KR102654968B1 - Genetic markers and identification methods for identifying fish species of the genus Girella - Google Patents

Abstract

The present invention is a genetic marker and identification for fish species of the genus Girella that can quickly and accurately identify two species of the genus Girella, which are widely used in Korea for food but are difficult to distinguish based on morphological characteristics. Provides a method.

Description

Genetic markers and identification methods for identifying fish species of the genus Girella}

The present invention relates to genetic markers for distinguishing fish species of the genus Benguet, and more specifically, to genetic markers for distinguishing fish species of the genus Benguet and a discrimination method using the same.

Largescale blackfish ( Girella punctata ) and smallscale blackfish ( G. leonina ) are fish belonging to the Girellidae family, and about 20 species are classified worldwide (Eschmeyer's Catalog of Fishes, 2023). They mainly live in shallow reef areas and are distributed in subtropical waters from the Atlantic Ocean to the western Indian Ocean region. In the waters of East Asia, including the southern coast of Korea and the southern waters of Japan, the white sea bream ( G. mezina ), the sea bream, and the long-tailed sea bream are distributed. These genera have similar morphological characteristics, so a case of taxonomic confusion has been reported in which G. melanichthys of the same genus was incorrectly used as a similar name to long-tailed sea bream. The long-tailed sea bream and the long-tailed sea bream are often confused because their external morphological characteristics are similar, such as the overall number of lateral line scales, the body color of the gill caps, and the shape of the caudal fin, while the two-tailed sea bream is easily distinguished from them morphologically (Itoi, S. et al., J. Mar. Sci . 64, 328-331. 2007). In a recent study, the phylogenetic relationship between the East Asian region's Bengalese sea bream and the long-tailed sea bream was confirmed to have a very close genetic relationship. The benged bream has an ecological habit of settling along the coast, while the long-tailed benged bream has a migratory habit and lives in areas a little away from the coastline. Due to these different ecological characteristics, there are differences in industrial applicability, and therefore, analysis techniques are needed to clearly distinguish between morphologically similar yellowtail seabream and long-tailed seabream.

However, there is still no technology for genetic markers to identify fish species of the genus Benguet genus, which are difficult to distinguish with the naked eye due to their similar appearance.

The present invention is a genetic marker and identification for fish species of the genus Girella that can quickly and accurately identify two species of the genus Girella, which are widely used in Korea for food but are difficult to distinguish based on morphological characteristics. The purpose is to provide a method. However, these tasks are illustrative and do not limit the scope of the present invention.

According to one aspect of the present invention, a first forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 5;

A second forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 6; and

A species-specific PCR kit for identifying fish species of the genus Benguet, including a universal reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 4, is provided.

According to another aspect of the present invention, a genomic DNA extraction step of extracting genomic DNA from fish of the genus Bangedome;

A DNA amplification step of amplifying genomic DNA extracted with the PCR kit of claim 1;

An electrophoresis step of performing electrophoresis on the amplified DNA product; and

A method for identifying fish species of the Benguet genus is provided, including the step of analyzing the band pattern of electrophoresed DNA.

By using the genetic marker for identifying fish species of the Bengendom genus of the present invention as described above, two species of the Bengendom genus, which are difficult to classify morphologically with the naked eye, can be quickly and accurately identified, thereby improving the management of fisheries resources as well as the safety of marine products through identification of similar species. You can also contribute to It can also be used as an economical method to verify the effectiveness of related processed products. Of course, the scope of the present invention is not limited by this effect.

