CN109554486A - SNP marker relevant to grass carp character and its application - Google Patents

Abstract

The invention discloses SNP marker relevant to grass carp character and its application, present invention SNP site related with Growth of Grass Carps Ctenopharyngodon Idellus situation is located at the 159th bit base of grass carp gene SNP 24, the 410th bit base of gene SNP 25, the 370th bit base of gene SNP 26, the 374th bit base of gene SNP 27；If when the 159th bit base of gene SNP 24, the 410th bit base of gene SNP 25, the 370th bit base of gene SNP 26 are CC genotype, weight is clearly superior to TT genotype individuals, if the 374th bit base TT genotype of gene SNP 27, weight are clearly superior to CC and TC genotype individuals.The present invention can select suitable genotype grass carp parent and breed effective for the molecular mark of grass carp, can obtain the faster Grass carps' fries of growth, accelerate breeding grass carp process.

Description

SNP marker relevant to grass carp character and its application

Technical field

The invention belongs to molecular biology DNA marker technology and application fields, in particular to SNP relevant to grass carp character Molecular labeling and its application.

Background technique

Grass carp (Ctenopharyngodon idella) belongs to Leuciscinae (Leuciscinae), grass carp category (Ctenopharyngodon), have the speed of growth fast, be currently that China's fresh water is supported the advantages that delicious meat, nutritive value is high The maximum cultivation object of annual output in breeding fish, year grass carp yield increases to 5,900,000 from 3,560,000 tons year by year from 2007 to 2016 Ton, ten annual outputs increase 65.73%.It can be seen that the healthy benign development of grass carp aquaculture, not only China or even development The Chinese family people provide a large amount of high-quality animal proteins, while having driven related industry such as feed processing, transport and sales industry Develop, solve the problem of employment of large quantities of personnel.So far, although aquatic products worker has paid many effort, But grass carp does not have the breeding for the artificially breeding identified by national breeding validation board yet, is mostly that wild species are straight in actual production Connect and tame, lack directive breeding, often occur in production because parent is of poor quality, cause offspring's speed of growth is slow, specification not Together, the problems such as premunition is poor, raiser usually face weight huge economic loss, therefore, the good grass carp breeding one of breeding high-yield It is directly the focus target of breeding grass carp work.

Feed cost can be saved by selecting the faster grass carp new varieties of the speed of growth, shorten the culture-cycle in turn significantly Grass carp aquaculture cost is reduced, therefore, develops fast and reliable breeding technique, the cultivation for carrying out grass carp long kind (being) fastly very must It wants.While carrying out conventional herd breeding research, development and application molecular mark technology can accelerate grass carp fine-variety breeding Process.SNP refers to due to the polymorphism that single nucleotide acid makes a variation and generates in genomic dna sequence, positioned at gene coding region SNP non-synonymous can lead to the variation of amino acid, to influence the function of protein, especially occur in structure function region SNP is even more important, and finally causes the variation of biological phenotype.

Whole-genome association (Genome-wide association study, GWAS) is intended to from full-length genome model Enclose the SNPs of interior screening and trait associations.The cost of GWAS analysis mainly has 2: first, the sample size for analysis；The Two, the expense of Genotyping.Quantity is more, and parting cost, the cost for measuring character are also higher.To reduce cost, only it is sequenced The GWAS method of extreme sample is developed, such as BSR-seq (RNA-seq based BSA), XP-GWAS (Extreme- Phenotype genome-wide association study) etc..Research has shown that XP-GWAS can effectively reduce Genotyping Workload, be able to carry out low-cost high-efficiency benefit SNP screening.SNP typing method also gradually by early stage, low pass Amount develops to high-throughput genetic chip, weight sequencing technologies.Wherein RAD-seq (Restriction Association site DNA sequencing) it is exactly that a kind of cheap, efficient SNP is excavated and parting high throughput method.Considering experimental cost and Efficiency can be found within the scope of full-length genome related to Growth of Grass Carps Ctenopharyngodon Idellus character using RAD-seq technology combination XP-GWAS strategy SNP site, it is intended to find new genetic marker, long grass carp breeding of new variety provides basic money fastly for molecular marking supplementary breeding Material.

Summary of the invention

The primary purpose of the present invention is that providing 4 SNPs label relevant to grass carp weight and application.

