" refers to a PCR technique that amplifies several genes simultaneously, unlike single PCR that amplifies one gene for one template DNA. In multiplex PCR, multiple primer pairs are included in a single PCR mixture. In this case, it is preferable that different DNA sequences indicate a specific amplification product size range so that the sizes do not overlap with each other.

In the multiplex PCR technique, since several different primer pairs are put in one tube and reacted, inhibition may occur between primers, so when applying to multiplex PCR, it is important to select primers for the genes to be amplified. Do. In addition, since suitable binding temperatures may differ for each of the several primers included, when applying multiplex PCR, optimization of a binding temperature suitable for multiplex PCR is required so that all of the PCR primer pairs included in a single PCR reaction can effectively bind.

In the present invention, “primer” generally refers to an oligonucleotide, and the term primers as defined herein refers to DNA strands capable of preparing DNA synthesis. DNA polymerase cannot synthesize DNA from scratch without a primer. DNA polymerase can only extend a strand of DNA present in a reaction used as a template to direct the sequence of nucleotides into which the complementary strand is assembled. And it can act as a starting point of synthesis under the conditions of suitable temperature and pH. Preferably, the primer is deoxyribonucleotide and is single stranded. The primers used in the present invention may include natural dNMP (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or synthetic nucleotides. In addition, the primer may also include a ribonucleotide.

The term “next generation sequencing (NGS)” of the present invention is a sequencing technique capable of generating a sequence of large amounts of reads, typically more than a few hundred or more thousands or many sequence reads at the same time. It is distinct and distinct from conventional Sanger or capillary sequencing Typically, the sequenced products have relatively short reads, typically between approximately 600 and 30 base pairs The techniques are typically additionally broad and sophisticated. Organize data processing workflow for data storage and read assembly.

If the nucleotide sequence information of the species to be analyzed is sufficiently revealed, the SSR information can be directly searched to develop a marker, but if the nucleotide sequence information is insufficient, a new domain must be developed. To develop this, recently, a method of developing SSR markers by analyzing a large amount of nucleotide sequence information from the target species for marker development using NGS (next generation sequencing) and directly searching the SSR region has been used. In the case of early large-scale sequencing, it took a long time at high cost, but it was analyzed faster and cheaper due to the development of technology, and is used to reveal genes of many species, and securing the base sequence using NGS for aquatic species for which SSR markers have not been developed. And microsatellite marker development is on the rise

An object of the present invention is to provide a marker that can be applied to the identification of paternity, group structure analysis, selection, family analysis, etc. using the NGS to reveal the nucleotide sequence of the plait and the SSR site.

The 16 simultaneous multiplex amplification marker sets selected according to the present invention have excellent discrimination power, amplification efficiency, stability, and diversity of markers, and the discrimination power for paternity identification is very high, 1.14 x 10-14. In addition, as a multiplex PCR set capable of simultaneously amplifying a total of 2 sets by configuring 8 markers as 1 set, there is an effect that allows faster and faster analysis. Hereinafter, the present invention will be described in detail as an experimental example together with the accompanying drawings.

<Experimental Example 1> Munchi flounder DNA extraction

High quality DNA was extracted in order to extract genomic DNA of Munchi flounder and to perform next generation sequencing (NGS). Extraction was performed using a phenol/chloroform extraction method commonly used in the art or WizardGenomic DNA Purification Kit (Promega, USA).

When performing Next-Generation Sequencing (NGS), high quality DNA was extracted to produce accurate data. In order to extract high quality DNA, the sample was immediately cut into about 1 cm ² of the collected tissue the next day after receipt, washed with sterilized tertiary distilled water, and then proceeded using Promega's Wiazard DNA extraction kit.

<Experimental Example 2> Preparation of DNA Library

In order to produce high-quality raw data, DNA library production was carried out by a Library QC (Quality Control) test and confirmed using Agilent's 2100 BioAnalyzer.

