CN108531621A - A kind of and long relevant SNP site of oyster fast-growth - Google Patents
A kind of and long relevant SNP site of oyster fast-growth Download PDFInfo
- Publication number
- CN108531621A CN108531621A CN201810759495.4A CN201810759495A CN108531621A CN 108531621 A CN108531621 A CN 108531621A CN 201810759495 A CN201810759495 A CN 201810759495A CN 108531621 A CN108531621 A CN 108531621A
- Authority
- CN
- China
- Prior art keywords
- snp site
- sequence
- seq
- primer
- long
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention provide it is a kind of growing relevant SNP site with long oyster, the SNP site is located in the exon of gene LOB, is sequence for SEQ ID NO:1 the 341st from the ends 5', base be G or T；The GG shells of the genotype individuals of this label are wide to be noticeably greater than TT genotype and TG genotype individuals, changes the composition of amino acid sequence, becomes phenylalanine by leucine.The application for the SNP marker that the present invention is had found, can substantially reduce the blindness of long oyster parental line selection, can be quickly obtained the speed of growth soon and the long oyster individual of inheritance stability is used for breeding or nursery.
Description
Technical field
The invention belongs to Biotechnology in Genetic Breeding fields, more particularly to a kind of and long relevant SNP site of oyster fast-growth.
Background technology
Long oyster (Crassostrea gigas) is also known as Pacific oyster, is to cultivate that widest in area, yield is maximum in the world
The important traditional breed variety of marine products economic shellfish and China.While the industry stable development of China head's oyster culture at present
It also begins to face many Tough questions：With frequency the problems such as cultivating intensive continuous improvement and marine environmental pollution and red tide
The breeding environment of numerous appearance, long oyster is worsening；Since nonstandard for many generations cultivation leads to inbred, long oyster is cultivated
Germplasm degradation phenomena is on the rise, and the problems such as growth is slow, dressing percentage is low, the death rate increases occurs, and seriously affects long oyster production
The sustainable development of industry；With the raising of the level of consumption and the aggravation of market competition, consumption market both domestic and external is to long oyster
Quality requirements are constantly promoted.Therefore, high-quality, high yield, degeneration-resistant improved seeds are cultivated, are that China head's oyster industry health is sustainable
The only way of development.
With the development of molecular biology and genomics, the breeding research of long oyster is also undergoing by traditional choosing
It selects, the transformation of crossbreeding to the molecular breeding based on genomic information.Molecular breeding core content based on genome is pair
The research of genotype and phenotypic polymorphism, wherein single nucleotide polymorphism (SNP) label are wide (especially in gene regions because of its distribution
Be also distributed), the advantages that high-throughput detection can be achieved, be increasingly becoming genetic marker preferred in genetic breeding research.If these
Genetic marker related to the production traits can be linked togather, you can realization carries out selection and use from DNA level, overcomes tradition side
Method is affected by human factors big unfavorable factor, improves the accuracy of selection, and may be implemented in and identify in early days with excellent
The individual of benign shape filters out excellent standby parent, so as to shorten breeding cycle, accelerates breeding process.By finding and length
The related gene of oyster fast-growth improves the screening efficiency of fast long parent, and the growth traits of predictable offspring, improves excellent
The breeding efficiency of kind.
Invention content
It marks and its applies with the relevant SNP site of long oyster fast-growth the purpose of the present invention is to provide a kind of.
Relevant SNP site being grown with long oyster present invention firstly provides a kind of, the SNP site is located at gene LOB
Exon in, be sequence be SEQ ID NO:1 the 341st from the ends 5', base be G or T；The genotype of this label
The GG shells of body are wide to be noticeably greater than TT genotype and TG genotype individuals (P<0.05) composition of amino acid sequence, is changed
(TTG/TTT), phenylalanine (Leu/Phe) is become by leucine.
Another aspect of the present invention provides a kind of method for detecting above-mentioned SNP site, is expanded using primer pair
The nucleic acid of detected sample, then SNP site is determined whether there is by sequencing；
The primer pair, one kind nucleotide sequence information are as follows：
Forward primer F1：CAACAGTCGTGAGAGACAGC(SEQ ID NO:2)；
Reverse primer R1：CCTAGACAATGAACGTAC(SEQ ID NO:3)；
The present invention also provides a kind of kit for detecting above-mentioned SNP site, the kit includes above-mentioned draws
Object pair.
SNP site provided by the present invention is for screening long oyster breeding parent；A kind of its specific operating method is as follows：
1) measuring samples genomic DNA is extracted；
2) to extract obtained DNA as template, using specific primer to carrying out PCR amplification, PCR product is obtained；
3) pcr amplification product is sequenced, it is fast to screen to determine the genotype of the SNP marker of sample according to sequencing result
The long parent of fast-growing；The individual for the genotype that i.e. screening SNP marker is GG.