The technical solution used in the present invention is:

The relevant gene order of Growth of Grass Carps Ctenopharyngodon Idellus is as shown in SEQ ID NO.1~SEQ ID NO.4.

159th Y of said gene sequence, SEQ ID NO.1 is base T or C, and the 410th Y of SEQ ID NO.2 is Base C or T, the 370th Y of SEQ ID NO.3 is base C or T, and the 374th Y of SEQ ID NO.4 is base C or T.

Gene order SEQ ID NO.1~SEQ ID NO.4 described above is in the application for judging Growth of Grass Carps Ctenopharyngodon Idellus speed.

The relevant SNP site of Growth of Grass Carps Ctenopharyngodon Idellus speed is the 159th bit base of SEQ ID NO.1, SEQ ID NO.1 the 410th Bit base, the 370th bit base of SEQ ID NO.1 and the 374th bit base of SEQ ID NO.1.

SNP site described above is judging or is identifying the application in Growth of Grass Carps Ctenopharyngodon Idellus speed.

SNP site described above grows the application of excellent grass carp kind in breeding.

A method of screening Growth of Grass Carps Ctenopharyngodon Idellus speed, comprising the following steps:

Whether the SNP site detected at the 159th bit base of grass carp gene order SEQ ID NO.1 is genotype CC, if Be, then it is excellent for weight, grow fast grass carp；

Or/and whether the SNP site at the 410th bit base of detection grass carp genes of SEQ ID NO.2 is genotype CC, If so, it is excellent for weight, grow fast grass carp；

Or/and whether the SNP site at the 370th bit base of detection grass carp genes of SEQ ID NO.3 is genotype CC, If so, it is excellent for weight, grow fast grass carp；

Or/and whether the SNP site at the 374th bit base of detection grass carp genes of SEQ ID NO.1 is genotype TT, If so, it is excellent for weight, grow fast grass carp.

Further, comprising the following steps:

(1) DNA of grass carp is extracted；

(2) using the DNA of extraction as template, PCR amplification experiment is carried out, obtains the target fragment containing SNP site, detection grass The 159th bit base of fish genes of SEQ ID NO.1, the 410th bit base of genes of SEQ ID NO.2, genes of SEQ ID NO.3 the 370th The genotype of bit base whether be CC or the 374th bit base of genes of SEQ ID NO.4 at genotype whether be TT.

Further, the step (2) PCR amplification: using SNP24-F, SNP24-R, SNP35-F, SNP35-R, SNP36-F, SNP36-R, SNP37-F and SNP37-R primer pair carry out PCR amplification, obtain PCR product, the core of the primer Nucleotide sequence is as follows:

SNP24-F:5'-CGTAGTCACGACAGGACACGT-3'；(SEQ ID NO.5)

SNP24-R:5'-CAGTGATTCTTCTGTTAATTCT-3'；(SEQ ID NO.6)

SNP35-F:5'-GATATGGATGACTGTCTCTCC-3'；(SEQ ID NO.7)

SNP35-R:5'-CAATCCAGGTCAGATAGTACA-3'；(SEQ ID NO.8)

SNP36-F:5'-TCAGGGTTCAAAGTTTGAGTG-3'；(SEQ ID NO.9)

SNP36-R:5'-GTGCGAGGTGATTGGTATCTG-3'；(SEQ ID NO.10)

SNP37-F:5'-GACAATGAGTTCACTATTCT-3'；(SEQ ID NO.11)

SNP37-R:5'-CAAGGTTCTGGAATCATTCCT-3'(SEQ ID NO.12)；

PCR product is subjected to PCR using extension primer SNP24-P, SNP35-P, SNP36-P and SNP37-P again and extends expansion Increase, determines the 159th bit base of grass carp genes of SEQ ID NO.1, the 410th bit base of genes of SEQ ID NO.2, genes of SEQ ID Genotype at the 374th bit base of the 370th bit base of NO.3 and genes of SEQ ID NO.4；The extension primer nucleotides sequence It arranges as follows:

SNP24-P:5'-TACGCTGTGAGAAACTGTGAGG-3'；(SEQ ID NO.13)

SNP35-P:5'-GTGAAAGGGGGAATACTATAAC-3'；(SEQ ID NO.14)

SNP36-P:5'-TTTTTTTTTTCGGACTCGGAGGTTGAGAGCTA-3'；(SEQ ID NO.15)

SNP37-P:5'-AGATCTCAATCCAAGCGAGCAC-3'(SEQ ID NO.16).