Figure 1 is a diagram showing information on general-purpose primers for gene analysis of the genus Girella designed from the mitochondrial COI sequences of two species of the genus Girella (Girella, AP011060.1; Long-tailed Girella, KX494865.1) of the present invention.
Figure 2 is a diagram illustrating the MSN (minimum spanning network) for the COI barcode region of the pink sea bream (n = 164) and the long-tailed sea bream (n = 36).
Figure 3 is a diagram showing information on species-specific genetic markers designed from the mitochondrial COI sequences of two species of Benguet genus for fish species identification.
Figure 4a is a photograph of an electrophoresis gel in which the target genes of two species of Benguet genus of the present invention were amplified through polymerase chain reaction (PCR) using universal primers. (1) mold mixture; (M) 100 bp DNA leder (Dynebio, South Korea).
Figure 4b is an electrophoresis gel photograph showing the results of identification of two species of the genus Benguet of the present invention through polymerase chain reaction (PCR) using a species-specific primer set. Lanes: (1) mold mixture; (M) 100 bp DNA leder (Dynebio, South Korea).
Figure 5 is an electrophoresis gel photograph showing the results of analyzing the sensitivity for detecting two species of the genus Benguet using the species-specific primer set of the present invention. Sensitivity analysis was determined through 10-fold amplification of genomic DNA from each of the two individuals serially diluted from 10 ng/μL to 0.01 ng/μL. Lanes: (M) 100 bp DNA leder (Dynebio, South Korea); (A) mold mixture; (1) 10 ng; (2) 1 ng; (3) 0.1 ng; (4) 0.01 ng.

Definition of Terms:

“Girella punctata ” used in this document is a saltwater fish with a body length of about 50 cm. The shape is oval with flat sides, the back is greenish-brown and the belly is silver-white. The caudal peduncle and caudal fin are shorter than those of the closely related long-tailed bengerfish. It lives in coastal rocky areas, and the fry live in groups. They mainly eat seaweed and also eat small invertebrates.

The "long-tailed sea bream ( Girella leonina )" used in this document is a species that has been treated as a sea bream for a long time due to its similar appearance to the sea bream. The criteria for distinguishing it from the sea bream are that the caudal fin is long, the tips of the upper and lower lobes are pointed, and the rear edge of the gill cover is black. The entire body is gray-black in color. It is a southern species that has abundant resources off the coast of Jeju Island and lives in warmer waters than the sea bream. It is a large species that grows to 60 to 70 cm in length.

“Haplotype” as used in this document refers to a set of statistically related single nucleotide polymorphism (SNP) gene regions within the same gene region, and is determined through analysis of genetic variation between similar haplotypes. It is used to define genetic groups.

"Cytochrome Oxidase subunit I (COI)" used in this document is a gene in mitochondria and is a DNA marker frequently used when classifying species. Mitochondrial DNA is maternally inherited and genetic recombination does not occur, so phylogenetic analysis between species and breeds It is widely used. In particular, the Cytochrome Oxidase subunit I (COI) gene is widely used as a DNA barcode for species identification markers in many species, including fish.

As used herein, “primer” refers to a single-stranded specific oligonucleotide having a base sequence complementary to a target base sequence specific to the species to be detected.

The term “single nucleotide polymorphism (SNP)” used herein means that one nucleotide sequence consisting of A, T, G, and C in the genome is changed to a different nucleotide sequence. Polymorphism refers to the presence of two or more alleles at one genetic locus, and when only a single base differs depending on the individual among the polymorphic sites, it is called a single nucleotide polymorphism. Preferred polymorphic markers have two or more alleles with an occurrence frequency of 1% or more in the selected population.

Detailed Description of the Invention:

According to one aspect of the present invention, a first forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 5;

A second forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 6; and

A species-specific PCR kit for identifying fish species of the genus Benguet, including a universal reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 4, is provided.

In the species-specific PCR kit, the fish species of the genus may be G. punctata or G. leonina .

According to another aspect of the present invention, a genomic DNA extraction step of extracting genomic DNA from fish of the genus Bangedome;

A DNA amplification step of amplifying genomic DNA extracted with the PCR kit of claim 1;

An electrophoresis step of performing electrophoresis on the amplified DNA product; and

A method for identifying fish species of the Benguet genus is provided, including the step of analyzing the band pattern of electrophoresed DNA.

In the above determination method, the step of analyzing the band pattern of the DNA can be performed by determining a band of 391 bp as G. punctata and a long-tailed bream ( G. leonina ) if a band of 579 bp is confirmed, and multi Genomic DNA can be amplified using multiplex PCR.