The application for the SNP marker that the present invention is had found, can substantially reduce the blindness of long oyster parental line selection, can be quick
It obtains the speed of growth soon and the long oyster individual of inheritance stability is used for breeding or nursery.
Specific implementation mode
The present invention is described in detail with reference to embodiment.
Embodiment 1：With the acquisition of the long relevant label of oyster fast-growth
1, on the basis of completion is sequenced in long oyster genome entirely, applicant is obtained and life by GWAS related analysis technologies
Long relevant gene-bHLH families.Long oyster bHLH families are classified, including A to F organizes totally 89 genes, in this base
It has selected 5 candidate genes to carry out the screening of SNP with the method for resurveying sequence on plinth, has selected 417 individual wild populations.Gained
To 63 sites verified again with the method for genetic chip in 288 individual wild populations, finally use biology it is soft
Part carries out obtaining NewChr4_588155SNP labels with growth traits association analysis.The genotype of NewChr4_588155 labels
The GG shells of individual are wide to be noticeably greater than TT genotype and TG genotype individuals, (the SEQ ID NO in the exon of gene LOB:
1) composition (TTG/TTT) for, changing amino acid sequence becomes phenylalanine (Leu/Phe) by leucine.
2, the association analysis of long oyster SNP site different genotype and growth traits
417 long oysters of individual wild population, measure that shell is high, shell is long, shell is wide, all weights and software weight this 5 respectively
Index, all measurement data, which meet, to be just distributed very much.NewChr4_588155 on LOB genes is marked using the method for resurveying sequence
Note analyzes that different genotype and shell are high, shell is long, shell is wide, all with SPSS after 417 long oyster individual carries out SNP partings
Weight and software are associated analysis again.It was found that the shell of GG type individuals is high, shell is long, shell is wide, all weights and software are all higher than TT again and
TG type individuals.
3,288 long oysters of individual wild population, measure respectively shell is high, shell is long, shell is wide, all weights and software weight this 5
A index, all measurement data, which meet, to be just distributed very much.Existed to mutational site on LOB genes using the method for genetic chip
After 288 long oyster individual carries out SNP partings, with SPSS analyze different genotype and shell are high, shell is long, shell is wide, all weights and
Software is associated analysis again.It was found that the shell of GG type individuals is high, shell is long, shell is wide, all weights and software are all higher than TT and TG types again
Individual.
1 long oyster site different genotype of table in Liang Ge groups with the association analysis of growth traits
Note：Numerical value is average value scholar's standard error in table, and same row difference Superscript letters indicate significant difference (P<0.05).
Embodiment 2：Application of the SNP marker in the long oyster parent of screening fast-growth
Make the kit of the assessment screening long oyster parent SNP marker of fast-growth, the positions SNP for detecting LOB genes
Point NewChr4_588155.
The kit contains the reagent of the specificity amplification primer and specific extension primer of required detection SNP site,
In, the specificity amplification primer sequence of site NewChr4_588155 is SEQ ID NO:2 and SEQ ID NO:3, the kit
Further include common agents needed for relevant art such as, (10 × PCR (containing Mg2+) buffer solution, dNTP (10mM), distilled water, enzyme etc..
In addition it can have standard items and control as determined gene).
Amplification reaction system includes：CDNA 1.0 μ L, 10 × PCR (containing Mg2+) buffer solution 2.5 μ L, the dNTP of concentration 10mM
2.0 μ L, the 1.0 μ L of sense primer that 10 μM of concentration, the archaeal dna polymerase 0.2 for downstream primer 1.0 μ L, concentration 5U/ the μ L that 10 μM of concentration
μ L, distilled water：17.3μL；Amplification condition：94 DEG C of 5min, 94 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 1min, totally 35 recycle, and last 72
DEG C extend 10min；Amplification PCR product is subjected to sequencing and carries out Genotyping.