Further, the PCR amplification system are as follows:

The pcr amplification reaction condition are as follows: 94 DEG C of denaturation 15s；54 DEG C of annealing 15s, 72 DEG C of extension 30s, 24 recycle.

The beneficial effects of the present invention are:

(1) present invention genotype obtained is the base mutation generated according to gene internal, therefore there is no heredity Exchange, does not need the further verifying of phenotype yet.

(2) four SNP markers of the present invention by detection grass carp, SNP24, SNP35, SNP36 and SNP37, Neng Gou The bigger grass carp of weight is effectively selected under identical cultivating condition, it can be effective for the molecular mark of grass carp.Into And genotype identification can be carried out to grass carp parent according to practical breeding demand, it is numerous to select suitable genotype grass carp parent progress It grows, the faster grass carp offspring (fry) of growth can be obtained, save breeding time, low in cost, accuracy is high, accelerates grass carp and educates Kind process.

Detailed description of the invention

Fig. 1 is the detection peak figure after SNP extension, the color of peak figure and corresponding nucleotide are as follows: green-A, red- T, black-C, blue-G.

Specific embodiment

Below with reference to embodiment, the invention will be further described.

The acquisition of 1 SNP marker of embodiment

1. grass carp gene order such as SEQ ID NO.1~SEQ ID NO.4 that present invention sequencing obtains, in SEQ ID The 159th bit base of NO.1, the 410th bit base of SEQ ID NO.1, the 370th bit base of SEQ ID NO.1 and SEQ ID NO.1 Respectively find a SNP site at 374 bit bases, the 159th bit base of SEQ ID NO.1, the 410th bit base of SEQ ID NO.1, There are allele C and T at the 370th bit base of SEQ ID NO.1 and the 374th bit base of SEQ ID NO.1, forms CC, TC, TT base Because of type.

The present invention is with batch breeding and with 25 monthly age grass carp groups of pool raising for the sample of growth traits (weight) analysis Body selects 298 tail grass carps for growth traits (weight) association analysis at random, chooses weight greatly individual 20 tails (average body Weight is 2659 ± 126.40g), minimum 20 tail of individual of weight (average weight is 744.76 ± 73.35g) extracts parent respectively Subsequent experimental is used for each 2ml of offspring's tail vein blood (addition ACD anti-coagulants is anticoagulant).

In following sequenceYWhat is represented is the base of mutation.

The gene order segment of SNP24 such as SEQ ID NO.1, the library RAD label (Ctg294657.0), mutated site are T159C:

ATCGGTCCACGTAACTCTCCCGAAAGCCTTTCCGCACCGCGCGGGCCATACTGACCACCGTAGTCACG ACAGGACACGTGCTGAAACCCAAGAGGACGGGATGATGGTCTTTAATTCATTAACATGACGAGTGCTGTGTGTGTG TGTGTGTGTTTGTTYCCTCACAGTTTCTCACAGCGTATGCCGCTCGTCCCCGTCGGACACACACAGGTGTTCAGAG GGCCGCAGGCAGCACCATGTTGGCAGGGAGGAACACACGGTGTAGTGACAGCTGCACACACACACACAATTACATG ATCACACACTACATCAAAACACCACAGAATTAACAGAAGAATCACTGCAAATGAAACTGAAACTGAAAAAATGAAT GTCATATGAATGATTCAATGATTAATGATGTCATAATGAAAGGATTATAAT(SEQ ID NO.1)；

SNP35 sequence fragment, the library RAD label (Ctg355219.0), mutated site C410T:

ATTACAACACACCAGTGGTGAGGTCAGCTGGTGGTAGCATGTGTTTCCTGATGTTGATTAGTTTGATT TTGTCTAGTATAAGTGCATTCTTTTTCTTTGGAGAACCCACATCTGCACTTTGCCTCCTGCGAAATGCCATATTTG CATTTTTCTTCACTGTCTGTATTTCCTGTTTGACTGTCCGTTCCTTTCAAATTGTTTGTGTTTTTAAAATGGCTGC TCAGTTCCCTAAGGTGCACAGCCTTTGGGTAAAGCACAATGGCCAGTGGCTCTTCATTGCATTTACTTCTGTCATT CATTTAATTTCTTGTGTGATATGGATGACTGTCTCTCCTGTCAAAGTCACGGCTGACTGGTGGACTTATACAGATC AAATTATGCTCGTCTGTGAAAGGGGGAATACTATAACYTTAACCATAGTTGTGTTCATAGGTTGGTTTCTTGGTTT CCTGTGTCTCCTGTTTTCCTACATGGGAAGAGATCTGCCGAAAAATTACAATGAGGCCAAATCAATAACCTTCAGT CTAACTTTGTACTATCTGACCTGGATTGGATATTTCACAGCATACCTCTCTTTCAAAAGCAAATACATCATCCTTT TGAATGCACTGGCTCAAATATCCAGTATAAATGGAATt(SEQ ID NO.2)；