When the total volume, which is the standard for the concentration passing through the Library QC, was 10 ug, the minimum was 5 nM or more, and de novo assembly was performed after the Library QC passed. The Illumina sequencer Hiseq4000 was used to produce NGS raw data of flounder, and the total data production was 15Gb or more, which is more than 15 times the genome size. After checking the total base reads produced, the data corresponding to Q20 was filtered and sorted.

<Experimental Example 3> Selection of microsatellite markers for parent-child identification of flounder

3-1 SSR area marker production

Q-score can be seen as an algebraic number of errors that can occur when calling a base, and Q20 is the probability of having an accuracy of 99% with the probability of loading one base incorrectly when loading 100 bases. As for the produced data, only reads with a Q20 of 90% or more were left and filtered, only the SSR region was selected after de novo assembly, and the marker of the region was designed using the Primer3 (version 0.4.0) program. For simultaneous amplification, the annealing temperature was set at 58~60℃, the GC contents were 40~60%, and the product size was 100~350bp marker.

Since the final selected marker was after all analysis was completed, a fluorescent dye was attached randomly by dividing the section by size. For the labeled primer, attach four fluorescent substances such as FAM, VIC, NED, and PET to the 5'side of the forward primer, and if the amplification product size overlaps each other, use a fluorescent substance of a different color so that the color of the fluorescent substance can be distinguished. Labeled. In addition, PCR combinations were carried out by configuring random combinations so that the sizes do not overlap between the respective markers and fluorescent dyes do not overlap.

3-2 Marker-specific primer construction

The information on the simultaneous amplification (Multiplex) gene markers developed for the vulgaris according to 3-1 above is as follows. Table 1 below shows information on the SSR marker set-A of the monchi flounder, and Table 2 shows information on the SSR marker set-B of the monchi flounder. Figure 1 shows the combination of a multiplex PCR set of the plaque.

Munchi flounder SSR marker set-A information Dye Sequence number Name Sequence(5' to 3') Repeat
Motif Size range FAM One PlYo15_F AAGGGCTATAGAAATGCAGTCC AGA 143~233 2 PlYo15_R GAGTGGCAACCAACGTCAAC 3 PlYo69_F CCAGTTCAGATGGTGGCAGT GAA 254~323 4 PlYo69_R TGCTGCACACAGGAGGATTT VIC 5 PlYo144_F TTTAAGGGCTGTGACCCTTC ATAG 185~209 6 PlYo144_R TCAATGGTGGAGATCTGCTG 7 PlYo184_F TCGAGGTCACAAGCTTGTCC AGAA 294~370 8 PlYo184_R GAATGTATCCTCAGAGAGTCACAGG NED 9 PlYo83_F AGAAAAGTGGTGAGGCAGCA AGG 148~184 10 PlYo83_R ACAGACGGCACGAAATACAGAA 11 PlYo185_F AGTGTGCGGACATTCACTGA TATC 294~378 12 PlYo185_R TGCACTGTGTGGTTGCCTAT PET 13 PlYo14_F GAGATCTACAGCTGGTAAGATTGTGTG CTT 135~174 14 PlYo14_R TGGCAGCTTGACCAACTGAT 15 PlYo182_F CCTTCAAATATCAGACAATCTTAGCC ATGG 311~331 16 PlYo182_R GCTGTGAGAGCTGTGACAGT

Munchi flounder SSR marker set-B information Dye Sequence number Name Sequence(5' to 3') Repeat Motif Size range FAM 17 PlYo32_F GGCTCTTGCGTGATATGTCC TGT 89~107 18 PlYo32_R TGGTCAAAGTGCTACAGCAACT 19 PlYo51_F TGAAGGGCCTTTGACGTCTC GCA 192-258 20 PlYo51_R AGCCCAAAGGTGTTCTCTGG VIC 21 PlYo70_F ACAGGAACTCGAGCTTCTCC TCC 146~173 22 PlYo70_R CCTCTCAGACGCTACAGACTAA 23 PlYo152_F CTCTGGACTCGTGGTTTCCA CAGA 208~260 24 PlYo152_R TTCATTGGTACCAGGCATGA NED 25 PlYo27_F TCAAACATCCACAGTGAGGCCT GAT 128~194 26 PlYo27_R GAGTGCAGGGGAGGACATTT 27 PlYo169_F CAAGCTACTGGATGATCTGAATTTCC TATC 284~352 28 PlYo169_R GCAGCTTTCATGCACCCAAA PET 29 PlYo41_F CGTTGGTTGACTTGCAGGTG CAG 177~189 30 PlYo41_R CCGTCTGACTTCTTGGTGCT 31 PlYo57_F CCCAGTGGTCGAACAGAATTATTTGAG TGT 224~254 32 PlYo57_R TTTACAACCCGGAGTCGTCC