The sea bream ( G. punctata ) and the long-tailed sea bream ( G. leonina ) are economically important fish species that live in the East Sea and South Sea of Korea, southern Hokkaido, Japan, around Taiwan, and the East China Sea. In Korea, the above two species are highly valued, especially in Jeju Island, and are very similar in appearance, with adults showing the number of lateral scales with pores, spines, rays on the dorsal fin, and rays on the anal fin; The length of the caudal fin and gill cover (black in the long-tailed bengal sea bream and not black in the long-tailed sea bream) are used as methods for classification. However, during the seed period, it is impossible to distinguish them morphologically, and therefore, analysis technology is needed to clearly identify the two species of Benguet genus.

Mitochondrial DNA for species identification is convenient to use in genetic analysis because its amount is greater than nuclear DNA (Lee, GY et al., Foods , 11, 280. 2022). A DNA-based method for the identification of red sea bream ( G. punctata ) and long-tailed sea bream ( G. leonina ) involves polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP) analysis that identifies specific mutations at enzymatic cleavage sites. It has been reported (Itoi, S. et al., J. Mar. Sci . 64, 328-331. 2007). However, while PCR-based RFLP analysis is labor-intensive, time-consuming, and requires skilled operators, multiplex PCR methods use PCR equipment and imaging equipment (gel documentation systems) that are commonly available in most laboratories and depend on operator skills. It is a less dependent method (Noh, ES et al., J. Life Sci. 27, 746-753. 2017). In addition, multiplex PCR can be used more easily than RFLP because it is cost- and time-efficient for analysis because it can detect multiple targets simultaneously in a single reaction by performing PCR amplification without adding restriction enzymes. In addition, by analyzing differences in nucleotide sequences within a species and designing species-specific primers, false positive and false negative errors occurring due to genetic mutations can be compensated for during the analysis process (Axayacatl, RO et al ., Ichthyol. Res . 2008, 55, 389-393. 2008). Meanwhile, DNA barcoding is a widely used approach based on mitochondrial genes such as cytochrome oxidase subunit I (COI), 16S rRNA, and cytochrome b amplification and profiling. The above technology is being applied to various biological fields such as forensic genetics, biodiversity, and species identification. In particular, species and lineages can be accurately identified through mitochondrial DNA analysis based on amplification and sequence analysis of COI mitochondrial genes ( Parvez, I. et al., Ecol. Genet. Genom . 17, 100067. 2020).

The present inventors used a DNA barcode-based approach to identify the species of Bengalese and long-tailed Japanese finfish, which are difficult to distinguish based on morphological characteristics. In addition, we evaluated the intra- and inter-species genetic diversity of the above species, identified the location of species-specific base mutations in the COI gene, and developed genetic markers for species identification. In total, 16 and 4 haplotypes of the COI gene were identified from the pink sea bream (n = 164) and long-tailed sea bream (n = 36), respectively. The haplotype diversity (Hd) and nucleotide diversity (Pi, %) of COI were 0.359 and 0.054, respectively, for the yellowtail sea bream and 0.560 and 0.078, respectively, for the long-tailed sea bream. Using the information, we designed a set of general-purpose primers and species-specific primers for amplifying the COI genes of the above two species of Benguet genus. Afterwards, amplification products with sizes of 991 bp (September genus), 579 bp (Long-tailed Ben'g'edge), and 391 bp (Beng's bream) were confirmed for the universal primers of Ben's and Long-tailed's. To identify multiple targets in a single reaction, multiplex PCR conditions were optimized to adjust resolution and accuracy. The detection level of multiplex PCR was confirmed to be 0.01 ng/μL for the two species of Girella, and no cross-reaction between bengal sea bream and long-tailed sea bream was found. The multiplex PCR method provides a simple and rapid technique for identification of the above Girella species. It can be used to prevent misidentification of species and to manage resources and quality.

In conclusion, the present inventors designed two sets of primers to develop a multiplex PCR method for the identification of pink sea bream and long-tailed sea bream. As a result of performing multiplex PCR on samples from 200 specimens of the species being analyzed, it was shown that species-specific primers successfully produced amplification products of 391 bp for the bengal sea bream and 579 bp for the long-tailed sea bream. The primer set for multiplex PCR reacted species-specifically, and the detection limit was found to be 0.01 pg. Therefore, using the multiplex PCR of the present invention, two morphologically similar species of Girella can be accurately detected, which will greatly contribute to fishery resource management and the safety of marine products. Additionally, because it is based on genetic analysis, it can be used quickly and inexpensively even in ground and processed foods.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but can be implemented in various different forms. The examples below make the disclosure of the present invention complete, and provide those of ordinary skill in the art with the scope of the invention. It is provided to provide complete information.

Materials and Methods

Sample collection and DNA extraction

In December 2021, fresh caudal fin sample tissues of 200 bengal sea bream and long-tailed bengal sea bream were collected at the Jeju Fisheries Research Institute of the National Institute of Fisheries Science (NIFS) and the morphological characteristics of the samples were analyzed. In the field, bengal sea bream (black) and long-tailed sea bream (colorless) were distinguished by the color pattern of their operculum flaps, and immediately after collection, tissues were stored in 95% ethanol until DNA extraction. Total genomic DNA was extracted from the 200 caudal fin samples using an automated DNA extraction system (KingFisher Flex system, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. The extracted genomic DNA was quantified using a spectrophotometer (Nanodrop ND-1000; Thermo Fisher Scientific, Waltham, MA, USA) and stored at 4°C until analysis.

PCR, sequencing, primer design and data analysis

The mtDNA COI region was amplified and sequenced using 200 individuals of the above sea bream and long-tailed sea bream. For PCR amplification, the primers (SEQ ID NOs: 1 and 2) in Table 1 below were used. For PCR amplification, a 20 μL reaction volume containing the following was used: 15.8 μL of distilled water, 1 μL of DNA template (10 ng/μL); 0.4 μL of dNTPs (250 μM), 2 mM MgCl ₂ , 0.8 μL of forward primer (VF2_t1; 10 pmol, SEQ ID NO: 1), 0.8 μL of reverse primer (FishR2_t1; 10 pmol, SEQ ID NO: 2), and 0.2 μL of 0.5 U DNA Taq (Anti-HS Taq, TNT Research, Jeonju, Republic of Korea). PCR was performed using an ABI Verity Thermal Cycler (Applied Biosystems, Foster City, CA, USA) under the following conditions: initial denaturation at 95°C for 11 min, followed by 40 s at 95°C, 40 s at 54°C, and 72°C. 35 cycles were performed under conditions of 50 seconds, and the final elongation was performed at 72°C for 7 minutes. The obtained bidirectional sequences were aligned using SeqMan Pro 17 (Lasergene 17; DNASTAR, Madison, WI, USA) and the obtained COI sequences were aligned with the COI sequences registered in GenBank using the NCBI BLAST (Basic Local Alignment Search Tool) web service. Potential errors and incomplete sequences were excluded by comparison. Number of haplotypes, polymorphic sites, haplotype diversity (H) and nucleotide diversity (Pi, %) were analyzed using DnaSP (version 5.1) software and PopArt v. The minimum spanning network (MSN) was identified from the COI gene (870 bp) using 1.7 software. Inter- and intra-species genetic distances were analyzed using MEGA software based on the Kimura 2-parameter model, and bootstrap support values were performed on 1000 random replicate data sets. To design species-specific primers, sequence alignment was performed using the corresponding sequencing data for the Japanese red sea bream (AP011060.1) and long-tailed black sea bream (NC046940.1) registered in GenBank NCBI. Alignments were performed using BioEdit (ver. 7.2) and SeqMan Pro 17 (DNASTAR) software and explored inter- and intra-species variation as well as conserved regions of mtDNA COI genes. The conserved regions of the aligned sequences were used to design universal primers (GR-207F and GR-1181R, 991 bp, Table 1) for both species, and the approach provided the nucleotide sequence information necessary for developing species-specific primers. (Figure 1). For PCR amplification, a 20 μL reaction volume containing the following was used: 14.8 μL of distilled water, 1 μL of DNA template (10 ng/μL); 0.4 μL of dNTPs (250 μM); and 2 mM MgCl ₂ , 0.8 μL of forward primer (GR-207F; 10 pmol, SEQ ID NO: 3), 0.8 μL of reverse primer (GR-1181R; 10 pmol, SEQ ID NO: 4), and 0.2 μL of 0.5 U DNA Taq ( Anti-HS Taq, TNT Research, Jeonju, Republic of Korea). PCR was performed using an ABI Verity Thermo Cycler (Applied Biosystems, Foster City, CA, USA) under the following conditions: initial denaturation at 95°C for 10 min followed by 35 cycles of 95°C for 40 s, 56°C for 40 s, and 72°C. 35 cycles of 50 seconds were performed, and the final elongation rate was performed at 72°C for 7 minutes. PCR products were visualized using an imaging device (AE9000 E-Graph, Atto, Tokyo, Japan), and fragment length was determined by comparison with a 100 bp DNA ladder (Dynebio, Seongnam-si, Korea). PCR products were subjected to PCR using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and then analyzed using an ABI 3730XL DNA analyzer (Applied Biosystems, Foster City, CA, USA). Information on the primers used to amplify the COI region and the universal primers of the COI region obtained from the mtDNA sequences of two species of Benguet genus are summarized in Table 1 below.

Universal primer sequence information primer Nucleic acid sequence (5'-->3') Mer Tm(℃) GC(%) product size sequence number VF2_t1 TGTAAAACGACGGCCAGTCAACCAACCACAAAAGACATTGGCAC One FishR2_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 2 GR-207F AGTAATACCAATTATGATTGGA 22 56 28 991 bp 3 GR-1181R ATAGTGGGAATCAGTGTA 18 39 4

Primer design by type

Forward and reverse sequences obtained from Bengalese sea bream and long-tailed sea bream were designed using universal primers using SeqMan Pro 17 software. First, the sequence was trimmed and a final length of 870 bp was obtained for analysis. The nucleotide sequence of the COI gene region was searched for single nucleotide polymorphisms with specificity between the two species, excluding intraspecies mutations due to point mutations. We designed species-specific forward primers for the target species with a species-specific single nucleotide polymorphism (SNP) located at the 3' end that allows PCR amplification for both species. Additionally, PCR product size was considered for clear species identification.

Species-specific multiplex PCR

The present inventors performed MSS-PCR using two forward primers (GP-825F and GL-639F) and one reverse primer (GR-1181R; see Table 2 below) to simultaneously identify two species of Benguet genus. The volume of the PCR reaction mixture was 10 μL and contained the following: 5.9 μL of distilled water, 1 μL of DNA template (10 ng/μL), 0.5 μL of dNTPs (250 μM), 1 μL of 1X PCR buffer, 2 mM MgCl. ₂ , 0.5 μL of forward primer (GP-825F and GL-639F; 10 pmol), 0.5 μL of reverse primer (GR-1181R; 10 pmol), and 0.1 μL of 0.5 U DNA Taq (Anti-HS Taq, TNT Research, Jeonju-si, Republic of Korea). PCR was performed using ABI Verity thermal cyclers (Applied Biosystems) under the following conditions: initial denaturation at 95°C for 10 minutes, followed by 30 cycles of 95°C for 30 seconds, 48-56°C for 30 seconds, and 72°C for 40 seconds. Cycles were performed and a final elongation was performed at 72°C for 7 minutes. PCR products were subjected to 1.8% agarose gel electrophoresis (120 V, 40 min) using 1x Loading Star (Dynebio, Seongnam, Korea) and visualized using an imaging device (AE9000 E-Graph, Atto, Tokyo, Japan). did. The fragment length was determined by comparison with a 100 bp DNA ladder (Dynebio, Seongnam, Korea). The sequence information of the primers used in the multiplex PCR is summarized in Table 2 below.