SNP36 sequence fragment, the library RAD label (Ctg36503.0), mutated site C370T:

AGTGTTCCGTGAGGAAATGGTGCGTTGACCACAGGGCTTTGATTACAGAAGCGGCTGGTGTAATGGAG ACGGAGGACTCTCTGTTCTCCTGAGGCCCCCAGACGCTTCCCGCATGTGTTTACTTAACGCAGTTAGGGCTTACGC CATGCATGTGATTACCAAGTGGCTGACACTTCATATCGCAAATAGACAAACTAAACAGAGAGGCCACACAACTTCA CCCTAATTTTTTTTTGGAGGGAAATTCTGTGGTTTGGATGTGAAATTCTGTGAATGGTCCCTGTAGAGTTTAAAAT CTTCTTTTTTTTAATATCTTCCCCCATGTATCAGGGTTCAAAGTTTGAGTGCGGACTCGGAGGTTGAGAGCTAYGC GTCCTTCATAGCCCAGGCTCTAGAAAAGACGCGTGGCCGTGAGTGTGTGCCCTCTTGGGAGGAGATCCAGGGGCTG ATGGGAAGGCAGGAGATACTGTGTGCTGTGCACTACCCTGGACCGGGCTGCTGCCAGATACCAATCACCTCGCACA CTACGGCTAATGAGGTATTGCATCAGTCGTTTCCTCTACAGCAGGGATTGGGAAc(SEQ ID NO.3)；

SNP37 sequence fragment, the library RAD label (Ctg378190.0), mutated site C374T::

AATCGACTCTAAAGTCTGGATCGGATGGACGTGTTCGAATGCACACCTGTGACCACATATAACTATAA TAATAAAAAAATAAAAAAATAATTTAGGGCAAGTATTATGTTTTTTTTTTTGTTTTTTTGGCTGTTGGCAATTCAG CTTTGCAGTTTTAAATTGCAATATTTCACAATATGTCTGCTTTTACTGTATTTTTGATCAAATAAATGCAGCATTG GTGAGACTTTACCAACCCTAAACTTTTGGCCCTAAACCAGCAGGATAACGCCACAAAGCTTAAATCATCTCAAACT GGTTTTTTAAACAAGACAATGAGTTCACTATTCTCAAATGGCCTCCACAGTCTCCAGATCTCAATCCAAGCGAGCA CYTTTGGGATGTGGTGCAACAGGAGATTTGCATAATGGATGTGCAGCTGACAAATCTGCAGCAACTGTGTGATGCC ATCATGATAATATGGACCAAACTCTCTGAGGAATGATTCCAGAACCTTGTTGAATTTATGCCACTATGAATTAAGG CAGTTCTGAAATCAACTTGGTACTAGAAAGATGTACAGTACCTAATAAAGTGGCCGGTTAGTgtatgtatacacac acacacacacacacacacacacac(SEQ ID NO.4).

The screening of 2 growth differences of embodiment label

Using extreme big individual 20 tail and extremely small individual 20 tail sample of building to the 84 difference SNPs screened Label carries out preliminary identification.In selected 84 sites SNPs, wherein 40 are not detected SNP mutation, 44 are detected SNP mutation.44 SNPs that will test saltant type approach analytical table in the difference of extreme big group of individuals and extremely small group of individuals It is bright, SNP24, SNP36 significant difference (P < 0.05), SNP37, SNP38 difference extremely significant (P < 0.01) (being shown in Table 2).

Label of the table 2 in extreme group's parting

Note: " _ " indicates this site P < 0.05.