<Example 4> Simultaneous amplification polymerase chain reaction (Multiplex PCR amplification)

Genotyping was performed using 2 sets of Multiplex PCR including 16 markers. In the case of simultaneous amplification (multiplexPCR), the effect of the annealing temperature and reagent concentration is greatly affected.

As for the composition of the PCR reagent, 1ul (100ng/ul), 10X buffer 1.5ul, dNTP (10mM) 1.5ul, Hot-taq polymerase (2.5U/ul) 0.6ul were mixed per sample for DNA template. For the A set of these labeled markers, PlYo15 was 0.15ul, PlYo69 was 0.35ul, PlYo144 was 0.2ul, PlYo184 was 0.4ul, PlYo83 was 0.1ul, PlYo185 was 0.35ul, PlYo14 was 0.15ul, PlYo182 was 0.25ul. In the case of set B, PlYo32 is 0.15ul, PlYo51 is 0.3ul, PlYo152 is 0.25ul, PlYo70 is 0.1ul, PlYo27 is 0.1ul, PlYo169 is 0.3ul, PlYo57 is 0.2ul, PlYo41 is 0.12ul. Used.

Distilled water was added so that the total amount was 15ul. The PCR conditions lowered the temperature by a touch-down PCR method and minimized the effect of the annealing temperature. After denaturing the template DNA at 95°C for 10 minutes, the first step is 94°C for 1 minute; 58°C for 90sec and 72°C for 1 minute in 5 cycles, followed by the second step at 94°C for 1 minute; 5 cycles for 90 sec at 57°C and 1 minute at 72°C, and 1 minute at 94°C; At 56° C., 90 sec and 1 minute at 72° C. were repeated in 25 cycles. Finally, the final kidney reaction was performed at 65°C for 5 minutes, and then the reaction was finished at 8°C.

<Example 5> Genotyping analysis

The amplified PCR product obtained by the method of Example 4 was subjected to 30X dilution, and then a mixture of 1 µl of the amplified product, GeneScan 500 LIZ dye Size Standard (ThermoFisher Scientific, USA) and Hi-Di Formaide (Applied Biosystems, USA) It was diluted 1:9 and used as a sample for analysis.

The sample was subjected to electrophoresis to be classified by size using a 3730xl DNA Analyzer (ThermoFisher Scientific, USA), an automatic base sequence analysis device. A standard allele ladder for each marker was produced, and all individuals were scored using an analysis program such as GeneMapper version 4.0 (ThermoFisher Scientific, USA), and data were collected and analyzed by classifying them by size and type of marker.

2 to 3 show graphs comparing allele frequencies for each marker. The markers at the areas where the size of each marker overlaps can be distinguished by the difference in the color of the labeled fluorescent dye, and the peak in blue is FAM, the peak in green is VIC, the peak in yellow is NED, and the peak in red is PET. And it was possible to know the amplification size (bp) for each marker using the GeneScan 500 LIZ dye Size Standard (ThermoFisher Scientific, USA). As a result of checking the frequency for each marker, it was confirmed that a stable frequency distribution appeared as a whole.

<Example 6> Analysis of polymorphism information index and genetic diversity for markers

Genetic diversity and population genetic analysis of a total of 100 individuals were performed using the developed multiplex PCR set of the plait. The number of alleles was high, 14.13 on average. The analysis result by applying the allele richness was also 14.11 on average, similar to the number of alleles (K), showing that it was very excellent in terms of amplification efficiency. Polymorphism Information Index (PIC) is the probability of discriminating alleles transmitted from parents to offspring. In other words, it is measured by the genotype of the parents, parents, and offspring, and is a measure of diversity in terms of individual identification. have. The value of the developed 16 markers was an average of 0.762, which was confirmed to be a very highly discriminating marker.

<Experimental Example 7> Verification of marker identification for paternity analysis and blood relationship analysis

In order to verify the identification of markers for parentage analysis and kinship analysis, the maximum likelihood method is mainly used in livestock and fish, which is a statistical analysis method through various genotypes. The important thing here is that the used marker must use an accurate marker with high discrimination power, and the discriminant power was calculated by the following formula.

<The formula for calculating the identification power>

Table 3 below shows the values calculated for each marker. The exclusion power of two multiplex PCR sets was calculated and analyzed for the results of analysis of 100 plaques. The exclusion power of the entire marker was 1.438X10 ^-14 , indicating a high discrimination power, which means that the confidence level of 99.99999999 or higher is high.

However, if the analysis of additional individuals is performed, although it is not a large range, there is a possibility that some errors may occur, but as a whole, it is considered that each marker is not biased to a specific genotype, and thus the discrimination power of the marker is considered to be excellent.

Therefore, after using this development marker, it appeared as a marker that can be used in many areas such as recapture rate investigation, genetic diversity analysis, family lineage identification, and selective breeding. After that, the marker set thread verification using actual paternity and the statistical standard LOD It is believed that the actual criterion is needed by calculating the score (log of likelihood ratio, log value of the relationship index).

Calculation value of discrimination by marker Maker Power of each marker PIYo_14(Tri) 0.2033 PIYo_144(Te) 0.3064 PIYo_15(Tri) 0.2435 PIYo_182(Te) 0.5936 PIYo_184(Te) 0.1243 PIYo_185(Te) 0.1513 PIYo_69(Tri) 0.0659 PIYo_83(Tri) 0.2103 PIYo_152(Te) 0.4560 PIYo_169(Te) 0.2009 PIYo_27(Tri) 0.1246 PIYo_32(Tri) 0.3862 PIYo_41(Tri) 0.3216 PIYo_51(Tri) 0.1097 PIYo_57(Tri) 0.1423 PIYo_70(Tri) 0.3604 Exclusion Power 1.873E-0011

<Experimental Example 8> Parentage analysis using the developed 16 markers

8-1. Analyzing the parent-child sample of the platypus for confirmation of the accuracy of paternity

8-1-1. Parent object (PIYO_P)

Figure 5 shows the results of genotyping of the parental individuals of the vulgaris. The parent group was named PIYO_P, and the first individual was named PIYO_P_001, and genotyping was performed on the 27 parent groups to analyze the accuracy of the paternity test for the 16 developed markers. As for the analysis method, genotyping was performed through 16 simultaneous amplification polymerase chain reactions developed above.

8-1-2. Child object (PIYO_J)

6 shows the results of genotyping of the offspring of the vulva. Genotyping was performed to analyze the accuracy of the paternity test for the 16 markers developed above by randomly collecting 183 seeds produced through crossing between individuals of the parent PIYO_P group. As for the analysis method, genotyping was performed through 16 simultaneous amplification polymerase chain reactions developed above.

8-2. Paternity analysis and statistical analysis

In general, parentage analysis (= paternity identification) is to calculate the catch rate through paternity identification between the mother and the sample participating in the production of the released seeds through statistical analysis and paternity identification. In general, the statistical paternity method used in paternity analysis uses the maximum likelihood ratio (Log of likelihood ratio) method, which is statistically approached by allowing human errors, and the exclusion method, which is excluded from paternity, if it is different even in one allele. .

In the case of the exclusion method, since most of it is used as human disaster, disaster, forensic evidence, etc., there should not be false positives or negatives. In general, 16 analyzes and contrasts are made.