SNP site is detected using kit, the long oyster parent of fast-growth is screened, is included the following steps：
(1) the clip housing film edge sample from parent to be measured extracts DNA；
(2) to extract obtained DNA as template, primary PCR amplification is carried out using specific primer, obtains first PCR productions
Object；
Amplification reaction system includes：1.0 μ L, 10 × PCR buffer solutions of cDNA (containing Mg2+) 2.5 μ L, the dNTP of concentration 10mM
2.0 μ L, the 1.0 μ L of sense primer that 10 μM of concentration, the archaeal dna polymerase 0.2 for downstream primer 1.0 μ L, concentration 5U/ the μ L that 10 μM of concentration
μ L, distilled water：17.3μL；Amplification condition：94 DEG C of 5min, 94 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 1min, totally 35 recycle, and last 72
DEG C extend 10min；Primer is
Forward primer F1：CAACAGTCGTGAGAGACAGC(SEQ ID NO:2)；
Reverse primer R1：CCTAGACAATGAACGTAC(SEQ ID NO:3)；
The PCR product obtained for the first time is sequenced, long oyster LOB bases to be measured are determined according to result after acquisition sequencing result
Whether the genotype of the SNP marker of cause is GG homozygotes to screen long oyster fast-growth individual.
The results show that the first filial generation arrived after the oyster parent's breeding filtered out by SNP kits totally 500 individuals
In, it is found that the shell of GG type individuals is high, shell is long, shell is wide, all weights and software are all higher than TT and TG type individuals () again, it was demonstrated that this SNP
Labelling kit be can quick selection and breeding merit oyster parent.
Table 2：The growth statistical form of the filial generation of the parent propagation of screening
Note：Numerical value is average value scholar's standard error in table, and same row difference Superscript letters indicate significant difference (P<0.05).
Above-mentioned reaction system, reaction condition and subsequent Genotyping and appraisal procedure, can be according to known in this field normal
Know either conventional techniques to be changed or replace.The value of the kit is that the length for quickly obtaining SNP marker is male
Oyster parent improves the breeding efficiency of improved seeds to carry out molecular mark.
One embodiment of the present invention above described embodiment only expresses, the description thereof is more specific and detailed, but simultaneously
It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art
It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection of the present invention
Range.
Sequence table
<110>Wanli College, Zhejiang
<120>A kind of and long relevant SNP site of oyster fast-growth
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 831
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
atgtctgcaa acggctcaac tacagtcacc gttaaaatag aagaggggga ggatagcggt 60
gtctatggca tgaattcatc atgtgactta tctacgtcat ttaactcttc ggaacatcga 120
tcccgagtcc ctgatgaaat tcgactgcgc atcaacagtc gtgagagaca gcgcatgcac 180
gaattgaacg acgctctgat ggcattaagg agtgtgttac cccaatctca gggatcgtcc 240
ctaaagaaac tctccaaaca gtctaccctt gtacatgcgc gggaacacat cctatctcta 300
tcacggtctg ttgaggagat gaaatgtttg gtacgttcat tgtctaggaa caaagttcat 360
ggcgtggata ctttggagag gagtagtttg aacagtgttc actatcccag tgctttttct 420
cctgccggac aaagatacag tccgtacacc tcaactccga taaagtccaa taagctacgg 480
gaatttcgcc caccagttcc aaacggtttg tccccatact tgagagtaac agaccaccgg 540
ctaattgaaa gtgaaatgaa cctcagatca aaagacgacg ccagtgattc tgcaaattta 600
tcagacagtt tatgttactc tttgccgcat gatgacacta ccagctatca gatcacgtca 660
gcgccatcgg acactgacag gagaaatccc ccagaattcc atattccctc aaagtaccag 720
aattccacat caacaaaacc cgttctgaag ttttccgtag attcgttact tggactttca 780
aataaatgtg atggtgattc tccagtgaaa agcgttgaca ttatgtgtta g 831
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
caacagtcgt gagagacagc 20
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cctagacaat gaacgtac 18
Claims (6)
1. a kind of growing relevant SNP site with long oyster, which is characterized in that the SNP site is located at the outer aobvious of gene LOB
In son, be sequence be SEQ ID NO:1 the 341st from the ends 5', base be G or T.
2. a kind of test right requires the method for stating SNP site described in 1, which is characterized in that the method is to use primer
SNP site is determined whether there is to expand the nucleic acid of detected sample, then by sequencing.
3. method as claimed in claim 2, which is characterized in that the sequence of the primer pair, forward primer is SEQ ID
NO:2；The sequence of reverse primer is SEQ ID NO:3.
4. a kind of primer pair for stating SNP site required for test right described in 1, which is characterized in that the primer pair,
The sequence of forward primer is SEQ ID NO:2；The sequence of reverse primer is SEQ ID NO:3.
5. the present invention also provides a kind of kit for detecting above-mentioned SNP site, the kit includes claim 4
The primer pair.