The verifying relevant to weight of the 3 associated SNP marker of grass carp weight of embodiment

1. sample DNA extracts

(1) it takes the blood 100ul of fish to be measured or shreds metapterygium tissue 3mg, the lysate (10mmol/L of 0.5mL is added Tris-HCl；0.1mol/L EDTA；0.5%SDS；30mg/L RNase；100mg/L Proteinase K, pH8.0), 55 DEG C of digestion 1 Hour, it gently shakes frequently therebetween.

(2) isometric phenol/chloroform/isoamyl alcohol (25:24:1) is added, is mixed by inversion, stands at room temperature after five minutes, 12000 revs/min are centrifuged 10 minutes, take supernatant, then primary with chloroform, stand at room temperature after five minutes, 12000 revs/min Zhongli's heart 10 minutes, take supernatant.

(3) dehydrated alcohol of 2 times of volumes is added, is stored at room temperature 10 minutes precipitating DNA, 12000 revs/min are centrifuged 10 points Clock.

(4) with 70% ethanol washing 1 time, 12000 revs/min are centrifuged 2 minutes, suck supernatant, are stored at room temperature 10 points dry 50 μ l TE (10mmol/L Tris-HCl are added in clock；1mmol/L EDTA, pH8.0) dissolving DNA, 4 DEG C of storages are spare.

2. design of primers and synthesis

Primer pair, and and weight have been synthesized according to grass carp genetic fragment (SEQ ID NO.1~SEQ ID NO.4) design The Snapshot primer of relevant 4 SNP sites, primer sequence are as follows:

SNP24-F:5'-CGTAGTCACGACAGGACACGT-3'；(SEQ ID NO.5)

SNP24-R:5'-CAGTGATTCTTCTGTTAATTCT-3'；(SEQ ID NO.6)

SNP35-F:5'-GATATGGGATGACTGTCTCTCC-3'；(SEQ ID NO.7)

SNP35-R:5'-CAATCCAGGTCAGATAGTACA-3'；(SEQ ID NO.8)

SNP36-F:5'-TCAGGGTTCAAAGTTTGAGTG-3'；(SEQ ID NO.9)

SNP36-R:5'-GTGCGAGGTGATTGGTATCTG-3'；(SEQ ID NO.10)

SNP37-F:5'-GACAATGAGTTCACTATTCT-3'；(SEQ ID NO.11)

SNP37-R:5'-CAAGGTTCTGGAATCATTCCT-3'(SEQ ID NO.12)

3.PCR amplification reaction system:

Pcr amplification reaction condition:

94 DEG C of denaturation 15s；54 DEG C of annealing 15s, 72 DEG C of extension 30s, 24 recycle；72 DEG C of extension 3min.Obtain PCR amplification Reaction product.Amplification obtains the band that stripe size is 423bp, 638bp, 579bp or 624bp.

4. the product of 3ul pcr amplification reaction is taken to be purified with ExoI and Sap, primer and dNTP in PCR product are removed.

Purify reaction system:

Purify reaction condition: 37 DEG C of 45min, 80 DEG C of 15min, the PCR product purified.

5. the PCR product of pair purifying carries out Single base extension

Reaction system are as follows:

Extension primer sequence is as follows:

SNP24-P:5'-TACGCTGTGAGAAACTGTGAGG-3'；(SEQ ID NO.13)

SNP35-P:5'-GTGAAAGGGGGAATACTATAAC-3'；(SEQ ID NO.14)

SNP36-P:5'-TTTTTTTTTTCGGACTCGGAGGTTGAGAGCTA-3'；(SEQ ID NO.15)

SNP37-P:5'-AGATCTCAATCCAAGCGAGCAC-3'；(SEQ ID NO.16)

Extension condition:

5. taking 1 μ l extension products, add 8 μ l loading loading, 95 DEG C of denaturation 3min, immediately ice-water bath.

6. grass carp genotyping

SNaPshot parting is carried out to PCR product using sequenator (sequenator model ABI 3730XL), according to sequencing As a result the color of peak figure can determine whether the genotype of each sample grass carp, at the 159th bit base of grass carp genes of SEQ ID NO.1 Whether SNP site is CC genotype, if it is CC genotype, then for weight is heavier, grass carp of rapid growth；Genes of SEQ ID Whether the SNP site at the 410th bit base of NO.2 is CC genotype, if CC genotype, then heavier, rapid growth for weight Grass carp；Whether the SNP site at the 370th bit base of genes of SEQ ID NO.3 is CC genotype, is then body if CC genotype Heavier, rapid growth grass carp；Or/and whether the SNP site at the 374th bit base of genes of SEQ ID NO.4 is TT gene Type, if TT genotype, then for weight is heavier, grass carp of rapid growth.

It is analyzed using SNPs and grass carp weight being associated property of the least square method to the significant difference screened, random Identical as the result verified in extreme group in group, i.e. this 4 SNPs are significant related (P < 0.05) to growth traits.Label SNP24, SNP35 and SNP36 label CC type weight mean value are all remarkably higher than TT type, and SNP37 label TT type weight mean value is significant Higher than CC and TC genotype (being shown in Table 3).

34 SNPs labels of table and weight character association analysis

Note: same letter indicates that difference is not significant (P > 0.05) between two kinds of genotype, and different letters indicate two kinds of genes Type significant difference (P < 0.05).

As can be known from Table 3, the 410th the 159th bit base of grass carp genes of SEQ ID NO.1, genes of SEQ ID NO.2 alkali SNP site at base, the 370th bit base of genes of SEQ ID NO.3 or/and the 374th bit base of genes of SEQ ID NO.4, with grass The weight of fish is closely related.Four SNP markers of the present invention by detection grass carp, SNP24, SNP35, SNP36 and SNP37, The bigger grass carp of weight can be effectively selected under identical cultivating condition.Present invention discover that the weight energy of SNP marker and grass carp It is closely related, it can be effective for the molecular mark of grass carp.And then it can be according to practical breeding demand to grass carp parent This progress genotype identification is selected suitable genotype grass carp parent and is bred, and the faster grass carp offspring of growth can be obtained (fry) has positive effect to the fish Seedling production that grows grass fastly, and can greatly save breeding time, low in cost, and accuracy is high, Accelerate breeding grass carp process.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.

SEQUENCE LISTING

<110>China's Pearl River Fishery Research Institute of Aquatic Science Research Institute