Species-specific primer sequence information Primer name Nucleic acid sequence (5'-->3') target species Tm(℃) product size sequence number GP-825F CTACATGGGTATAGTTTGA Girella punctata 50 391 5 GL-639F AATACTTCTCACAGACCGA girl leonina 579 6

Specificity and sensitivity of species-specific multiplex PCR

To evaluate the specificity of multiplex PCR, the amplified products were subjected to agarose gel electrophoresis to confirm the absence of dimer amplification, nonspecific products, and cross-reaction. Analytical sensitivity testing for multiplex PCR was performed by quantifying DNA from bengal sea bream and long-tailed sea bream at concentrations of 10, 1, 0.1, and 0.01 ng/μL. For both species, the multiplex PCR assay can detect DNA up to concentrations of 0.01 ng/μL.

Example 1: mtDNA COI-based species identification

The Benguet samples collected in the present invention were identified using sequence analysis of the mtDNA COI gene. As a result of comparing the 540 bp sequence of the Japanese bengal sea bream and the long-tailed sea bream with the sequencing data of NCBI GenBank, it was confirmed that more than 99% of the sequences belonged to the long-tailed sea bream (AP011060.1) and the long-tailed sea bream (NC046940.1). The haplotypes of the obtained COI sequences were registered in GenBank using NCBI's Blast web service to exclude potential errors and incomplete sequences (G. punctate ; accession no. OR267414~OR267429, G. leonina ; accession no. .OR267383~OR267386).

Example 2: COI gene sequence analysis and genetic diversity analysis

Through COI (870 bp) analysis (FIG. 4a) using the primer set of the present invention (SEQ ID NO: 3, SEQ ID NO: 4), 16 haplotypes (n = 164) and 4 haplotypes (n = 164), respectively, were identified among 200 individuals of Bengalese sea bream and long-tailed sea bream. Two haplotypes (n=36) were identified. The haplotype with the highest number was present in 80% (n = 131) and 40% (n = 16) of Bengalese and Long-tailed Bengalese individuals, respectively. Haplotypes were not shared between the above sea bream and the long-tailed sea bream. As a result of the haplotype (Hd) and nucleotide (Pi, %) diversity analysis, the number of haplotype and nucleotide diversity was higher in the long-tailed bengal sea bream than in the long-tailed bengal sea bream, at 0.357 and 0.054, and in the long-tailed bengal sea bream, 0.560 and 0.078. In addition, minimum spanning networks (MSN) were constructed to investigate the intraspecific relationships between the yellowtail seabream and the long-tailed seabream. In the haplotype network, the haplotypes of the bengal sea bream and the long-tailed sea bream differed by 55 fixed mutation levels. Therefore, the two species formed completely different groups. The Bengdom network consisted of a central major haplotype (GP_1, n=131), including several unique haplotypes. In the long-tailed finfish network, each haplotype was located linearly from a central major haplotype (GL_1, n = 21), which had a simple structure because it contained only four haplotypes (Figure 2).

In addition, in order to confirm the genetic similarity between the red sea bream and the long-tailed sea bream, the present inventors compared the distribution of average inter- and intra-species genetic distances as a percentage of genetic divergence. As a result, intraspecific genetic divergence was 0.2% in the Pacific Redtail and Long-tailed Yellowtail, which was significantly lower than the interspecific genetic distance (7.2% between the Redtail and Long-tailed Redtail). Therefore, the pink sea bream and the long-tailed sea bream can be easily distinguished genetically.