The method of using the maximum log of likelihood ratio allows some human errors and mutations in the matching of allele and analyzes them based on statistical reliability results.For livestock, plants, and aquatic organisms, legal data and separated families are identified. It is mainly used in aquatic organisms because it is used as a statistical evaluation tool for selection breeding, release effect investigation, individual selection, generation production, etc., rather than as strong evidence data such as.

Because there are more variations and mutations than humans due to the characteristics of aquatic organisms (mutated animals), it is appropriate to perform statistical paternity using the cumulative allele frequency and probability. The maximum likelihood method uses statistical processing (mostly LOD score = loge T/P, T= transmission probability, P= frequency of offspring genotypes in the population) to confirm paternity to the parent with the highest statistical probability.

This is advantageous in the case of a natural group that needs to analyze a lot of data, and it is a more powerful method for analysis such as paternity of the natural group of aquatic organisms because a slight genotyping error and possibility of mutation are acceptable. In particular, it is a better way to verify paternity when the number of parents or offspring is large.

In the present invention, numerical values were derived through parentage analysis of the commonly used Cervus 3.07 software (Marshall et al., 1998), and parentage was established when parentage analysis was performed on the genetic information of the mother and the offspring. The likelihood ratio was calculated for the objects that were not established, and the likelihood ratio result values were compared and analyzed through simulation for the objects that were not established, and the thresholds for normal distribution and false-positive & negative were set. When checking the relationship, a reference value using the mismatch acceptance criterion and the threshold criterion was also set at the same time.

In conclusion, because it is insufficient to provide scientific basis and explanation to allow mismatch indefinitely, the results were confirmed and verified using the above two methods organically. In addition, since there is no accurate statistical standard in the fisheries field, a threshold value that minimizes false positives & false negatives by creating a normal distribution for the likelihood ratio values of parent-child individuals and non-parent-child individuals to apply statistical reference values as shown in the figure below. Was established.

FIG. 7 shows the results of genotyping analysis of the paternity of the vulgaris, and Table 4 below shows the accuracy results of actual paternity detection for 173 seeds of the vulgaris and 27 of the parents. The number of repetitions of the SSR site for the developed genetic marker is inherited to offspring according to Mendel's law, and paternity can be identified by comparing it with the genotype of the parent group. As a result of paternity verification of 27 parents and 173 seeds, all paternity verification was possible when mismatch '1' was used, and only 1 out of 173 showed 1 mismatch.

Actual paternity detection accuracy result for the parents of Munchi flounder analysis(%) Analysis application criteria Number of animals analyzed 173 (100%) Analysis of 200 parents and children Genotyping number 173 (100%) Analyze at least 12 of 16 markers Number of household checks 173 (100%) Seed 173 rice MISMATCH less than 1

8 shows a normal distribution for a log likelihood ratio value, which is a statistical result. As shown in Fig. 8, as a result of conducting a statistical analysis of the normal distribution of the parental-identified individual and the non-parental group, the overlapping value was less than 1%, which is for the purpose of confirming paternity in future release effect investigation and selection breeding. It indicates that it can be used with high accuracy (99% or more) as a marker.

9 shows the analysis results for False positive & False negative. As shown in FIG. 9, values for false positives & false negatives were derived for the parental confirmation group and the non-parental group, and when the log value is '0', the false positive error rate is 0.5% and the false negative error rate In the case of, it was shown as low as less than 0.01%, which means that the accuracy and reliability are more than 99%. Therefore, it is believed that the use of 16 markers according to the present invention can be used to identify parents with an accuracy of 99% or more in future release effect investigations, and thus accurate and reliable results can be derived.

The parent-child identification marker and parent-child identification method according to the present invention provides a basic database to newly develop a high line or variety by applying to the group, lineage analysis, and parent-child identification of the plait. As a contribution, there is industrial applicability.

<110> Gyeongsangbuk-do <120> Genetic marker for parentage and thereof in Limanda yokohamae <130> p19-0711014 <160> 32 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PlYo15_forward primer <400> 1 aagggctata gaaatgcagt cc 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo15_reverse primer <400> 2 gagtggcaac caacgtcaac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo69_forward primer <400> 3 ccagttcaga tggtggcagt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo69_reverse primer <400> 4 tgctgcacac aggaggattt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo144_forward primer <400> 5 tttaagggct gtgacccttc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo144_reverse primer <400> 6 tcaatggtgg agatctgctg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo184_forward primer <400> 7 tcgaggtcac aagcttgtcc 20 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PlYo184_reverse primer <400> 8 gaatgtatcc tcagagagtc acagg 25 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo83_forward primer <400> 9 agaaaagtgg tgaggcagca 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PlYo83_reverse primer <400> 10 acagacggca cgaaatacag aa 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo185_forward primer <400> 11 agtgtgcgga cattcactga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo185_reverse primer <400> 12 tgcactgtgt ggttgcctat 20 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PlYo14_forward primer <400> 13 gagatctaca gctggtaaga ttgtgtg 27 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo14_reverse primer <400> 14 tggcagcttg accaactgat 20 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PlYo182_forward primer <400> 15 ccttcaaata tcagacaatc ttagcc 26 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo182_reverse primer <400> 16 gctgtgagag ctgtgacagt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo32_forward primer <400> 17 ggctcttgcg tgatatgtcc 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PlYo32_reverse primer <400> 18 tggtcaaagt gctacagcaa ct 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo51_forward primer <400> 19 tgaagggcct ttgacgtctc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo51_reverse primer <400> 20 agcccaaagg tgttctctgg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo70_forward primer <400> 21 acaggaactc gagcttctcc 20 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PlYo70_reverse primer <400> 22 cctctcagac gctacagact aa 22 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo152_forward primer <400> 23 ctctggactc gtggtttcca 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo152_reverse primer <400> 24 ttcattggta ccaggcatga 20 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PlYo27_forward primer <400> 25 tcaaacatcc acagtgaggc ct 22 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo27_reverse primer <400> 26 gagtgcaggg gaggacattt 20 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PlYo169_forward primer <400> 27 caagctactg gatgatctga atttcc 26 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo169_reverse primer <400> 28 gcagctttca tgcacccaaa 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo41_forward primer <400> 29 cgttggttga cttgcaggtg 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo41_reverse primer <400> 30 ccgtctgact tcttggtgct 20 <210> 31 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PlYo57_forward primer <400> 31 cccagtggtc gaacagaatt atttgag 27 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlYo57_reverse primer <400> 32 tttacaaccc ggagtcgtcc 20

Claims (3)

PlYo15, PlYo69, PlYo144, PlYo184, PlYo83, PlYo185, PlYo14, PlYo182 are specific for microsatellite markers consisting of the group consisting of 8 and SEQ ID NOs: 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and Forward and reverse primer pairs of 10, 11 and 12, 13 and 14, 15 and 16;
PlYo32, PlYo51, PlYo70, PlYo152, PlYo27, PlYo169, PlYo41, PlYo57 are specific for microsatellite markers consisting of the group consisting of 8 and SEQ ID NOs: 17 and 18, 19 and 20, 21 and 22, 23 and 24, 25 and 26, 27 and 28, 29 and 30, 31 and 32, including a pair of forward and reverse primers, Limanda yokohamae microsatellite marker composition capable of identifying parent and child PlYo15, PlYo69, PlYo144, PlYo184, PlYo83, PlYo185, PlYo14, PlYo182 are specific for microsatellite markers consisting of the group consisting of 8 and SEQ ID NOs: 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and Forward and reverse primer pairs of 10, 11 and 12, 13 and 14, 15 and 16;
PlYo32, PlYo51, PlYo70, PlYo152, PlYo27, PlYo169, PlYo41, PlYo57 are specific for microsatellite markers consisting of the group consisting of 8 and SEQ ID NOs: 17 and 18, 19 and 20, 21 and 22, 23 and 24, 25 and 26, 27 and 28, 29 and 30, 31 and 32 forward primer and reverse primer set comprising a pair of primers for identification of Limanda yokohamae paternity Limanda yokohamae paternity identification kit comprising the primer set of claim 2

Images