<120>SNP marker relevant to grass carp character and its application

<130>

<160> 16

<170> PatentIn version 3.5

<210> 1

<211> 423

<212> DNA

<213>artificial sequence

<400> 1

atcggtccac gtaactctcc cgaaagcctt tccgcaccgc gcgggccata ctgaccaccg 60

tagtcacgac aggacacgtg ctgaaaccca agaggacggg atgatggtct ttaattcatt 120

aacatgacga gtgctgtgtg tgtgtgtgtg tgtttgttyc ctcacagttt ctcacagcgt 180

atgccgctcg tccccgtcgg acacacacag gtgttcagag ggccgcaggc agcaccatgt 240

tggcagggag gaacacacgg tgtagtgaca gctgcacaca cacacacaat tacatgatca 300

cacactacat caaaacacca cagaattaac agaagaatca ctgcaaatga aactgaaact 360

gaaaaaatga atgtcatatg aatgattcaa tgattaatga tgtcataatg aaaggattat 420

aat 423

<210> 2

<211> 638

<212> DNA

<213>artificial sequence

<400> 2

attacaacac accagtggtg aggtcagctg gtggtagcat gtgtttcctg atgttgatta 60

gtttgatttt gtctagtata agtgcattct ttttctttgg agaacccaca tctgcacttt 120

gcctcctgcg aaatgccata tttgcatttt tcttcactgt ctgtatttcc tgtttgactg 180

tccgttcctt tcaaattgtt tgtgttttta aaatggctgc tcagttccct aaggtgcaca 240

gcctttgggt aaagcacaat ggccagtggc tcttcattgc atttacttct gtcattcatt 300

taatttcttg tgtgatatgg atgactgtct ctcctgtcaa agtcacggct gactggtgga 360

cttatacaga tcaaattatg ctcgtctgtg aaagggggaa tactataacy ttaaccatag 420

ttgtgttcat aggttggttt cttggtttcc tgtgtctcct gttttcctac atgggaagag 480

atctgccgaa aaattacaat gaggccaaat caataacctt cagtctaact ttgtactatc 540

tgacctggat tggatatttc acagcatacc tctctttcaa aagcaaatac atcatccttt 600

tgaatgcact ggctcaaata tccagtataa atggaatt 638

<210> 3

<211> 579

<212> DNA

<213>artificial sequence

<400> 3

agtgttccgt gaggaaatgg tgcgttgacc acagggcttt gattacagaa gcggctggtg 60

taatggagac ggaggactct ctgttctcct gaggccccca gacgcttccc gcatgtgttt 120

acttaacgca gttagggctt acgccatgca tgtgattacc aagtggctga cacttcatat 180

cgcaaataga caaactaaac agagaggcca cacaacttca ccctaatttt tttttggagg 240

gaaattctgt ggtttggatg tgaaattctg tgaatggtcc ctgtagagtt taaaatcttc 300

ttttttttaa tatcttcccc catgtatcag ggttcaaagt ttgagtgcgg actcggaggt 360

tgagagctay gcgtccttca tagcccaggc tctagaaaag acgcgtggcc gtgagtgtgt 420

gccctcttgg gaggagatcc aggggctgat gggaaggcag gagatactgt gtgctgtgca 480

ctaccctgga ccgggctgct gccagatacc aatcacctcg cacactacgg ctaatgaggt 540

attgcatcag tcgtttcctc tacagcaggg attgggaac 579

<210> 4

<211> 624

<212> DNA

<213>artificial sequence

<400> 4

aatcgactct aaagtctgga tcggatggac gtgttcgaat gcacacctgt gaccacatat 60

aactataata ataaaaaaat aaaaaaataa tttagggcaa gtattatgtt tttttttttg 120

tttttttggc tgttggcaat tcagctttgc agttttaaat tgcaatattt cacaatatgt 180

ctgcttttac tgtatttttg atcaaataaa tgcagcattg gtgagacttt accaacccta 240

aacttttggc cctaaaccag caggataacg ccacaaagct taaatcatct caaactggtt 300

ttttaaacaa gacaatgagt tcactattct caaatggcct ccacagtctc cagatctcaa 360

tccaagcgag cacytttggg atgtggtgca acaggagatt tgcataatgg atgtgcagct 420

gacaaatctg cagcaactgt gtgatgccat catgataata tggaccaaac tctctgagga 480

atgattccag aaccttgttg aatttatgcc actatgaatt aaggcagttc tgaaatcaac 540

ttggtactag aaagatgtac agtacctaat aaagtggccg gttagtgtat gtatacacac 600

acacacacac acacacacac acac 624

<210> 5

<211> 21

<212> DNA

<213>artificial primer

<400> 5

cgtagtcacg acaggacacg t 21

<210> 6

<211> 22

<212> DNA

<213>artificial primer

<400> 6

cagtgattct tctgttaatt ct 22

<210> 7

<211> 22

<212> DNA

<213>artificial primer

<400> 7

gatatgggat gactgtctct cc 22

<210> 8

<211> 21

<212> DNA

<213>artificial primer

<400> 8

caatccaggt cagatagtac a 21

<210> 9

<211> 21

<212> DNA

<213>artificial primer

<400> 9

tcagggttca aagtttgagt g 21

<210> 10

<211> 21

<212> DNA

<213>artificial primer

<400> 10

gtgcgaggtg attggtatct g 21

<210> 11

<211> 20

<212> DNA

<213>artificial primer

<400> 11

gacaatgagt tcactattct 20

<210> 12

<211> 21

<212> DNA

<213>artificial primer

<400> 12

caaggttctg gaatcattcc t 21

<210> 13

<211> 22

<212> DNA

<213>artificial primer

<400> 13

tacgctgtga gaaactgtga gg 22

<210> 14

<211> 22

<212> DNA

<213>artificial primer

<400> 14

gtgaaagggg gaatactata ac 22

<210> 15

<211> 32

<212> DNA

<213>artificial primer

<400> 15

tttttttttt cggactcgga ggttgagagc ta 32

<210> 16

<211> 22

<212> DNA

<213>artificial primer

<400> 16

agatctcaat ccaagcgagc ac 22

Claims (10)

1. the relevant gene order of Growth of Grass Carps Ctenopharyngodon Idellus is as shown in SEQ ID NO.1~SEQ ID NO.4.

2. gene order described in claim 1, the 159th Y of SEQ ID NO.1 is base T or C, the of SEQ ID NO.2 410 Y are base C or T, and the 370th Y of SEQ ID NO.3 is base C or T, and the 374th Y of SEQ ID NO.4 is base C Or T.

3. gene order SEQ ID NO.1~SEQ ID NO.4 as claimed in claim 2 is judging answering for Growth of Grass Carps Ctenopharyngodon Idellus speed With.

4. the relevant SNP site of Growth of Grass Carps Ctenopharyngodon Idellus speed is the 159th bit base of SEQ ID NO.1, SEQ ID NO.1 the 410th Base, the 370th bit base of SEQ ID NO.1 and the 374th bit base of SEQ ID NO.1.

5. SNP site as claimed in claim 4 is judging or is identifying the application in Growth of Grass Carps Ctenopharyngodon Idellus speed.

6. the application that SNP site as claimed in claim 4 grows excellent grass carp kind in breeding.

7. a method of screening Growth of Grass Carps Ctenopharyngodon Idellus speed, which comprises the following steps:

Whether the SNP site detected at the 159th bit base of grass carp gene order SEQ ID NO.1 is genotype CC, if so, It is excellent for weight, grow fast grass carp；

Or/and whether the SNP site at the 410th bit base of detection grass carp genes of SEQ ID NO.2 is genotype CC, if so, It is then excellent for weight, grow fast grass carp；

Or/and whether the SNP site at the 370th bit base of detection grass carp genes of SEQ ID NO.3 is genotype CC, if so, It is then excellent for weight, grow fast grass carp；

Or/and whether the SNP site at the 374th bit base of detection grass carp genes of SEQ ID NO.1 is genotype TT, if so, It is then excellent for weight, grow fast grass carp.

8. the method according to the description of claim 7 is characterized in that the following steps are included:

(1) DNA of grass carp is extracted；

(2) using the DNA of extraction as template, PCR amplification experiment is carried out, obtains the target fragment containing SNP site, detects grass carp base Because of the 370th the 159th bit base of SEQ ID NO.1, the 410th bit base of genes of SEQ ID NO.2, genes of SEQ ID NO.3 alkali The genotype of base whether be CC or the 374th bit base of genes of SEQ ID NO.4 at genotype whether be TT.

9. the method according to the description of claim 7 is characterized in that described step (2) PCR amplification: using SNP24-F, SNP24-R, SNP35-F, SNP35-R, SNP36-F, SNP36-R, SNP37-F and SNP37-R primer pair carry out PCR amplification, PCR product is obtained, the nucleotide sequence of the primer is as follows:

SNP24-F:5'-CGTAGTCACGACAGGACACGT-3'；(SEQ ID NO.5)

SNP24-R:5'-CAGTGATTCTTCTGTTAATTCT-3'；(SEQ ID NO.6)

SNP35-F:5'-GATATGGATGACTGTCTCTCC-3'；(SEQ ID NO.7)

SNP35-R:5'-CAATCCAGGTCAGATAGTACA-3'；(SEQ ID NO.8)

SNP36-F:5'-TCAGGGTTCAAAGTTTGAGTG-3'；(SEQ ID NO.9)

SNP36-R:5'-GTGCGAGGTGATTGGTATCTG-3'；(SEQ ID NO.10)

SNP37-F:5'-GACAATGAGTTCACTATTCT-3'；(SEQ ID NO.11)

SNP37-R:5'-CAAGGTTCTGGAATCATTCCT-3'(SEQ ID NO.12)；

PCR product is subjected to PCR using extension primer SNP24-P, SNP35-P, SNP36-P and SNP37-P again and extends amplification, really Determine the 159th bit base of grass carp genes of SEQ ID NO.1, the 410th bit base of genes of SEQ ID NO.2, genes of SEQ ID NO.3 Genotype at the 374th bit base of 370 bit bases and genes of SEQ ID NO.4；The extension primer nucleotide sequence is as follows:

SNP24-P:5'-TACGCTGTGAGAAACTGTGAGG-3'；(SEQ ID NO.13)

SNP35-P:5'-GTGAAAGGGGGAATACTATAAC-3'；(SEQ ID NO.14)

SNP36-P:5'-TTTTTTTTTTCGGACTCGGAGGTTGAGAGCTA-3'；(SEQ ID NO.15)

SNP37-P:5'-AGATCTCAATCCAAGCGAGCAC-3'(SEQ ID NO.16).

10. the method according to the description of claim 7 is characterized in that the PCR amplification system are as follows:

The pcr amplification reaction condition are as follows: 94 DEG C of denaturation 15s；54 DEG C of annealing 15s, 72 DEG C of extension 30s, 24 recycle.