Example 3: Species-specific primers

Design of species-specific primers is an important step for multiplex PCR. Species-specific primers must contain at least one variable region for each species, have a melting point of ≥ 50°C, generate PCR products of different sizes between species, and are resistant to self-dimers and heterodimers. ), etc., there should be no other amplification products (Lee, YW et al., J. AOAC Int. 100, 104?108. 2017). The present inventors successfully developed species-specific primers by identifying single nucleotide polymorphism sites that differ between species in sequences obtained from universal primers of the COI gene. From the obtained 870 bp sequence, species-specific forward primers were designed for each species based on nucleotide mutations that show differences between species (Figure 3). The results of inter-species nucleotide variation analysis of the COI region from the mtDNA sequence are summarized in Table 3 below.

Results of inter-species nucleotide variation analysis bell polymorphic site base (bp) 288 291 327 336 345 363 369 378 396 429 441 Red snapper A A T A T A C A T A T long-tailed benged bream G G C G C T A G C G C 475 483 486 495 501 504 534 546 558 564 582 T T T T C C A T G A C C A C C T T G C A G A 583 594 600 621 630 633 636 639 678 696 717 C T T C T G T G T G T T C C A C A C A A A C 756 768 810 816 819 825 849 852 864 867 873 T T C T A A A C G T C C C T C G G T T A C T 966 975 978 984 996 1008 1017 1023 1035 1044 1047 T G T T T G A C T T A C A C C C C C T C C G 1065 1089 1107 A G T G A C

Example 4: PCR specificity and sensitivity

The present inventors performed gradient PCR using a species-specific primer set to confirm the specificity and sensitivity of the species-specific primers. Primer sets GP-825F/GR1181R and GL-639F/GR1181R successfully amplified specific fragments of 391 bp and 579 bp for long-tailed sea bream, respectively, at an annealing temperature of 48 to 56°C (optimum temperature: 50°C). The above results suggest that amplification products according to each species-specific primer can be distinguished using electrophoresis and show high specificity for the target species. Additionally, the present inventors developed a multiplex PCR method by adjusting the components and cycling conditions for PCR (Henegariu, O. et al., Biotechniques. 1997, 23, 504-511. 1997). PCR amplification was performed using mixed species-specific primers (GP-825F, GL-639, and GR-1181R) at different reaction conditions and annealing temperatures, and each PCR product was obtained using the same amount of forward primer. It was confirmed that accurate DNA amplification for the species and clear distinction between amplified products according to size were possible. Additionally, through sequence analysis, it was confirmed that the multiple PCR products were 100% identical to each of the two expected regions. No primer dimers, non-specific amplification products, or cross-reactions were observed in species-specific amplification (Figure 4b). MSS-PCR sensitivity testing showed that the DNA template concentrations of the two stored products were 10, 1, 0.1, and 0.01 ng/μL. The sensitivity test showed that the MSS-PCR assay was able to detect DNA from Bengalese finfish and long-tailed finfish at a concentration of 0.01 ng/μL (Figure 5).

The present invention has been described with reference to the above-described embodiments, but this is merely illustrative, and those skilled in the art will understand that various modifications and equivalent other embodiments are possible therefrom. Therefore, the true scope of technical protection of the present invention should be determined by the technical spirit of the attached patent claims.

Claims (5)

A first forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 5;
A second forward primer consisting of the nucleic acid sequence shown in SEQ ID NO: 6; and
A species-specific PCR kit for identifying fish species of the genus Benguet, comprising a universal reverse primer consisting of the nucleic acid sequence shown in SEQ ID NO: 4. According to paragraph 1,
The species-specific PCR kit where the fish species of the genus is Girella punctata or long-tailed bream ( Girella leonina ). Genomic DNA extraction step of extracting genomic DNA from Bangedom fish;
A DNA amplification step of amplifying genomic DNA extracted with the PCR kit of claim 1;
An electrophoresis step of performing electrophoresis on the amplified DNA product; and
A method for identifying fish species of the genus Benguet, including the step of analyzing the band pattern of electrophoresed DNA. According to paragraph 3,
The step of analyzing the band pattern of the DNA is performed by determining that a band of 391 bp is identified as Girella punctata and that a band of 579 bp is identified as long-tailed bengal bream ( Girella leonina ). According to paragraph 3,
Method for amplifying genomic DNA by multiplex PCR.