6. a kind of method for screening long oyster breeding parent, which is characterized in that the method includes following step：
1) measuring samples genomic DNA is extracted；
2) to extract obtained DNA as template, PCR amplification is carried out using the primer pair described in claim 4, obtains PCR product；
3) pcr amplification product is sequenced, the genotype of the SNP marker of sample is determined according to sequencing result to screen fast fast-growing
Long parent；The individual for the genotype that i.e. screening SNP marker is GG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810759495.4A CN108531621B (en) | 2018-07-11 | 2018-07-11 | SNP locus related to rapid growth of crassostrea gigas |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810759495.4A CN108531621B (en) | 2018-07-11 | 2018-07-11 | SNP locus related to rapid growth of crassostrea gigas |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108531621A true CN108531621A (en) | 2018-09-14 |
| CN108531621B CN108531621B (en) | 2021-12-21 |
Family
ID=63488035
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810759495.4A Active CN108531621B (en) | 2018-07-11 | 2018-07-11 | SNP locus related to rapid growth of crassostrea gigas |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108531621B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112626238A (en) * | 2021-01-19 | 2021-04-09 | 浙江万里学院宁海海洋生物种业研究院 | Characteristic sequence for identifying crassostrea sikamea, specificity identification primer and identification method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506162A (en) * | 2016-01-31 | 2016-04-20 | 中国海洋大学 | SNP marker related to rapid growth of pacific oysters and identification method as well as application thereof |
-
2018
- 2018-07-11 CN CN201810759495.4A patent/CN108531621B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506162A (en) * | 2016-01-31 | 2016-04-20 | 中国海洋大学 | SNP marker related to rapid growth of pacific oysters and identification method as well as application thereof |
Non-Patent Citations (2)
| Title |
|---|
| HAIGANG QI ET AL.: "Construction and evaluation of a high-density SNP array for the Pacific oyster (Crassostrea gigas)", 《PLOS ONE》 * |
| 陈钰等: "长牡蛎转化生长因子受体基因多态性与生长性状和糖原含量的相关性分析", 《中国海洋大学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112626238A (en) * | 2021-01-19 | 2021-04-09 | 浙江万里学院宁海海洋生物种业研究院 | Characteristic sequence for identifying crassostrea sikamea, specificity identification primer and identification method |
| CN112626238B (en) * | 2021-01-19 | 2022-02-22 | 浙江万里学院宁海海洋生物种业研究院 | Characteristic sequence for identifying crassostrea sikamea, specificity identification primer and identification method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108531621B (en) | 2021-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109182556B (en) | SNP molecular marker related to growth traits of pelteobagrus vachelli and application | |
| CN105506162B (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof | |
| CN109554486A (en) | SNP marker relevant to grass carp character and its application | |
| CN106701931A (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of micropterus salmoide L. 'excellent bass No. 1' and application of SNP marker | |
| CN110129455A (en) | A kind of application growing relevant molecular labeling in litopenaeus vannamei genetic breeding | |
| CN109182557B (en) | SNP molecular marker for identifying low dissolved oxygen tolerance and fullness of pelteobagrus vachelli and application thereof | |
| CN109280709A (en) | One kind molecular labeling relevant to pig growth and reproductive trait and application | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN108531621A (en) | A kind of and long relevant SNP site of oyster fast-growth | |
| CN108588242A (en) | A kind of SNP site of long oyster AHR genes | |
| CN108118100B (en) | SNP molecular marker for identifying and controlling formation of low-temperature yellowing character of Chinese cabbage leaves and application thereof | |
| CN110283929A (en) | The relevant SNP marker 5-160 of capsicum epidemic disease resistant gene and its specific primer and application | |
| CN110305981A (en) | The molecular labeling PG1524 and its detection method of a kind of Apricot Fruit hardness key gene and application | |
| KR101946162B1 (en) | Snp markers for discriminating raphanus sativus cultivar and uses thereof | |
| CN109504798A (en) | A kind of SNP marker and its application based on high-resolution solubility curve identification the operatic circle core size | |
| CN116162721A (en) | Molecular marker for distinguishing size of pumpkin fruits, identification method and application | |
| CN111705146B (en) | Molecular marker for identifying duck jute feather character and application thereof | |
| CN115058537A (en) | Kelp breeding method | |
| CN110041422A (en) | Micropterus salmoides grows relevant SNP site and its application | |
| CN110358855A (en) | Capsicum epidemic disease resistant gene SNP marker 5-156 and its specific primer and application | |
| CN110317897A (en) | The relevant SNP marker 5-162 of capsicum epidemic disease resistant gene and its specific primer and application | |
| CN111440791A (en) | Primer for marking cucumber fruit shape gene, gene sequence, detection method of cucumber fruit shape and application | |
| CN111334597A (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN109136392A (en) | Mostly for the genetic diversity identification method and reagent of meiosis gynogenesis megalobrama amblycephala |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |